Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Jul 24.
Published in final edited form as: Curr Biol. 2026 Jun 17;36(13):3380–3387.e3. doi: 10.1016/j.cub.2026.05.043

Disinhibition of cerebellar output by loss of Restless Legs Syndrome-associated gene MEIS1

William Joo 1,2,3, Joo Won Choi 2, Alexander F Schier 1,2,3,4
PMCID: PMC13392613  NIHMSID: NIHMS2188443  PMID: 42309051

SUMMARY

Genome-wide association studies have identified risk variants for Restless Legs Syndrome (RLS)1–6, but the behavioral functions and sites of action of the corresponding genes remain unknown. Here, we analyze zebrafish mutants for candidate RLS genes, and find that meis1b is required for normal locomotion behavior and cerebellar development. Neuronal manipulation experiments indicate that loss of meis1b perturbs locomotor behavior by generating abnormal cerebellar output - a mechanism reminiscent of movement disorders such as ataxia and dystonia.

eTOC Blurb

Joo et al. investigate the behavioral functions of genes associated with Restless Legs Syndrome, and discover crucial roles for meis1b in zebrafish locomotor behavior and cerebellar development. Neuronal manipulation experiments indicate that loss of meis1b perturbs locomotion by disinhibiting cerebellar outputs.

Graphical Abstract

graphic file with name nihms-2188443-f0001.jpg

RESULTS

Restless Legs Syndrome (RLS) is a sensorimotor disorder characterized by an uncomfortable and irresistible urge to move, which can significantly disrupt sleep and quality of life7. The pathogenic mechanisms and relevant brain circuitry remain mysterious. Positive family history exists for up to 60% of idiopathic cases, while monozygotic twins exhibit concordance rates as high as 83%, indicating strong genetic contributions1. While family linkage studies have not identified causal genes, genome-wide association studies isolated multiple risk loci, providing an entry point to explore the molecular processes that contribute to RLS. The implicated genes include MEIS1, BTBD9, MAP2K5, SKOR1, PTPRD, and TOX32–6, but the functions of these candidates are poorly understood. Here, we use larval zebrafish to define how these genes impact behavior and brain activity, and discover crucial roles for MEIS1 in locomotion patterns and cerebellar development.

To determine the behavioral functions of RLS-associated genes, we generated knockouts for the zebrafish orthologs and analyzed spontaneous swim movements between 5–7 days post-fertilization (dpf). Individual movements were automatically tracked during natural day/night cycles, and movement bouts were classified as movement sequences separated by longer than 1 second, as in previous studies8–10 (Figure 1B). Map2k5 mutants were lethal by 6 dpf, while meis1a, btbd9, ptprda, ptprdb, and tox3 mutants showed minimal changes in spontaneous behavior (Figure S1A–B). In contrast, meis1b mutants exhibited profoundly altered locomotor bout structure. Homozygous mutants initiated fewer movement bouts relative to wild-type and heterozygous sibling controls, while movement bout duration was ~2 fold longer during both day and night periods (Figure 1C–D). The amplitude of individual movements was also larger during the day period in mutants relative to controls (Figure S2B). Meis1b is thus required for normal locomotion patterns.

Figure 1. Meis1b is required for normal locomotor behavior.

Figure 1.

Open in a new tab

(A) Outline of the experiment. The chosen Restless legs syndrome (RLS) risk loci implicate 6 human genes, corresponding to 9 zebrafish orthologs. Mutant lines were generated for all 9 orthologs, and both spontaneous locomotion and brain anatomy were analyzed.

(B) Schematic of movement bout quantifications. Trains of individual movements were classified as distinct bouts if separated by ≥ 1 second.

(C) 3 minute locomotion activity traces for 3 representative wild-type or meis1b mutant larvae at 6 days post fertilization (dpf). Top rows, Day phase locomotion. Bottom rows, Night phase locomotion. Each vertical bar represents a second with locomotion, with black indicating periods of rest. Color scale corresponds to movement amplitude in pixels. Scalebar, 30 seconds.

(D) Meis1b mutants exhibit less frequent and longer movement bouts. Left panels, Movement bout frequency and bout length. Right panels, Bout length. Shaded plots correspond to night phase data. Each data point indicates mean values for one larva. White, wild-type (n=65). Gray, heterozygous (n=142). Red, homozygous (n=46). ****p<0.0001, One-way ANOVA with Tukey’s multiple comparisons test.

See also Figure S1.

MEIS1 (myeloid ectopic viral integration site 1) is a homeodomain-containing transcription factor with diverse developmental functions11–14, and exhibits the strongest genetic association with RLS symptoms3,7. To assess how loss of meis1b alters brain activity and morphology, we mapped the distribution of phospho-ERK, a marker of neuronal activity15. Immunostained whole brains from 6dpf mutant and control larvae were registered to a common brain atlas, allowing quantitative comparison of phospho-ERK levels relative to total ERK levels. Meis1b mutants exhibited strongly perturbed phospho-ERK patterns in the cerebellum, with both increased and decreased signals in adjacent parts of the anterior region (Figure 2A). To test whether loss of meis1b also perturbs brain structure, we statistically compared deformations of the total ERK channel relative to a reference larval brain atlas. This deformation-based morphometry analysis revealed patches of decreased cerebellar volume that overlapped with phospho-ERK deficits (Figure 2B–C). These results indicate abnormal cerebellar structure in meis1b mutants.

Figure 2. Loss of meis1b perturbs cerebellar activation and structure.

Figure 2.

Open in a new tab

(A) Meis1b mutants exhibit perturbed pERK signals in the cerebellum at 6 days post-fertilization (dpf). Sum-of-slices projection of significant differences between meis1b mutant and wild type larvae, shown in horizontal orientation (top-down view). Green, increased pERK signal.

Magenta, decreased pERK signal. White line indicates boundaries of the larval brain.

(B) Single section from panel A. Grayscale, elavl3-H2B-RFP+ neurons. Orange box focuses on cerebellum, shown in panel C.

