Ameliorating calcium homeostasis improves longevity and healthspan in progeroid and naturally aged mice

Abstract

Cellular calcium (Ca²⁺)-regulating systems are compromised during aging-related disorders. Here, we show that disruption of Ca²⁺ homeostasis leads to the cytoplasmic accumulation of Ca²⁺ binding protein S100A6, which promotes Hutchinson-Gilford progeria syndrome (HGPS) and natural aging. S100A6 recruits CacyBP to facilitate the ubiquitination and degradation of PARP1, leading to DNA damage and the formation of cytoplasmic chromatin fragments (CCF), activing cGAS-STING-NF-κB pathway and the secretion of senescence-associated secretory phenotype (SASP) factors. Mianserin (MIA), a tetracyclic antidepressant, attenuates senescence in cells derived from HGPS patients and naturally aging humans by antagonizing serotonin receptors HTR2B/2 C to lower Ca²⁺ concentrations. MIA also improves a range of aging phenotypes and significantly extends the lifespan of both Lmna^G609G/G609G progeroid and naturally aging mice. Together, our findings uncover the mechanism of Ca²⁺ homeostasis disruption during premature and natural aging, and suggest MIA as a potential therapeutic strategy to extend healthy lifespan by augmenting Ca²⁺ homeostasis.

The study shows that disruption of calcium homeostasis triggers the aberrant accumulation of S100A6 in the cytoplasm, thereby promoting Hutchinson-Gilford Progeria Syndrome (HGPS) and natural aging. Mianserin was found to effectively retard the aging process and significantly extend the lifespan of both progeroid and naturally aged mice by restoring calcium homeostasis.

Introduction

Aging refers to the gradual deterioration of the physiological functions of an organism over time, which results in the emergence of age-related conditions including cardiovascular disease, muscle wasting, osteoporosis and more^1,2. An underlying contributor to these age-related disorders is the widespread accumulation of senescent cells within tissues, which profoundly disrupts tissue integrity and function³. Notably, cellular senescence, as well as a range of age-related diseases such as heart failure, hypertension, sarcopenia, and Alzheimer’s disease are associated with dysregulation of calcium (Ca²⁺) homeostasis^4–7. Ca²⁺ acts as a widespread second messenger in cells, activating various signaling pathways by binding to proteins such as calmodulin, calcineurin, troponin C, S100 proteins and inositol triphosphate receptors (IP3Rs). Of these, S100 proteins have been shown involved in the regulation of proliferation, differentiation, apoptosis, Ca²⁺ homeostasis, energy metabolism, inflammation and migration/invasion through interactions with various target proteins^8–10. S100A6 is a key member of the S100 calcium-binding protein family which has been reported involved in various tumor progression^11,12. S100A6 levels are elevated in pancreatic ductal adenocarcinoma cells, and its high nuclear expression is significantly associated with poor survival in patients¹³. S100A6 enhances liver tumor invasion and migration via the RAGE/NF-κB/VEGF-D pathway¹⁴. S100A6 promotes cell proliferation by activating the PI3K/AKT/mTOR signaling pathway in thyroid cancer¹⁵. S100A6 overexpression accelerates p53 acetylation and degradation, thereby driving lung cancer cell proliferation, invasion, migration, and angiogenesis¹⁶. These findings highlight the overexpression and the nuclear localization of S100A6 in cancer progression.

Hutchinson-Gilford progeria syndrome (HGPS) is a rare and fatal condition characterized by premature aging with an average age of death of 14.5 years^17,18. Patients with HGPS age at a rate 5 to 10 times faster than normal individuals and are thought to undergo an accelerated version of normal aging¹⁹. Mutation in LMNA gene at position 1824 leads to the synthesis of a truncated variant of the prelamin A precursor protein, known as progerin protein, that lacks 50 amino acid residues near the C-terminus^19–21. Progerin accumulates in the nuclear envelope, leading to various abnormalities in HGPS cells including abnormal nuclear morphology, telomere shortening, loss of peripheral heterochromatin and DNA damage^22–24. Ca²⁺ concentrations are elevated in the skin fibroblasts of HGPS patient cells and in endothelial cells derived from induced pluripotent stem cells of HGPS patients^25,26. Additionally, transcriptomic analyses show that calcium signaling genes are dysregulated in HGPS patient-derived cells compared to healthy controls²⁵. Moreover, myoblasts overexpressing progerin exhibit enhanced store-operated calcium entry (SOCE)²⁷. Together, these findings indicate aberrant activation of calcium signaling pathways in HGPS. However, the role of Ca²⁺ homeostasis disruption in HGPS cellular and organismal aging remains unknown.

Given the important role of Ca²⁺ homeostasis in multiple age-related diseases, Ca²⁺ inhibitors have been widely used to treat diseases such as arrhythmias, hypertension and coronary artery disease^28–30. Mianserin (MIA), a tetracyclic antidepressant, has been widely used in the treatment of depression for over 50 years³¹. MIA acts as an antagonist for serotonin (5-hydroxytryptamine, 5-HT) receptors and adrenergic receptors by reducing 5-HT reuptake and thus increasing the concentration of 5-HT in the synaptic cleft. The antagonism of serotonin receptors by MIA can also reduce intracellular Ca²⁺ concentrations by affecting IP3Rs, thereby reducing the release of Ca²⁺ from the endoplasmic reticulum (ER) to the cytoplasm^32,33. In addition, MIA has been reported to prolong the lifespan of C. elegans by regulating the SER-4 serotonin and SER-3 octopamine receptors³⁴. However, whether MIA can delay mammalian aging by restoring Ca²⁺ homeostasis is unclear.

Here, we found that disruption of Ca²⁺ homeostasis promoted the cytoplasmic accumulation of the Ca²⁺-binding protein S100A6 during HGPS and natural aging. We further demonstrated that the cytoplasmic localization of S100A6 was necessary to mediate DNA damage and SASP through degradation of PARP1. Importantly, we found that MIA alleviated chronic cellular senescence and age-related disorders, as well as improved the life span of both Lmna^G609G/G609G progeroid mice and naturally aged mice through the restoration of impaired Ca²⁺ homeostasis. These findings highlight the potential repurposing of MIA in anti-aging.

Results

Elevated cytoplasmic Ca²⁺ concentration-mediated cytoplasmic accumulation of S100A6 promotes HGPS cellular senescence

To investigate the molecular mechanisms of HGPS aging in vivo, we performed tandem mass tag (TMT) proteomics sequencing analysis on lung tissues from 12-week-old wild-type Lmna^+/+ and Lmna^G609G/G609G progeroid mice which was generated in our previous work (Supplementary Fig. 1a–f)³⁵. Of the upregulated proteins, Ca²⁺-binding protein S100A6 was found to be significantly upregulated in the lung tissue of Lmna^G609G/G609G mice (Fig. 1a, b). Consistently, Ca²⁺ signaling pathway was also found in the top 20 upregulated signaling pathway (Fig. 1c). S100A6 levels were confirmed upregulated in multiple tissues, including the heart, lung, skin, and muscle of Lmna^G609G/G609G mice (Fig. 1d). Upregulated expression of S100A6 was also confirmed in the skin fibroblasts of HGPS patients (HGADFN127, HGADFN167, and HGADFN003) (Fig. 1e), as well as in human skin fibroblast CRL-1474 cells (derived from a 7-year-old boy) overexpressing progerin (Supplementary Fig. 2a). Knockdown of S100A6 in HGPS patient cells increased the expression of Cyclin A2 and Lamin B1, downregulated γH2AX, p16, and p21 (Fig. 1f), and restored the cell proliferative capacity (Fig. 1g). Additionally, knockdown of S100A6 in CRL-1474 cells overexpressing progerin increased the expression of Cyclin A2 and Lamin B1, downregulated γH2AX, p16(Supplementary Fig. 2c and e), and reduced proportion of SA-β-gal–positive cells (Supplementary Fig. 2b, d).

Fig. 1. Elevated cytoplasmic Ca²⁺ concentration induces cytoplasmic accumulation of S100A6 in HGPS cells.

a–c TMT proteomics sequencing analysis on the lung tissues from 12-week-old wild-type Lmna^+/+ and Lmna^G609G/G609G mice. Volcano plot, Created in BioRender. Tian, L. (2026) https://BioRender.com/5d701ta (a) and Heat map (b) showed the upregulated proteins in the lung tissues of Lmna^G609G/G609G mice. The top 20 Upregulated KEGG signaling pathway (c). d Western blot analysis of S100A6 in tissues including the heart, lung, muscle, and skin of Lmna^+/+ and Lmna^G609G/G609G mice (n = 3). e Western blot analysis of progerin, Cyclin A2, Lamin B1, and S100A6 levels in HGPS patient cells (HGADFN127/167/003) versus CRL-1474 cells. n = 3 biological replicates. f,g Western blot analysis of Cyclin A2, Lamin B1, γH2AX, p21, and p16 in shS100A6-transfected HGADFN127 cells for 4 days (f). Quantification of Ki67 positive cells by immunofluorescence (g). n = 3 biological replicates. h–k Flow cytometry detection of Ca²⁺ concentration in cells isolated from multi-tissues was performed using Fluo-4 AM, including the lung (h), skin (i), and heart (j) of Lmna^+/+ and Lmna^G609G/G609G mice (n = 7) and in multiple HGPS patient cells (HGADFN127/155/167) compared to CRL-1474 controls (k, n = 3 biological replicates.). l, m. Immunofluorescence detection of intracellular Ca²⁺ (l, n = 3 biological replicates) and S100A6 localization (m) in HGADFN127 and CRL-1474 cells. Scale bars: 10 μm. n Line graphs indicated the immunofluorescence signal intensity across the dotted lines in (m). o Immunohistochemistry detection of S100A6 localization in lung and muscle of Lmna^+/+ and Lmna^G609G/G609G mice. p Flow cytometry detection of Ca²⁺ levels in shS100A6-transfected HGADFN127 cells (n = 6 biological replicates). q,r Immunofluorescence analysis of ER (q, n = 3 biological replicates) and mitochondrial (r, n = 5 biological replicates) Ca²⁺ levels in HGADFN127 and CRL-1474 cells. s Western blot analysis of progerin, Cyclin A2, Lamin B1, and IP3R in CRL-1474, HGADFN167, and HGADFN127 cells. n = 3 biological replicates. t Immunofluorescence detection of S100A6 was performed in HGADFN127 cells treated. Scale bars: 10μm. n = 3 biological replicates. u Schematic illustration of the changes of S100A6 and Ca²⁺ in HGPS cells, Created in BioRender. Tu, D. (2026) https://BioRender.com/y476ddv. Source data are provided as Source Data File. All data are presented as mean±S.D. Statistical significance was determined by two-tailed unpaired Student’s t-test (h-j, l, q, r) or one-way ANOVA analysis (g, k, p, t).

Given Ca²⁺ binding protein S100A6 is overexpressed in HGPS senescence, how does the intracellular Ca²⁺ concentration change during HGPS aging? We isolated cells from multiple tissues of Lmna^G609G/G609G progeroid mice and used Fluo-4 AM to measure cytoplasmic Ca²⁺ concentration. Ca²⁺ levels were significantly elevated in the cells from various tissues, including heart, lung, skin, (Fig. 1h–j), muscle and liver of Lmna^G609G/G609G progeroid mice (Supplementary Fig. 3a, b). Elevated Ca²⁺ concentrations were also found in the cytoplasm of HGPS patient cells (HGADFN127, HGADFN155 and HGADFN167) (Fig. 1k). Consistent with the upregulated cytoplasmic Ca²⁺ in HGADFN127 cells (Fig. 1l), upregulated S100A6 was also found mainly localized in the cytoplasm of HGADFN127 cells (Fig. 1m, n) and multiple tissues of Lmna^G609G/G609G progeroid mice (Fig. 1o). Besides responds to Ca²⁺ concentration, S100A6 was also reported involved in the regulation of Ca²⁺ homeostasis³⁶. Knocking down S100A6 in HGPS patient HGADFN127 cells did decrease the Ca²⁺ concentration (Fig. 1p).