(C) Single section of cerebellum (white outline) with differences in pERK (top) or morphology (bottom).

(D) Schematic of the ventricular zone (VZ, shaded area) in ventral cerebellum at 3 dpf.

(E) Meis1b protein is enriched in the VZ, as well as in putative mature cells within the cerebellum.

Magenta, ptf1a-GAL4 > UAS-mCherry. Green, Meis1b immunostaining.

(F) Schematic of the upper rhombic lip (URL, shaded area), dorsal to the VZ plane.

(G) Meis1b expression in the URL. Magenta, atoh1c-GAL4 > UAS-Kaede. Kaede was visualized by immunostaining. Scale bars, 50 um.

See also Figure S2.

Cerebellar circuitry and cell types are conserved between mammals and zebrafish16,17. Purkinje cells receive parallel fiber inputs from granule cells and climbing fiber inputs from the inferior olive. In turn, Purkinje cells send inhibitory projections to intermingled eurydendroid cells - the teleost equivalent to mammalian deep cerebellar nuclei neurons - which send cerebellar outputs to the rest of the brain. To visualize meis1b distribution during cerebellar development, we stained larvae with a Meis1b antibody14 at 3dpf. Meis1b protein was expressed in ptf1a+ ventricular zone precursors, which generate Purkinje cells, as well as atoh1c+ upper rhombic lip precursors, which generate granule cells18–20 (Figure 2D–G). Within the ventricular zone, meis1b was particularly enriched in the anterior-medial region. Consistent with these observations, larval zebrafish single-cell RNA sequencing21 revealed meis1b expression in both ptf1a+/neurog1+ precursors and atoh1c+ rhombic lip cells (Figure S2A). MEIS1 is also enriched in ventricular zone and rhombic lip precursors in mice and humans22,23, indicating common cerebellar expression patterns across species.

To identify the anatomical defects underlying perturbed pERK signals, we further examined Purkinje cells and granule cells using histological markers and transgenic lines16,24,25. Strikingly, 100% of meis1b mutants lost an anterior subpopulation of Parvalbumin+ Purkinje cells, consistent with reduced anterior volume in pERK morphometry analyses (Figure 3A–B, Figure S2C). Anterior Purkinje cells were absent by 3 dpf, when the earliest-born Purkinje cells differentiate, and remained missing at 5 and 7dpf. Indeed, Purkinje cell number increased between 3–7dpf in controls, but stalled after 5dpf in mutants (Figure S2D). Meis1b mutants also exhibited perturbed granule cell and climbing fiber inputs. 90A-GAL4+, and 152B-GAL4+, and trpc-GAL4+ granule cell numbers were reduced, while 23C-GAL4+ granule cell number was expanded in the posterior cerebellum (Figure 3C and Figure S2E–F). Furthermore, 28C-GAL4+ climbing fibers also exhibited strong structural defects (Figure 3C). Meis1b is thus crucial for the development of cerebellar Purkinje cells, and is also required for proper differentiation of neurons that provide Purkinje cell inputs. In contrast, eurydendroid cells, the postsynaptic targets of Purkinje cells, did not exhibit major cell loss. Indeed, eurydendroid cells in the anterior cerebellum remained in place despite loss of neighboring Purkinje cells (Figure 3D).

Figure 3. Meis1b is required for cerebellar development.

Figure 3.

Open in a new tab

(A) Schematic of Purkinje neurons (green) and parallel fibers (magenta) in the cerebellum between 3–7 days post-fertilization (dpf). Only sparse parallel fibers are shown for clarity.

(B) Comparison of Purkinje cells (Pvalb7+, green) and parallel fibers (Vglut1+, magenta) in wild-type (top row) and meis1b mutant larvae (bottom row). Meis1b mutants exhibit Purkinje cell loss at 3, 5, and 7 dpf. Dotted line indicates anterior boundary of the cerebellum.

(C) 5 dpf meis1b mutants exhibit defects in granule cell populations labeled by 90A-GAL4, 152B-GAL4, and 23C-GAL4 (left panels), as well as climbing fiber axons labeled by 28C-GAL4 (right). Green, UAS-GFP.

(D) 6 dpf meis1b mutants exhibit loss of Purkinje cells (Parvalbumin+, Magenta) but not eurydendroid cells (Olig2-GFP+, Green). Scale bars, 50 um.

See also Figure S2.

Based on these observations, we hypothesized that abnormal cerebellar output may underlie behavioral defects in meis1b mutants. Specifically, Purkinje cell loss may disinhibit eurydendroid cells, generating hyperactive or abnormal outputs that perturb locomotor behavior. To test this idea, we chronically silenced ptf1a-GAL4+ Purkinje cells by expressing BoTxBLC-GFP, an optimized botulinum neurotoxin that cleaves SNARE proteins to eliminate synaptic transmission26. Larvae with silenced Purkinje cells exhibited expanded locomotor bout length relative to controls, much like meis1b mutants (Figure 4A–B). This effect was specific to ptf1a-GAL4+ cells, as expressing BoTxBLC-GFP in granule cells or inferior olive cells had no significant effect on locomotor bout length. Specifically silencing ptf1a+ Purkinje cells thus mimics the abnormal bout length phenotype of meis1b mutants.

Figure 4. Disinhibited cerebellar output perturbs locomotor bout duration.

Figure 4.

Open in a new tab

(A) Simplified schematic of principal cerebellar cell types.

(B) Locomotor activity bout length phenotypes of genetically targeted neuronal manipulation experiments. UAS-BoTxBLC or UAS-Scn5a was expressed in Purkinje cells, granule cells, inferior olive cells, or eurydendroid cells using indicated GAL4 lines. Here and in subsequent panels, whiskers indicate minimum and maximum values, boxes extend from 25th to 75th percentiles, and line in box indicates median values. Filled gray circles indicate presence of transgene. Numbers above each column indicate sample size. Meis1b data (left-most columns) was duplicated from Figure 1 for comparison. ****p<0.0001, One-way ANOVA with Tukey’s multiple comparisons test.