To further investigate the source of the elevated cytoplasmic Ca²⁺ levels, we used Mag-Fluo-4 AM and Rhod-2 AM to detect Ca²⁺ content in the major intracellular Ca²⁺ stores endoplasmic reticulum (ER) and mitochondria. Compared to CRL-1474 cells, the Ca²⁺ levels in ER of HGADFN127 cells were decreased, while mitochondrial Ca²⁺ concentrations remained unchanged (Fig. 1q-r), indicating that the increased cytoplasmic Ca²⁺ levels in HGPS cells are likely derived from ER. Inositol 1,4,5-trisphosphate receptor (IP3R) is the primary Ca²⁺ channel protein located on ER which controls the release of Ca²⁺ from ER into cytoplasm^37,38. We found that IP3R was highly expressed in HGPS patient HGADFN127 and HGADFN167 cells (Fig. 1s). Both IP3R inhibitors Xestospongin C (XeC) and 2-aminobenzyl diphenylborate (2-APB) reduced Ca²⁺ concentration and cytoplasmic S100A6 levels (Fig. 1t, Supplementary Fig. 3c, d). Above results suggest that the release of Ca²⁺ from ER into cytoplasm is associated with the cytoplasmic accumulation of S100A6 in HGPS cellular senescence (Fig. 1u).

S100A6 binds to and degrades PARP1 through recruiting CacyBP

To identify potential regulatory factors associated with S100A6 during HGPS senescence, we used mass spectrometry (MS) to screen for S100A6 binding proteins, and identified PARP1, an important DNA damage repair enzyme^39,40, as a binding protein of S100A6 (Fig. 2a). We then confirmed the binding between S100A6 and PARP1 in both HEK-293T (human embryonic kidney cells expressing SV40 large T antigen) and human skin fibroblast CRL-1474 cells (derived from a 7-year-old boy) that overexpressed progerin (Fig. 2b and Supplementary Fig. 2f). PARP1 and S100A6 were also found exist in a complex and co-localized in the cytoplasm of HGADFN127 cells (Fig. 2c–e). We next found that PARP1 protein levels were downregulated during HGPS cellular senescence (Fig. 2f). Furthermore, knockdown of S100A6 did not affect PARP1 mRNA levels (Fig. 2g), but significantly upregulated PARP1 protein levels (Fig. 2h), suggesting that S100A6 may regulate PARP1 expression at the protein level in HGPS cells. The proteasome inhibitor carfilzomib restored PARP1 protein level in HGADFN127 cells (Fig. 2i). S100A6 knockdown increased the half-life of PARP1 in the presence of the protein synthesis inhibitor cycloheximide (CHX) (Fig. 2j). Silencing S100A6 was also found to significantly reduce the ubiquitination level of PARP1 in CRL-1474 cells overexpressing progerin (Fig. 2k). Then, how does S100A6 mediate the ubiquitination degradation of PARP1? Cacyclin-binding protein/Siah-interacting protein (CacyBP/SIP) is an important binding protein of S100A6 and a regulatory factor that affects the activity of the bound E3 ubiquitin ligase⁴¹. We found that S100A6, PARP1 and CacyBP exised in a complex in HGADFN127 cells (Fig. 2l). Interfering with CacyBP leads to a significant upregulation of PARP1 protein levels and a marked decrease in its ubiquitination levels (Fig. 2m, n). Further investigation showed that knocking down S100A6 weakened the binding between CacyBP and PARP1 (Fig. 2o). However, interfering with CacyBP didn’t affect the interaction between S100A6 and PARP1 (Fig. 2p). In summary, upregulated S100A6 recruits CacyBP to ubiquitinate and degrade PARP1 in HGPS cells (Fig. 2q).

Fig. 2. S100A6 binds to and degrades PARP1 through recruiting CacyBP.

a PARP1, RPL6, TCP1, PABPC1, CAD, XPO1 and RPS18 were identified as S100A6-binding proteins by MS. Created in BioRender. Tian, L. (2026) https://BioRender.com/2fy9569. b Co-IP assay was performed to analyze the interaction between S100A6 and PARP1 in CRL-1474 cells overexpressing Flag-progerin. n = 3 biological replicates. c Immunofluorescence detection of S100A6 and PARP1 localization in HGADFN127 and CRL-1474 cells. Scale bars: 20μm. n = 3 biological replicates. d Line graphs indicated the immunofluorescence signal intensity across the dotted lines in (c). e Co-IP assay was performed to analyze the interaction between S100A6 and PARP1 in the nucleus and cytoplasm of CRL-1474 cells overexpressing Flag-progerin. n = 3 biological replicates. f Western blot analysis of Cyclin A2, Lamin B1, and PARP1 levels in HGPS patient cells (HGADFN127 and HGADFN167) versus CRL-1474 cells. n = 3 biological replicates. g Quantitative RT–PCR analysis of PARP1 mRNA levels in HGADFN127 cells with S100A6 deletion. n = 3 biological replicates. h Western blot analysis of S100A6, Cyclin A2, Lamin B1, and PARP1 levels in S100A6-deleted HGADFN127 cells. n = 3 biological replicates. i Western blot analysis of PARP1 levels in HGADFN127 cells treated with carfilzomib (5 nM) for 24 h. n = 3 biological replicates. j HGADFN155 cells were transfected with shCtrl or shS100A6#2, and then treated with CHX (100 μg/mL); PARP1 levels was examined by western blot. n = 3 biological replicates. k Co-IP analysis of PARP1 ubiquitination in CRL-1474 cells overexpressing progerin and transfected with shS100A6 for 48 h. n = 3 biological replicates. l Co-IP analysis of the S100A6–CacyBP–PARP1 interaction in CRL-1474 and HGADFN127 cells. n = 3 biological replicates. m Western blot analysis of CacyBP, Lamin B1, and PARP1 levels in CacyBP-deleted HGADFN127 cells. n = 3 biological replicates. n Co-IP analysis of PARP1 ubiquitination in siCacyBP-transfected HGADFN155 cells. n = 3 biological replicates. o Co-IP analysis of PARP1-CacyBP interaction in shS100A6- transfected HGADFN155 cells. n = 3 biological replicates. p Co-IP analysis of the S100A6-PARP1interaction in siCacyBP-transfected HGADFN155 cells. n = 3 biological replicates. q Schematic diagram for S100A6 recruiting CacyBP to ubiquitinate and degrade PARP1. Created in BioRender. Tu, D. (2026) https://BioRender.com/a7iyqnv. Source data are provided as Source Data File. All data are presented as mean±S.D. Statistical significance was determined by one-way ANOVA analysis (g).

S100A6 promotes CCF and the secretion of SASP factors by degrading PARP1

Since S100A6 promoted PARP1 degradation, we next sought to determine the extent of DNA damage in HGPS cells. We found that IMR90 cells overexpressing Flag-progerin (delivered via lentiviral transduction) exhibited a significant increase in γH2AX foci/cell compared to control cells transduced with the empty lentiviral vector (pCDH-CMV-3×Flag) (Fig. 3a, b). In addition, we observed a significant increase in the proportion of cytoplasmic chromatin fragments-positive (CCF) cells in IMR90 cells overexpressing progerin (Fig. 3c). CCF can activate the cGAS-STING signaling pathway leading to the activation of IRF3 and NF-κB, and subsequent SASP secretion⁴². Here, we found that the signaling pathways downstream of cGAS-STING, the IRF3 and NF-κB pathways, were also activated in HGPS patient cells (Fig. 3d). The HGPS patient HGADFN127 cells were treated with IRF3 inhibitor Cyclo (phe-pro) (cFP) and p65 inhibitor Rubiadin-1-methyl-ether (RBM) respectively. The results showed that the levels of IL-6 and IL-8 in HGADFN127 cells decreased after treatment with p65 inhibitor RBM (Fig. 3e-h). Furthermore, knockdown of S100A6 resulted in a significant decrease in the numbers of CCF formation (Fig. 3i), γH2AX foci/cell (Fig. 3j), and the levels of SASP factors (Fig. 3k, l).

Fig. 3. S100A6 promotes CCF and the secretion of SASP factors by degrading PARP1.

a–c Immunofluorescence detection of γH2AX foci and CCF in IMR90 cells overexpressing Flag-progerin or empty lentiviral vector (pCDH-CMV-3×Flag). Scale bars: 10 μm. Arrows indicate CCF (a). Quantification of γH2AX foci per nucleus (b) and percentage of CCF-positive cells (c). n = 3 biological replicates. d Western blot analysis of S100A6, Cyclin A2, Lamin B1, cGAS, STING, p-STING, IRF3, p-IRF3, p65, and p-p65 in CRL-1474 and HGADFN127 cells. n = 3 biological replicates. e–g Western blot analysis of IRF3, p-IRF3, p65, p-p65, IL-6, and IL-8 in HGADFN127 cells treated for 24 h with cFP (2.5 mM; e) or RBM (10 μM; g). n = 3 biological replicates. f–h Quantitative RT–PCR analysis of IL6 and IL8 mRNA levels in HGADFN127 cells treated with cFP (f) and RBM (h)for 24 h. n = 3 biological replicates. i,j Immunofluorescence detection of γH2AX foci and CCF in shS100A6- infected HGADFN127 cells. The numbers of γH2AX foci in each nucleus (i) and the percentage of CCF-positive cells was quantified (j). n = 3 biological replicates. k,l HGADFN127 cells infected with shCtrl or shS100A6. Western blot analysis of S100A6, Cyclin A2, Lamin B1, IL-6, IL-8, and γH2AX (k). Quantitative RT-PCR analysis of IL-6 and IL-8 mRNA levels (l, n = 3 biological replicates). m–p Illustration of Fluzoparib treatment in HGADFN127 cells infected with shRNA (m). Immunofluorescence detection of γH2AX foci and CCF. The number of γH2AX foci per nucleus was quantified (n). The percentage of CCF-positive cells was quantified (o). Western blot analysis of Cyclin A2, Lamin B1, PARP1, IL-6, IL-8, and γH2AX (p). n = 3 biological replicates. q–t Illustration of S100A6 knockdown and dnMCAK overexpression in HGADFN127 cells. HGADFN127 cells were infected with shS100A6#1 for 3 days, followed by dnMCAK infection for 2 days. q Immunofluorescence detection of γH2AX foci and CCF. The numbers of γH2AX foci in each nucleus (r) and the percentage of CCF-positive cells was quantified (s). Western blot analysis of S100A6, Cyclin A2, Lamin B1, PARP1, IL6, IL8, and γH2AX (t). n = 3 biological replicates. Source data are provided as Source Data File. All data are presented as mean±S.D. Statistical significance was determined by two-tailed unpaired Student’s t-test (b, c, f, h) or one-way ANOVA analysis (i, j, l, n, o, r, s).