(C) Left, schematic of eurydendroid cell-based rescue experiments. Right, Dual silencing of ptf1a-GAL4+ cells and 156A-GAL4+ eurydendroid cells rescues locomotor bout length. Numbers above each column indicate sample size. **p<0.01, ****p<0.0001, One-way ANOVA with Tukey’s multiple comparisons test.

(D) Silencing eurydendroid cells rescues the expanded locomotor bout length of meis1b mutants. Numbers above each column indicate sample size. *p<0.05, **p<0.01, One-way ANOVA with Tukey’s multiple comparisons test.

(E) Model of disinhibited cerebellum outputs in meis1b mutants. Purkinje cell loss-of-function in meis1b mutants generates abnormal output from eurydendroid cells, leading to expanded locomotor bout lengths. Inhibiting eurydendroid cells can ameliorate the bout length phenotype.

See also Figures S2–S4.

If eurydendroid cell disinhibition drives expanded bout lengths, directly manipulating eurydendroid cell activity should modulate locomotor bout lengths and rescue the effects of Purkinje cell silencing. Indeed, silencing eurydendroid cells reduced locomotor bout length, while increasing their excitability by expressing the sodium channel subunit Scn5a27 strongly expanded bout length (Figure 4B and Figure S2G–H). To test whether eurydendroid cell silencing can rescue the expanded bout length phenotype of Purkinje cell silencing, we expressed BoTxBLC in both populations. Larvae expressing BoTxBLC only in ptf1a+ cells exhibited long locomotor bouts as previously observed, and additionally silencing eurydendroid cells restored bout lengths to control durations (Figure 4C). Lastly, we tested whether eurydendroid cell silencing can rescue the meis1b mutant phenotype. Indeed, silencing eurydendroid cells restored the expanded bout lengths of meis1b mutants to sibling control levels (Figure 4D). Cumulatively, our neuronal manipulation experiments suggest that Purkinje cell loss in meis1b mutants disinhibits eurydendroid cells, which in turn perturb locomotion through abnormal activity patterns (Figure 4E).

DISCUSSION

Despite the discovery of genes linked to RLS, the neuroanatomical underpinnings of the disease remain poorly understood. In this study, we reveal crucial roles for the RLS-associated gene MEIS1 in locomotor behavior and cerebellar development. Previous studies have shown that specific MEIS1 risk alleles are associated with reduced MEIS1 expression in human tissues28 or reduced MEIS1 enhancer activity29. While MEIS1 has also been studied in knockout mice, the embryonic lethality of homozygous mutants30,31 has hampered efforts to dissect its behavioral functions and corresponding neural circuits. Interestingly, cerebellar granule cell progenitor-specific Meis1 conditional deletion perturbs granule cell development in mice13, but the behavioral relevance of this manipulation remains unknown. Our zebrafish mutant analyses complement these previous approaches, and suggest a model in which aberrant cerebellar outputs from disinhibited eurydendroid cells drive abnormal locomotion patterns. Consistent with this idea, previous studies have demonstrated that cerebellum activity can generate or perturb motor outputs in both fish and mammals32–35. While zebrafish mutants cannot model the full complexity of human RLS symptoms, our results raise the possibility that cerebellar disinhibition might contribute to RLS phenotypes.

Indeed, the cerebellar disinhibition model conceptually resembles proposed mechanisms for ataxia and dystonia. Purkinje cell loss is a common hallmark of ataxias, and abnormal cerebellar activity patterns are thought to drive distinct ataxic or dystonic phenotypes36,37. Silencing or neuromodulation of deep cerebellar nuclei can alleviate motor symptoms in ataxic or dystonic mice38–40, just as silencing eurydendroid cells rescues the abnormal locomotion bouts of meis1b mutants. Intriguingly, RLS symptoms occur more frequently in patients with specific cerebellar ataxias41, as well as patients with the type 1 Chiari malformation42,43, a downward displacement of the cerebellum into the foramen magnum. Furthermore, neuroimaging studies in RLS patients have found hyperactive or abnormal cerebellar signals at resting state or during periodic limb movements, although numerous other brain regions have also been implicated44,45. These observations are not well-understood, and possible cerebellar dysfunction in RLS awaits more detailed studies in humans. However, these connections hint at shared cerebellar pathology between RLS and other movement disorders.

In line with this idea, zebrafish orthologs for another RLS-associated gene, SKOR1, are specifically expressed in cerebellar Purkinje cells21,46,47 (Figure S3). Strikingly, we found that skor1a/b mutants behaviorally phenocopied meis1b mutants, with drastically lengthened activity bouts (Figure S4A–C). Like meis1b mutants, skor1a/b mutants also exhibited perturbed cerebellar activity patterns in pERK analyses (Figure S4D). However, skor1a/b mutants did not exhibit Purkinje cell loss, consistent with previous results47, suggesting functional deficits rather than major structural defects (Figure S4E). We also observed that clinically effective RLS treatment drugs shortened locomotor bouts, prominently altered cerebellar pERK patterns, and rescued meis1b phenotypes (Figure S4F–H). Multiple RLS-associated genes and RLS treatments thus functionally converge on the cerebellum. Although the RLS-associated locus on chromosome 15 lies between SKOR1 and MAP2K5, our observations suggest that SKOR1 drives the association. Furthermore, MEIS1 may regulate SKOR1, as MEIS1 risk variants correlate with reduced SKOR1 expression in RLS patient-derived tissue samples, and MEIS1 can directly bind the SKOR1 upstream region48. In summary, our study highlights potential cerebellar contributions to RLS symptoms, and provides a foundation to further elucidate the corresponding neural circuits and molecular mechanisms.

RESOURCE AVAILABILITY

Lead contact

Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Alexander F. Schier (alex.schier@unibas.ch).

Materials availability

All unique/stable reagents generated in this study will be made available upon request by the lead contact.

Data and code availability

Data reported in this paper will be shared by the lead contact upon request. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

STAR★METHODS

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

All animal-related protocols and procedures were approved by the Harvard University Faculty of Arts & Sciences Standing Committee on the Use of Animals and the Basel-Stadt cantonal Veterinary Office Committees for Animal Experimentation. Zebrafish were raised at 28.5°C on a standard 14h:10h light:dark cycle. All behavioral experiments were conducted with the same light cycle and temperature. Embryos were grown in 150 mm petri dishes in E3 medium with methylene blue, at a density of ~100 larvae per dish. Debris was removed and medium replaced twice before 4 dpf. All fish were genotyped by PCR. Mutants were generated by injecting a mix of 2–4 gRNAs and ~0.5nL of 50 uM Cas9 protein into TL/AB embryos at the 1-cell stage. See Figure S1 and Key Resources Table for details on mutant alleles and corresponding sgRNA target sequences. Resulting mosaic adults were screened for germline transmission of desired deletion alleles by mating to wild-type TL/AB fish, and positive progeny were further crossed to generate homozygous mutants. Fish lines used for anatomical analyses include: TgBAC(ptf1a:GAL4-VP16)50, Tg(ptf1a-DsRed)19, Tg(UAS-NfsB-mCherry)51, Tg(atoh1c:gal4ff)fh43020, Tg(UAS:kaede)s199952, Tg(olig2-EGFP)53, Tg(olig2-DsRed)54, gSA2AzGFF152B25, hspGFFDMC90A25, gSIAGFF23C25, hspGFFDMC28C25, hspzGFFgDMC156A25, trpc2-GAL455, Tg(UAS:BoTxBLC-GFP)34b26, and Tg(UAS-E1b:BGi-SCN5a-v2a-TagRFPT)y26627.

KEY RESOURCES TABLE.

REAGENT OR RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit anti-Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) Cell Signaling Technology 4730; AB_2315112
Rabbit anti-RFP Rockland 600-401-379; AB_2209751
Chicken anti-GFP Aves GFP-1020; AB_10000240
Rabbit anti-Kaede MBL International PM012; AB_592060
Mouse anti-Meis1 Pillay et al.49 P2A6
Mouse anti-Parvalbumin Sigma MAB1572; AB_2174013
Mouse anti-Pvalb7 Bae et al.16 N/A
Rabbit anti-Vglut1 Bae et al.16 N/A
Chemicals, peptides, and recombinant proteins
Pramipexole hydrochloride Sigma A1237
Ropinerole hydrochloride Sigma R2530
Experimental models: Organisms/strains
Zebrafish: TgBAC(ptf1a:GAL4-VP16) Parsons et al.50 ZDB-ALT-100929-1
Zebrafish: Tg(ptf1a-DsRed) Kaslin et al.19 ZDB-ALT-101201-1
Zebrafish: Tg(atoh1c:gal4ff)fh430 Kidwell et al.20 ZDB-ALT-180828-2
Zebrafish: Tg(UAS-NfsB-mCherry) Davison et al.51 ZDB-ALT-070316-1
Zebrafish: Tg(UAS:kaede)s1999 Scott et al.52 ZDB-ALT-070314-1
Zebrafish: Tg(olig2-EGFP) Shin et al.53 ZDB-ALT-041129-8
Zebrafish: Tg(olig2-DsRed) Kucenas et al.54 ZDB-ALT-080321-2
Zebrafish: gSA2AzGFF152B Takeuchi et al.25 ZDB-ALT-150409-3
Zebrafish: hspGFFDMC90A Takeuchi et al.25 ZDB-ALT-150409-6
Zebrafish: gSIAGFF23C Takeuchi et al.25 ZDB-ALT-150409-11
Zebrafish: hspGFFDMC28C Takeuchi et al.25 ZDB-ALT-150409-1
Zebrafish: hspzGFFgDMC156A Takeuchi et al.25 ZDB-ALT-150409-7
Zebrafish: trpc2-GAL4 DeMaria et al.55 ZDB-ALT-140818-2
Zebrafish: Tg(UAS:zBoTxBLC-GFP)34b Sternberg et al26 ZDB-ALT-160119-9
Zebrafish: Tg(UAS-E1b:BGi-SCN5a-v2a-TagRFPT)y266 Tabor et al.27 ZDB-ALT-141113-5
Zebrafish: meis1a mutant This study N/A
Zebrafish: meis1b mutant This study N/A
Zebrafish: btbd9 mutant This study N/A
Zebrafish: ptprda mutant This study N/A
Zebrafish: ptprdb mutant This study N/A
Zebrafish: tox3 mutant This study N/A
Zebrafish: skor1a mutant This study N/A
Zebrafish: skor1b mutant This study N/A
Oligonucleotides
meis1a guide RNA 1/4: ggtccactacggcatggatg This study N/A
meis1a guide RNA 2/4: gatgtacggggatcctcacg This study N/A
meis1a guide RNA 3/4: tgcgggtacgggtgcagcgg This study N/A
meis1a guide RNA 4/4: agcgcgtcgttaacgggcgg This study N/A
meis1b guide RNA 1/4: ctactccgtccatcccatag This study N/A
meis1b guide RNA 2/4: tgcatggatctggcggcgtg This study N/A
meis1b guide RNA 3/4: tactggtgggagtggagctg This study N/A
meis1b guide RNA 4/4: tgggcggcatggcgttggtg This study N/A
btbd9 guide RNA 1/4: gcggagttcatcggccgcag This study N/A
btbd9 guide RNA 2/4: gctctgacaggagatgcagg This study N/A
btbd9 guide RNA 3/4: cgatgtcacattcgtggtgg This study N/A
btbd9 guide RNA 4/4: tgcacacagggtcattctag This study N/A
ptprda guide RNA 1/4: tgacgctcatgcgtgcgcag This study N/A
ptprda guide RNA 2/4: catccacgactcgctgcagg This study N/A
ptprda guide RNA 3/4: gtttcgggccggtacttcgg This study N/A
ptprda guide RNA 4/4: actcgatctgcgtcagcttc This study N/A
ptprdb guide RNA 1/4: atcggtggcacagagaatcg This study N/A
ptprdb guide RNA 2/4: gattatgagatcatgccggg This study N/A
ptprdb guide RNA 3/4: catcacctgtcaggcggtgg This study N/A
ptprdb guide RNA 4/4: gtcttctggtgtcaaatcct This study N/A
tox3 guide RNA 1/3: tactccaagtctgggtgacg This study N/A
tox3 guide RNA 2/3: gacgtgggctcaccttaccc This study N/A
tox3 guide RNA 3/3: accatcctaaccctcagcgg This study N/A
skor1a guide RNA 1/4: cggtgcagttggagatcctg This study N/A
skor1a guide RNA 2/4: gatcatgccacagcggcgcg This study N/A
skor1a guide RNA 3/4: ccccgagaaaggatttgcag This study N/A
skor1a guide RNA 4/4: aaattctcgggtaatttggg This study N/A
skor1b guide RNA 1/4: gaggatctccagctggaccg This study N/A
skor1b guide RNA 2/4: cccatttcctcgagacgctg This study N/A
skor1b guide RNA 3/4: ctggtaatttcggcgggctg This study N/A
skor1b guide RNA 4/4: acgtgtcgcacgaatgcgcg This study N/A
Software and algorithms
Zeiss ZEN Blue Zeiss SCR_013672
Zebrafish tracking software Woods et al8, Joo et al56 N/A
MATLAB R2016, R2020b Mathworks SCR_001622
Python Python Software Foundation SCR_008394
Graphpad Prism 10 Graphpad SCR_002798
Fiji/ImageJ https://imagej.net/ SCR_003070
Adobe Photoshop Adobe SCR_014199
Adobe Illustrator Adobe SCR_010279
Open in a new tab