We next verified the role of PARP1 by treating S100A6-depleted HGPS patient cells with PARP1 inhibitor fluzoparib (Fig. 3m). Fluzoparib treatment of shS100A6 (knock down the level of S100A6) cells led to an increase in the numbers of γH2AX foci/cell (Fig. 3n), as well as increased accumulation of CCF (Fig. 3o) compared to cells treated with shS100A6 alone. Fluzoparib also reversed the shS100A6-mediated reduction of Cyclin A2, Lamin B1, IL-6, and IL-8 levels (Fig. 3p). Dominant-negative mitotic centromere-associated kinesin mutant (dnMCAK) overexpression can increase chromosome instability further increasing cytoplasmic DNA levels⁴³. We next determined the role of CCF by transfecting dnMCAK in S100A6-depleted HGPS patient cells (Fig. 3q). Overexpression of dnMCAK in shS100A6-treated cells increased the numbers of γH2AX foci/cells (Fig. 3r) and CCF formation (Fig. 3s) compared to cells treated with shS100A6 alone dnMCAK also reversed the shS100A6-mediated reduction of Cyclin A2, Lamin B1, IL-6, and IL-8 levels (Fig. 3t). These results indicate that during HGPS cellular senescence, S100A6 triggers DNA damage and CCF formation through the degradation of PARP1, thereby activating the cGAS-STING-NF-κB signaling pathway and promoting the secretion of SASP factors.

Inhibition of IP3R delays the HGPS cellular senescence but was not applicable in anti-aging of Lmna^G609G/G609G progeroid mice

Above data showed that activation of IP3R promotes the release of Ca²⁺ from ER into the cytoplasm in HGPS senescence. Then, if inhibition of IP3R can reduce cytoplasmic Ca²⁺ level and delay the progression of HGPS senescence. We treated HGPS patient cells with IP3R inhibitors XeC and 2-APB. The results showed that both inhibition of IP3R with XeC and 2-APB could reduce the Ca²⁺concentration of HGPS cells and delay cellular senescence (Fig. 4a–f and Supplementary Fig. 4a–h).

Fig. 4. IP3R inhibitor 2-APB delays HGPS cellular senescence and alleviates parts of the aging characteristics of Lmna^G609G/G609G progeroid mice.

a–f Western blot analysis of Cyclin A2, Lamin B1, and S100A6 was performed in HGADFN127 cells treated with XeC and 2-APB for 4 days (a,b). Immunofluorescence staining of Ki67 in (c) Scale bars: 10 μm. The percentage of Ki67 positive cells was calculated (d). The percentage of SA-β-gal positive cells was calculated (e,f). n = 3 biological replicates. Scale bars: 100 μm. g Experimental setup for 2-APB treatment: 4-week-old Lmna^G609G/G609G mice received intraperitoneal injections of 2-APB at a dose of 2 mg/kg every other day. Age-matched Lmna^+/+ mice served as controls and were given intraperitoneal injections of vehicle on the same schedule. Body weights were monitored weekly. Locomotor activity was assessed in 12-week-old mice. Created in BioRender. Tian, L. (2026) https://BioRender.com/99ll4u9. h Representative photographs of male Lmna^G609G/G609G mice (12 weeks), treated with or without 2-APB. i The progression of body weight in Lmna^G609G/G609G mice treated with or without MIA was detected from 4 weeks after birth (n = 12,12,16). j A comparison of body weight was conducted between 4-week-old and 12-week-old mic (n  =  12,12,16). k The open field test was used to assess the motion capabilities of Lmna^G609G/G609G mice (12 weeks), with or without 2-APB treatment (n = 12,12,16). l Kaplan-Meier survival curves for Lmna^+/+ and Lmna^G609G/G609G mice, treated with or without 2-APB, were analyzed (n = 12). m–p IHC of IP3R in the heart, lung and muscle of Lmna^G609G/G609G mice (12 weeks), with or without 2-APB treatment (m, scale bars, 50 μm; n  =  5). The quantification scores of IP3R (n–p). q-s IHC of S100A6 in the heart and lung of Lmna^G609G/G609G mice (12 weeks), with or without 2-APB treatment (q, scale bars, 50 μm; n  =  5). The quantification scores of S100A6 (r-s). t-v IHC of PARP1 in the heart and lung of Lmna^G609G/G609G mice (12 weeks), with or without 2-APB treatment (t, scale bars, 50 μm; n  =  5). The quantification scores of PARP1 (u-v). w The drug-induced tremors in Lmna^G609G/G609G mice treated with or without 2-APB was calculated (n  = 10). Source data are provided as Source Data File. All data are presented as mean±S.D. Statistical significance was determined by two-tailed unpaired Student’s t-test (j) or one-way ANOVA analysis (d, f, k, n-p, r, s, u-w).

Thus, we asked whether inhibition of IP3R could delay the aging of Lmna^G609G/G609G mice. Treatment of Lmna^G609G/G609G mice with 2 mg/kg 2-APB every other day from four weeks after birth was found to mitigate the decline in body weight (Fig. 4g–j, Supplementary Fig. 5a–f), improve their locomotor ability (Fig. 4k, Supplementary Fig. 3g, h), and extend their lifespan, with an increase in median survival of 14.15% (Fig. 4l, Supplementary Fig. 5i, j). Histochemically, 2-APB was found to reduce IP3R levels in the heart, lung, and muscle (Fig. 4m–p), decreased S100A6 levels in the heart and lung (Fig. 4q-s), and increased PARP1 levels in the heart and lung of Lmna^G609G/G609G mice (Fig. 4t–v). However, long-term treatment with 2-APB led to drug-induced tremors in the mice (Fig. 4w). These results suggest although IP3R inhibitor 2-APB can improve parts of the HGPS aging phenotypes, it is not suitable for the treatment of HGPS.

Mianserin delays cellular senescence in HGPS cells by restoring Ca²⁺ homeostasis

Although inhibition of IP3R can alleviate HGPS cellular senescence, it is not suitable for individual therapy in HGPS. Then, we tried to seek other strategies to balance Ca²⁺ homeostasis. Mianserin, a widely used tetracyclic antidepressant, has also been shown to inhibit IP3R activation by antagonizing 5-HT receptors HTR2B and HTR2C, thereby reducing intracellular Ca²⁺ concentration. We first detected 5-HT levels in the serum of Lmna^G609G/G609G mice and found that 5-HT levels were reduced compared with Lmna^+/+mice (Fig. 5a). Consistently, we found that the levels of 5-HT receptors HTR2B and HTR2C were upregulated in multiple tissues, such as the heart (Fig. 5b), lung (Fig. 5c), muscle (Fig. 5d), and skin (Fig. 5e) of Lmna^G609G/G609G mice. Elevated levels of HTR2B and HTR2C were also confirmed in HGPS patient cells (Fig. 5f). HTR2B and HTR2C activate IP3R, which promotes the release of Ca²⁺ from ER⁴⁴. Thus, we next examined the effects of MIA on Ca²⁺ concentrations. MIA treatment lowered intracellular Ca²⁺ concentration in HGADFN127 cells (Fig. 5g) and in the lung, skin, heart, and muscle of Lmna^G609G/G609G mice (Fig. 5h–k). Knockdown of HTR2B or HTR2C in HGADFN127 cells subsequently led to a reduction in intracellular Ca²⁺ levels (Fig. 5l). To further explore the relationship between MIA and HTR2B or HTR2C in HGPS senescence, we treated HGADFN127 cells with MIA and simultaneously added agonizts for HTR2B (BW723C86) or HTR2C (RO60-0175). The results showed that both HTR2B and HTR2C agonizts restored Ca²⁺ levels reduced by MIA (Fig. 5m). We also found that in HGADFN127 cells treated with MIA, the binding of HTR2B or HTR2C to G-α was reduced (Fig. 5o). Above data showed that MIA reduced the intracellular Ca²⁺ concentration of HGPS cells by targeting HTR2B and HTR2C.

Fig. 5. MIA delays cellular senescence in HGPS cells by restoring Ca²⁺ homeostasis.

a Serum 5-HT levels in Lmna^+/+ and Lmna^G609G/G609G mice (12 weeks) were detected by ST/5-HT ELISA Kit (n = 6,7). b–f Quantitative RT-PCR analysis of HTR2B and HTR2C mRNA levels of the heart (b, n = 6), lung (c, n = 6), muscle (d, n = 6), and skin (e, n = 5) of Lmna^+/+ and Lmna^G609G/G609G mice, and in CRL-1474 and HGADFN127 cells (f, n = 3 biological replicates). g Flow cytometry detection of Ca²⁺ concentration in HGADFN127 cells treated with MIA (10 μM) for 4 days. n = 3 biological replicates. h–k Flow cytometry analysis of Ca²⁺ concentration in cells isolated from the heart (h, n = 6,8,8), lung (i, n = 7,7,7), skin (j, n = 7,7,8), and muscle (k, n = 7,7,7) of Lmna^+/+ and Lmna^G609G/G609G mice, treated with or without MIA (10 mg/kg, from 4 weeks) at 12 weeks. l, m Flow cytometry detection of Ca²⁺ concentration in HGADFN127 cells. Cells transfected with siHTR2B or siHTR2C (l). MIA-treated cells with HTR2B (BW723C86) or HTR2C (RO60-0175) agonists (m). n = 3 biological replicates. n Western blot analysis of Cyclin A2, Lamin B1, IL-6, IL-8, γH2AX, PARP1, and S100A6 in CRL-1474 cells overexpressing progerin treated with MIA (10 μM) for 4 days. n = 3 biological replicates. o Co-IP analysis of HTR2B/HTR2C-G-α interaction in HGADFN127 cells treated with or without MIA (10 μM) for 4 days. n = 3 biological replicates. p-t CRL-1474 cells overexpressing Flag-progerin or empty lentiviral vector (pCDH-CMV-3×Flag) were treated with MIA (10 μM) for 4 days. Quantification of SA-β-gal-positive (p) and Ki67-positive cells (q). Immunofluorescence for γH2AX foci and CCF (r Scale bars: 10μm). Quantification of γH2AX foci per nucleus (s) and CCF-positive cells (t). n = 3 biological replicates. u-z. Schematic of MIA followed by ionomycin treatment in HGADFN127 cells (u). The percentages of Ki67-positive (v) and SA-β-gal-positive cells (w) were calculated by immunofluorescence; western blot analysis of Cyclin A2, Lamin B1, PARP1, IL6, IL8, and γH2AX (x). Immunofluorescence detection of γH2AX foci and CCF. Quantification of γH2AX foci (y) and CCF-positive cell percentage (z). n = 3 biological replicates. Source data are provided as Source Data File. All data are presented as mean±S.D. Statistical significance was determined by two-tailed unpaired Student’s t-test (a-g) or one-way ANOVA analysis (h-m, p, q, s, t, v, w, y, z).

We further examined the effects of MIA on HGPS cellular senescence. MIA upregulated the expression of Cyclin A2, Lamin B1, and PARP1, while downregulating S100A6, γH2AX, IL-6, and IL-8 levels in CRL-1474 cells overexpressing progerin (Fig. 5n). In addition, MIA reduced the proportion of SA-β-gal positive cells (Fig. 5p) and restored the proliferative capacity (Fig. 5q). Furthermore, MIA significantly decreased the number of γH2AX foci/cell (Fig. 5r, s) and CCF formation (Fig. 5t). These results suggest that MIA can alleviate HGPS cellular senescence. To determine whether MIA restores the senescent phenotype of HGPS patient cells by lowering intracellular Ca²⁺ concentrations, we simultaneously treated HGPS patient cells with Ca²⁺ agonist ionomycin to increase intracellular Ca²⁺ concentrations (Fig. 5u). Ionomycin reversed the anti-aging effect of MIA as evidenced by a significant reduction in the proportion of Ki67 positive cells (Fig. 5v), a significant increase in the proportion of SA-β-gal positive cells (Fig. 5w) and increased γH2AX, IL-6 and IL-8 levels (Fig. 5x). Furthermore, ionomycin increased both the number of γH2AX foci/cell (Fig. 5y) and CCF in HGADFN127 cells treated with MIA (Fig. 5z). These results indicate that MIA delays the senescence of HGPS cells by reducing intracellular Ca²⁺ concentrations.