METHOD DETAILS

Behavior

Behavioral experiments were conducted between 4–7dpf. Larvae were transferred from petri dishes to 96-square-well 0.7mL plates (E&K Scientific) on 4 dpf. To avoid water evaporation, plates were sealed with optical adhesive films (Thermofisher Scientific, Cat# 4311971). Spontaneous locomotion was automatically tracked in custom behavior boxes56 at ~30 frames-per-second with 1088 × 660-pixel resolution using a Grasshopper3 camera (FLIR). For pramipexole and ropinerole exposure experiments, larvae were placed in unsealed plates and 10mM stock solution was directly added to each well for a final concentration of 15uM. Genotypes for all larvae were determined post-hoc using PCR, and locomotion patterns were analyzed with Matlab and Python software. Unhealthy larvae without swim bladders were excluded from behavioral experiments.

pERK Analyses and Immunostaining

Larvae were raised under standard conditions and fed paramecia at 5 dpf. On 6 dpf, water was replaced to remove any residual paramecia, and fish were maintained in an undisturbed environment for at least 3h before fixation with ice-cold 4% PFA in 1x PBS, 0.25% Triton-X (PBSTx). After overnight fixation, larvae were washed 3 × 20 minutes in PBSTx before bleaching in 1% H2O2/3% KOH solution to remove pigment. Larvae were then washed 3x in PBSTx and permeabilized on ice with pre-chilled 0.05% Trypsin-EDTA for 20 minutes. Trypsin was removed with PBSTx washes, and samples were incubated in blocking solution (PBSTx with 2% normal goat serum, 1% bovine serum albumin, 1% dimethyl sulfoxide) for 1h, followed by primary antibody staining in blocking solution for 2 days. Phosphorylated ERK antibody (Cell Signaling, #4370) and total ERK antibody (Cell Signaling, #4696) were diluted 1:500. After 3 × 20 min washes, samples were incubated in Alexa fluorophore-conjugated secondary antibody (Life Technologies) solution for 2 days. Larvae were then mounted in 2% low-melting agarose/PBS, and imaged on a Zeiss LSM780 upright confocal microscope with a 20X/1.0 NA water-dipping objective, or a Zeiss inverted LSM800 with 25x/0.80 objective. Larvae were removed from agarose for genotyping post-imaging. pERK and deformation-based morphometry were analyzed as previously described15,57. Immunostaining and imaging for other markers was performed similarly to pERK. Primary antibodies were Rabbit anti-RFP (Rockland 600–401-379, 1:500), Chicken anti-GFP (Aves Labs, 1:1000), Rabbit anti-Kaede (1:500, MBL PM012), Mouse anti-Meis1 (P2A6 hybridoma supernatant, 1:500)49, Mouse anti-Parvalbumin (Sigma MAB1572, 1:500), Mouse anti-Pvalb7 (1:1000)16, and Rabbit anti-Vglut1 (1:1000)16.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical tests were performed as indicated in the figure legends using Matlab and Graphpad Prism v9 and v10. All other statistical details are provided in the figures and legends. Figures were created using ImageJ, Adobe Photoshop, and Adobe Illustrator. Exon/intron diagrams in Figure S1 were created using the Exon-Intron Graphic Maker (http://wormweb.org/exonintron), with protein domain annotations from Interpro (https://www.ebi.ac.uk/interpro/).

Supplementary Material

1

SUPPLEMENTAL INFORMATION

Document S1. Figures S1–S4.

Highlights.

  • Meis1b is required for normal locomotor behavior in zebrafish larvae

  • Meis1b is crucial for cerebellar development

  • Loss of meis1b perturbs larval locomotion by disinhibiting cerebellar output

ACKNOWLEDGMENTS

We thank the laboratories of Michael Brand, Harold Burgess, Masahiko Hibi, Koichi Kawakami, Cecilia Moens, Michael Parsons, and Andrew Waskiewicz, as well as the Zebrafish National BioResource Project (NBRP), for generously providing zebrafish lines and reagents; Professor Richard Losick and the Harvard University Department of Cellular and Molecular Biology for scientific support; the Biozentrum Imaging Core Facility for imaging support; and members of the Schier laboratory for comments on the manuscript. This work was financially supported by a Research Fellowship from the Harvard Division of Sleep Medicine Training Program in Sleep, Circadian, and Respiratory Neurobiology to W.J. and a grant from the Swiss National Science Foundation to A.F.S. (Grant 197827).

Footnotes

DECLARATION OF INTERESTS

A.F.S. is a scientific advisor to Novartis.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • 1.Rye DB (2015). The Molecular Genetics of Restless Legs Syndrome. Sleep Med Clin 10, 227–233, xii. 10.1016/j.jsmc.2015.05.015. [DOI] [PubMed] [Google Scholar]
  • 2.Stefansson H, Rye DB, Hicks A, Petursson H, Ingason A, Thorgeirsson TE, Palsson S, Sigmundsson T, Sigurdsson AP, Eiriksdottir I, et al. (2007). A genetic risk factor for periodic limb movements in sleep. N Engl J Med 357, 639–647. 10.1056/NEJMoa072743. [DOI] [PubMed] [Google Scholar]
  • 3.Winkelmann J, Schormair B, Lichtner P, Ripke S, Xiong L, Jalilzadeh S, Fulda S, Putz B, Eckstein G, Hauk S, et al. (2007). Genome-wide association study of restless legs syndrome identifies common variants in three genomic regions. Nat Genet 39, 1000–1006. 10.1038/ng2099. [DOI] [PubMed] [Google Scholar]
  • 4.Schormair B, Kemlink D, Roeske D, Eckstein G, Xiong L, Lichtner P, Ripke S, Trenkwalder C, Zimprich A, Stiasny-Kolster K, et al. (2008). PTPRD (protein tyrosine phosphatase receptor type delta) is associated with restless legs syndrome. Nat Genet 40, 946–948. 10.1038/ng.190. [DOI] [PubMed] [Google Scholar]
  • 5.Vilarino-Guell C, Farrer MJ, and Lin SC (2008). A genetic risk factor for periodic limb movements in sleep. N Engl J Med 358, 425–427. 10.1056/NEJMc072518. [DOI] [PubMed] [Google Scholar]
  • 6.Winkelmann J, Czamara D, Schormair B, Knauf F, Schulte EC, Trenkwalder C, Dauvilliers Y, Polo O, Hogl B, Berger K, et al. (2011). Genome-wide association study identifies novel restless legs syndrome susceptibility loci on 2p14 and 16q12.1. PLoS Genet 7, e1002171. 10.1371/journal.pgen.1002171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Manconi M, Garcia-Borreguero D, Schormair B, Videnovic A, Berger K, Ferri R, and Dauvilliers Y (2021). Restless legs syndrome. Nat Rev Dis Primers 7, 80. 10.1038/s41572-021-00311-z. [DOI] [PubMed] [Google Scholar]
  • 8.Woods IG, Schoppik D, Shi VJ, Zimmerman S, Coleman HA, Greenwood J, Soucy ER, and Schier AF (2014). Neuropeptidergic signaling partitions arousal behaviors in zebrafish. J Neurosci 34, 3142–3160. 10.1523/JNEUROSCI.3529-13.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chiu CN, and Prober DA (2013). Regulation of zebrafish sleep and arousal states: current and prospective approaches. Front Neural Circuits 7, 58. 10.3389/fncir.2013.00058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Barlow IL, and Rihel J (2017). Zebrafish sleep: from geneZZZ to neuronZZZ. Curr Opin Neurobiol 44, 65–71. 10.1016/j.conb.2017.02.009. [DOI] [PubMed] [Google Scholar]
  • 11.Moens CB, and Selleri L (2006). Hox cofactors in vertebrate development. Dev Biol 291, 193–206. 10.1016/j.ydbio.2005.10.032. [DOI] [PubMed] [Google Scholar]
  • 12.Jiang M, Xu S, Bai M, and Zhang A (2021). The emerging role of MEIS1 in cell proliferation and differentiation. Am J Physiol Cell Physiol 320, C264–C269. 10.1152/ajpcell.00422.2020. [DOI] [PubMed] [Google Scholar]
  • 13.Owa T, Taya S, Miyashita S, Yamashita M, Adachi T, Yamada K, Yokoyama M, Aida S, Nishioka T, Inoue YU, et al. (2018). Meis1 Coordinates Cerebellar Granule Cell Development by Regulating Pax6 Transcription, BMP Signaling and Atoh1 Degradation. J Neurosci 38, 1277–1294. 10.1523/JNEUROSCI.1545-17.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Erickson T, French CR, and Waskiewicz AJ (2010). Meis1 specifies positional information in the retina and tectum to organize the zebrafish visual system. Neural Dev 5, 22. 10.1186/1749-8104-5-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Randlett O, Wee CL, Naumann EA, Nnaemeka O, Schoppik D, Fitzgerald JE, Portugues R, Lacoste AM, Riegler C, Engert F, and Schier AF (2015). Whole-brain activity mapping onto a zebrafish brain atlas. Nat Methods 12, 1039–1046. 10.1038/nmeth.3581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bae YK, Kani S, Shimizu T, Tanabe K, Nojima H, Kimura Y, Higashijima S, and Hibi M (2009). Anatomy of zebrafish cerebellum and screen for mutations affecting its development. Dev Biol 330, 406–426. 10.1016/j.ydbio.2009.04.013. [DOI] [PubMed] [Google Scholar]
  • 17.Pose-Mendez S, Schramm P, Valishetti K, and Koster RW (2023). Development, circuitry, and function of the zebrafish cerebellum. Cell Mol Life Sci 80, 227. 10.1007/s00018-023-04879-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kani S, Bae YK, Shimizu T, Tanabe K, Satou C, Parsons MJ, Scott E, Higashijima S, and Hibi M (2010). Proneural gene-linked neurogenesis in zebrafish cerebellum. Dev Biol 343, 1–17. 10.1016/j.ydbio.2010.03.024. [DOI] [PubMed] [Google Scholar]