MIA alleviates multiple aging characteristics and significantly extends the lifespan of Lmna^G609G/G609G mice

To evaluate the therapeutic effects of MIA, Lmna^G609G/G609G mice were administered with 10 mg/kg or 20 mg/kg of MIA via intraperitoneal injection starting from four weeks after birth or 0.9% saline as a control (every other day) (Fig. 6a). Lmna^G609G/G609G mice receiving 10 mg/kg or 20 mg/kg of MIA treatment had a healthier appearance (Fig. 6b, and Supplementary Fig. 6b, c, and Supplementary Fig. 7a) than untreated Lmna^G609G/G609G mice. MIA treatment also reduced weight loss in Lmna^G609G/G609G mice (Fig. 6d, e, and Supplementary Fig. 6d–g, Supplementary Fig. 7b–e). Importantly, MIA also extended the lifespan of Lmna^G609G/G609G mice, with 10 mg/kg and 20 mg/kg of MIA increasing the median survival by 27.89% and 30.2%, respectively (Fig. 6t, Supplementary Fig. 6j–l and Supplementary Fig. 7h, i). However, treatment with 20 mg/kg MIA was found to impair the mobility of Lmna^G609G/G609G mice (Supplementary Fig. 6h and i), while 10 mg/kg MIA improved their mobility (Fig. 6s and Supplementary Fig. 7f, g). Thus, all subsequent experiments were conducted using 10 mg/kg MIA.

Fig. 6. MIA ameliorates aging phenotypes and extends lifespan of Lmna^G609G/G609G mice.

a Experimental setup: 4-week-old Lmna^G609G/G609G mice received intraperitoneal injections of 10 mg/kg MIA or saline every other day; age-matched Lmna^+/+ mice received saline as controls. Body weight was monitored weekly, test grip strength (9–12 weeks), and heart/lung/muscle function, spinal curvature, and locomotor activity assessed at 12 weeks. Created in BioRender. Tian, L. (2026) https://BioRender.com/99ll4u9. b, c Representative images (b) and micro-CT analysis of spinal curvature (c) in 12-week-old male Lmna^G609G/G609G mice ± MIA. d, e The progression of body weight in Lmna^G609G/G609G mice ± MIA was monitored from 4 weeks after birth (d, n = 21,22,20), with comparison between 4- and 12-week timepoints (e, n = 21,20). f-h. The Feino color Doppler small animal ultrasound imaging system was used to perform echocardiography on the left ventricle of 12-week-old Lmnaᴳ⁶⁰⁹ᴳ/ᴳ⁶⁰⁹ᴳ mice ± MIA (f), with quantification of ejection fraction (g) and fractional shortening (h) (n  =  8). i Masson staining of heart from 12-week-old Lmna^G609G/G609G mice ± MIA to assess fibrosis. Scale bars, 50 μm. n = 7. j–l Non-invasive airway mechanics in 12-week-old Lmna^G609G/G609G mice ± MIA. Respiratory rate (j, n = 8,6,6), tidal volume (k, n = 7,6,6), and airway resistance (l, n = 8,6,8). m Masson staining of lung from 12-week-old Lmna^G609G/G609G mice ± MIA to assess fibrosis. Scale bars, 50 μm. n = 7. n–p The twitch force (n) and tetanic force (o) of muscles derived from 12-week-old Lmna^G609G/G609G mice ± MIA. Representative right TA muscle photographs from these mice are shown (p, n = 4). q A grip strength meter (Bioseb) was used to detect the grip strength of Lmna^G609G/G609G mice ± MIA from 9 to 12 weeks (n = 10, 6,6). r Masson staining of muscle from 12-week-old Lmna^G609G/G609G mice ± MIA to assess fibrosis. Scale bars, 50 μm. n = 7. s Open field test for locomotion in 12-week-old Lmna^G609G/G609G mice ± MIA (n = 16). t Kaplan-Meier survival curves for Lmna^+/+ and Lmna^G609G/G609G mice ± MIA, were analyzed (n = 30). u–w IHC was performed to detect S100A6 and PARP1 in the heart of Lmna^G609G/G609G mice ± MIA treatment (u, scale bars, 50 μm; n  =  7). Quantification of S100A6(v)and PARP1(w). All data are presented as mean±S.D. Statistical significance was determined by two-tailed unpaired Student’s t-test (e, q) or one-way ANOVA analysis (g–o, r, s, v, w).

Lmna^G609G/G609G mice that received MIA treatment exhibited a reduction in spinal curvature (Fig. 6c). The normal physiological functions of heart, lung, and muscle are all highly dependent on the intracellular Ca²⁺ concentration⁴⁵. Therefore, we further evaluated the effects of MIA treatment on the cardiac, pulmonary, and muscular functions of HGPS progeroid mice. We found that the ejection fraction (Fig. 6f, g) and fractional shortening (Fig. 6h) of the hearts of Lmna^G609G/G609G mice were significantly improved after eight weeks of MIA treatment, together with a reduction in fibrosis (Fig. 6i). MIA also improved the respiratory rate (Fig. 6j), tidal volume (Fig. 6k), airway resistance (Fig. 6l), and degree of pulmonary fibrosis (Fig. 6m) in Lmna^G609G/G609G mice. Furthermore, we evaluated the effects of MIA on muscle function in Lmna^G609G/G609G mice. We determined 100 Hz as the optimal stimulation frequency based on the force-frequency curve (Supplementary Fig. 7k). Under this stimulation frequency, we assessed twitch and tetanic forces. The results showed that after eight weeks of MIA treatment, Lmna^G609G/G609G mice exhibited significant improvements in twitch force (Fig. 6n), tetanic force (Fig. 6o), and tibialis anterior (TA) muscle mass (Fig. 6p). Additionally, grip strength (Fig. 6q) and the degree of muscle fibrosis (Fig. 6r) were also improved. In addition, we found that MIA treatment decreased S100A6 expression levels in the heart, lung, muscle and skin of Lmna^G609G/G609G mice (Fig. 6u, v, Supplementary Fig. 8a, b), increased PARP1 expression levels in the heart, lung and muscle tissues (Fig. 6u, w, Supplementary Fig. 8c, d), decreased IL6, CXCL10, IL-β, and TNF-α levels in the heart and lung (Fig. 6u, x, y, Supplementary Fig. 8e, f). MIA treatment also increased the number of Lamin B1 positive cells in the lung and muscle of the Lmna^G609G/G609G mice (Supplementary Fig. 8g, h). Furthermore, we found that MIA treatment increased serum 5-HT levels in Lmna^G609G/G609G mice, improved their preference for sugar water (Supplementary Fig. 9a, b) and didn’t not further impair liver function (Supplementary Fig. 9c, d). In summary, our findings show that MIA can improve the aging phenotypes and extend the lifespan of Lmna^G609G/G609G mice.