  • 19.Kaslin J, Kroehne V, Benato F, Argenton F, and Brand M (2013). Development and specification of cerebellar stem and progenitor cells in zebrafish: from embryo to adult. Neural Dev 8, 9. 10.1186/1749-8104-8-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kidwell CU, Su CY, Hibi M, and Moens CB (2018). Multiple zebrafish atoh1 genes specify a diversity of neuronal types in the zebrafish cerebellum. Dev Biol 438, 44–56. 10.1016/j.ydbio.2018.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sur A, Wang Y, Capar P, Margolin G, Prochaska MK, and Farrell JA (2023). Single-cell analysis of shared signatures and transcriptional diversity during zebrafish development. Dev Cell 58, 3028–3047 e3012. 10.1016/j.devcel.2023.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sepp M, Leiss K, Murat F, Okonechnikov K, Joshi P, Leushkin E, Spanig L, Mbengue N, Schneider C, Schmidt J, et al. (2024). Cellular development and evolution of the mammalian cerebellum. Nature 625, 788–796. 10.1038/s41586-023-06884-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zimmerman AJ, Del Valle EA, Pahl MC, Doldur-Balli F, Keenan BT, Liu PZ, Shetty ZY, Tsundupalli TR, Palermo J, Krishnan A, et al. (2025). Cross-species variant-to-function analyses implicate MEIS1 in conferring sleep abnormalities and impaired cerebellar development. bioRxiv, 2025.2008.2005.665539. 10.1101/2025.08.05.665539. [DOI] [PubMed] [Google Scholar]
  • 24.Asakawa K, Suster ML, Mizusawa K, Nagayoshi S, Kotani T, Urasaki A, Kishimoto Y, Hibi M, and Kawakami K (2008). Genetic dissection of neural circuits by Tol2 transposon-mediated Gal4 gene and enhancer trapping in zebrafish. Proc Natl Acad Sci U S A 105, 1255–1260. 10.1073/pnas.0704963105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Takeuchi M, Matsuda K, Yamaguchi S, Asakawa K, Miyasaka N, Lal P, Yoshihara Y, Koga A, Kawakami K, Shimizu T, and Hibi M (2015). Establishment of Gal4 transgenic zebrafish lines for analysis of development of cerebellar neural circuitry. Dev Biol 397, 1–17. 10.1016/j.ydbio.2014.09.030. [DOI] [PubMed] [Google Scholar]
  • 26.Sternberg JR, Severi KE, Fidelin K, Gomez J, Ihara H, Alcheikh Y, Hubbard JM, Kawakami K, Suster M, and Wyart C (2016). Optimization of a Neurotoxin to Investigate the Contribution of Excitatory Interneurons to Speed Modulation In Vivo. Curr Biol 26, 2319–2328. 10.1016/j.cub.2016.06.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Tabor KM, Bergeron SA, Horstick EJ, Jordan DC, Aho V, Porkka-Heiskanen T, Haspel G, and Burgess HA (2014). Direct activation of the Mauthner cell by electric field pulses drives ultrarapid escape responses. J Neurophysiol 112, 834–844. 10.1152/jn.00228.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Xiong L, Catoire H, Dion P, Gaspar C, Lafreniere RG, Girard SL, Levchenko A, Riviere JB, Fiori L, St-Onge J, et al. (2009). MEIS1 intronic risk haplotype associated with restless legs syndrome affects its mRNA and protein expression levels. Hum Mol Genet 18, 1065–1074. 10.1093/hmg/ddn443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Spieler D, Kaffe M, Knauf F, Bessa J, Tena JJ, Giesert F, Schormair B, Tilch E, Lee H, Horsch M, et al. (2014). Restless legs syndrome-associated intronic common variant in Meis1 alters enhancer function in the developing telencephalon. Genome Res 24, 592–603. 10.1101/gr.166751.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hisa T, Spence SE, Rachel RA, Fujita M, Nakamura T, Ward JM, Devor-Henneman DE, Saiki Y, Kutsuna H, Tessarollo L, et al. (2004). Hematopoietic, angiogenic and eye defects in Meis1 mutant animals. EMBO J 23, 450–459. 10.1038/sj.emboj.7600038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Azcoitia V, Aracil M, Martinez AC, and Torres M (2005). The homeodomain protein Meis1 is essential for definitive hematopoiesis and vascular patterning in the mouse embryo. Dev Biol 280, 307–320. 10.1016/j.ydbio.2005.01.004. [DOI] [PubMed] [Google Scholar]
  • 32.Ahrens MB, Li JM, Orger MB, Robson DN, Schier AF, Engert F, and Portugues R (2012). Brain-wide neuronal dynamics during motor adaptation in zebrafish. Nature 485, 471–477. 10.1038/nature11057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Markov DA, Petrucco L, Kist AM, and Portugues R (2021). A cerebellar internal model calibrates a feedback controller involved in sensorimotor control. Nat Commun 12, 6694. 10.1038/s41467-021-26988-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Witter L, Canto CB, Hoogland TM, de Gruijl JR, and De Zeeuw CI (2013). Strength and timing of motor responses mediated by rebound firing in the cerebellar nuclei after Purkinje cell activation. Front Neural Circuits 7, 133. 10.3389/fncir.2013.00133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Heiney SA, Kim J, Augustine GJ, and Medina JF (2014). Precise control of movement kinematics by optogenetic inhibition of Purkinje cell activity. J Neurosci 34, 2321–2330. 10.1523/JNEUROSCI.4547-13.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.van der Heijden ME, Brown AM, Kizek DJ, and Sillitoe RV (2024). Cerebellar nuclei cells produce distinct pathogenic spike signatures in mouse models of ataxia, dystonia, and tremor. Elife 12. 10.7554/eLife.91483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jackson NN, Stagray JA, and Snell HD (2025). Cerebellar contributions to dystonia: unraveling the role of Purkinje cells and cerebellar nuclei. Dystonia 4. 10.3389/dyst.2025.14006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.van der Heijden ME, and Sillitoe RV (2023). Cerebellar dysfunction in rodent models with dystonia, tremor, and ataxia. Dystonia 2. 10.3389/dyst.2023.11515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Calderon DP, Fremont R, Kraenzlin F, and Khodakhah K (2011). The neural substrates of rapid-onset Dystonia-Parkinsonism. Nat Neurosci 14, 357–365. 10.1038/nn.2753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Fremont R, Calderon DP, Maleki S, and Khodakhah K (2014). Abnormal high-frequency burst firing of cerebellar neurons in rapid-onset dystonia-parkinsonism. J Neurosci 34, 11723–11732. 10.1523/JNEUROSCI.1409-14.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Alonso-Navarro H, Garcia-Martin E, Agundez JAG, and Jimenez-Jimenez FJ (2019). Association between restless legs syndrome and other movement disorders. Neurology 92, 948–964. 10.1212/WNL.0000000000007500. [DOI] [PubMed] [Google Scholar]
  • 42.Kaplan Y, and Oksuz E (2008). Association between restless legs syndrome and Chiari type 1 malformation. Clin Neurol Neurosurg 110, 408–410. 10.1016/j.clineuro.2007.12.023. [DOI] [PubMed] [Google Scholar]
  • 43.Watson NF, Buchwald D, Noonan C, Goldberg J, Maravilla K, and Ellenbogen RG (2010). Sleep in patients with Chiari-I malformations. Sleep and Biological Rhythms 8, 261–266. 10.1111/j.1479-8425.2010.00456.x. [DOI] [Google Scholar]
  • 44.Bucher SF, Seelos KC, Oertel WH, Reiser M, and Trenkwalder C (1997). Cerebral generators involved in the pathogenesis of the restless legs syndrome. Ann Neurol 41, 639–645. 10.1002/ana.410410513. [DOI] [PubMed] [Google Scholar]
  • 45.Antelmi E, Mogavero MP, Lanza G, Cartella SM, Ferini-Strambi L, Plazzi G, Ferri R, and Tinazzi M (2024). Sensory aspects of restless legs syndrome: Clinical, neurophysiological and neuroimaging prospectives. Sleep Med Rev 76, 101949. 10.1016/j.smrv.2024.101949. [DOI] [PubMed] [Google Scholar]
  • 46.Takeuchi M, Yamaguchi S, Sakakibara Y, Hayashi T, Matsuda K, Hara Y, Tanegashima C, Shimizu T, Kuraku S, and Hibi M (2017). Gene expression profiling of granule cells and Purkinje cells in the zebrafish cerebellum. J Comp Neurol 525, 1558–1585. 10.1002/cne.24114. [DOI] [PubMed] [Google Scholar]
  • 47.Itoh T, Uehara M, Yura S, Wang JC, Fujii Y, Nakanishi A, Shimizu T, and Hibi M (2024). Foxp and Skor family proteins control differentiation of Purkinje cells from Ptf1a- and Neurog1-expressing progenitors in zebrafish. Development 151. 10.1242/dev.202546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Catoire H, Sarayloo F, Mourabit Amari K, Apuzzo S, Grant A, Rochefort D, Xiong L, Montplaisir J, Earley CJ, Turecki G, et al. (2018). A direct interaction between two Restless Legs Syndrome predisposing genes: MEIS1 and SKOR1. Sci Rep 8, 12173. 10.1038/s41598-018-30665-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Pillay LM, Forrester AM, Erickson T, Berman JN, and Waskiewicz AJ (2010). The Hox cofactors Meis1 and Pbx act upstream of gata1 to regulate primitive hematopoiesis. Dev Biol 340, 306–317. 10.1016/j.ydbio.2010.01.033. [DOI] [PubMed] [Google Scholar]
  • 50.Parsons MJ, Pisharath H, Yusuff S, Moore JC, Siekmann AF, Lawson N, and Leach SD (2009). Notch-responsive cells initiate the secondary transition in larval zebrafish pancreas. Mech Dev 126, 898–912. 10.1016/j.mod.2009.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Davison JM, Akitake CM, Goll MG, Rhee JM, Gosse N, Baier H, Halpern ME, Leach SD, and Parsons MJ (2007). Transactivation from Gal4-VP16 transgenic insertions for tissue-specific cell labeling and ablation in zebrafish. Dev Biol 304, 811–824. 10.1016/j.ydbio.2007.01.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Scott EK, Mason L, Arrenberg AB, Ziv L, Gosse NJ, Xiao T, Chi NC, Asakawa K, Kawakami K, and Baier H (2007). Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nat Methods 4, 323–326. 10.1038/nmeth1033. [DOI] [PubMed] [Google Scholar]
  • 53.Shin J, Park HC, Topczewska JM, Mawdsley DJ, and Appel B (2003). Neural cell fate analysis in zebrafish using olig2 BAC transgenics. Methods Cell Sci 25, 7–14. 10.1023/B:MICS.0000006847.09037.3a. [DOI] [PubMed] [Google Scholar]
  • 54.Kucenas S, Takada N, Park HC, Woodruff E, Broadie K, and Appel B (2008). CNS-derived glia ensheath peripheral nerves and mediate motor root development. Nat Neurosci 11, 143–151. 10.1038/nn2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.DeMaria S, Berke AP, Van Name E, Heravian A, Ferreira T, and Ngai J (2013). Role of a ubiquitously expressed receptor in the vertebrate olfactory system. J Neurosci 33, 15235–15247. 10.1523/JNEUROSCI.2339-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Joo W, Vivian MD, Graham BJ, Soucy ER, and Thyme SB (2020). A Customizable Low-Cost System for Massively Parallel Zebrafish Behavioral Phenotyping. Front Behav Neurosci 14, 606900. 10.3389/fnbeh.2020.606900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Thyme SB, Pieper LM, Li EH, Pandey S, Wang Y, Morris NS, Sha C, Choi JW, Herrera KJ, Soucy ER, et al. (2019). Phenotypic Landscape of Schizophrenia-Associated Genes Defines Candidates and Their Shared Functions. Cell 177, 478–491 e420. 10.1016/j.cell.2019.01.048. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS2188443-supplement-1.pdf (15.4MB, pdf)

Data Availability Statement

Data reported in this paper will be shared by the lead contact upon request. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

RESOURCES