S100A6 is highly expressed in multiple natural aging models

To determine whether high expression of S100A6 during HGPS aging is universal, we examined the expression of S100A6 in other senescence models (Fig. 7a). S100A6 was highly expressed in replicative senescent CRL-1474 fibroblasts, skin fibroblasts from 88-year-old and 92-year-old individuals (Fig. 7b, c). S100A6 was also found accumulated in the cytoplasm of both replicative senescent fibroblasts and skin fibroblasts obtained from 88-year-old individuals (Fig. 7d, e). Furthermore, high S100A6 levels were consistently observed in the skin tissue of elderly individuals (over 70 years old) (Fig. 7f, g), while the levels of PARP1 were lower in the skin tissue of elderly individuals compared with younger ones (Supplementary Fig. 10a, b). S100A6 was also highly expressed in mesenchymal stem cells derived from human bone marrow blood (hBMSCs) of elderly individuals (over 70 years old) (Fig. 7h). We also examined S100A6 levels in multiple tissues of rats of different age groups and found that S100A6 was highly expressed in multiple tissues including the heart, skin and kidney of 20-month-old rats compared to 4-month-old rats (Fig. 7i–l). However, S100A6 levels were found to be reduced in premature senescence models including Ras-induced, H₂O₂-induced and etoposide-induced senescence of IMR90 cells (Fig. 7m–o). Above data suggested during the natural aging process, S100A6 exhibits significant high expression.

Fig. 7. S100A6 is highly expressed in natural aging.

a Illustration of S100A6 expression patterns in multiple senescence models. Created in BioRender. Tu, D. (2026) https://BioRender.com/hcigi3k. b,c Western blot analysis of the protein levels of Cyclin A2, Lamin B1, and S100A6 in replicative senescence CRL-1474 cells (b, p25 vs p45), skin fibroblasts from 88-year-old and 92-year-old individuals (c). n = 3 biological replicates. d,e Immunofluorescence analysis of S100A6 localization in replicative senescence fibroblasts and skin fibroblasts from 88-year-old individuals (d, scale bar, 10 μm, n = 3 biological replicates). Line graphs indicating IF signal intensity across the dotted lines (e). f,g IHC of S100A6 in the human skin tissues of different ages (f, scale bars, 50 μm; n  =  6,6). The quantification scores of S100A6 (g, n = 6,5). h Western blot analysis of the protein levels of Cyclin A2, Lamin B1, PARP1, and S100A6 in hBMSCs from individuals. n = 3 biological replicates. i–l IHC of S100A6 in multiple tissues of rats of 4 months and 20 months, including the heart, kidney and skin (i, scale bars, 50 μm; n  =  5). The quantification scores of S100A6 (j–l). m–o Western blot analysis of the protein levels of Cyclin A2, Lamin B1, and S100A6 in Ras-induced (m), H₂O₂-induced (n), and etoposide-induced (o) senescence of IMR90 cells. n = 3 biological replicates. Source data are provided as Source Data File. All data are presented as mean ± S.D. Statistical significance was determined by two-tailed unpaired Student’s t-test (g, j–l).

MIA improves the aging phenotypes and extends the lifespan of natural aging mice

Since elevated S100A6 levels were associated with various physiological aging processes, we next asked whether MIA treatment could alleviate physiological cell/ individual aging (Fig. 8a). We found that MIA upregulated the expression of Cyclin A2, Lamin B1, and PARP1 in cells from 88-year-old and elderly human mesenchymal stem cells, while down-regulating IL-6 and IL-8 levels (Fig. 8b, c), suggesting that MIA can attenuate the senescence of physiologically senescent cells.

Fig. 8. MIA improves the aging phenotypes and extends the lifespan of natural aging mice.

a Illustration of the MIA treatment analysis workflow in cells. Skin fibroblasts from 88-year-old individuals were treated with 10 μM MIA for 4 days. Created in BioRender. Tian, L. (2026) https://BioRender.com/ajcua4m. b Western blot analysis of Cyclin A2, Lamin B1, PARP1, IL6, and IL8 levels in skin fibroblasts from 88-year-old individuals treated with MIA. n = 3 biological replicates. c Western blot analysis of Cyclin A2, Lamin B1, PARP1, IL-6, and IL-8 levels in elderly hBMSCs treated with MIA. n = 3 biological replicates. d Illustration of the MIA treatment analysis workflow in natural aging mice. Aged male mice, 20 months old, received intraperitoneal injections of either 10 mg/kg MIA or saline every other day. Body weights were monitored weekly beginning at 20 months of age. At 24 months of age, spinal curvature and locomotor activity were evaluated. Created in BioRender. Tian, L. (2026) https://BioRender.com/z0yrjy8. e Representative photographs of C57BL/6 J mice (24 months) ± MIA. f The hair status of C57BL/6 J mice (24 months) ± MIA (n = 5,5). g Micro-CT analysis of spinal curvature in 24-month-old male C57BL/6 J mice ± MIA. h The progression of body weight in 20-month-old male C57BL/6 J mice ± MIA, was monitored starting from 20 months of age (n = 7,8). i Comparison of body weight in 85- and 110-week-old mice (n  =  7,8). j The open field test was used to assess the motion capabilities of 24-month-old male C57BL/6 J mice ± MIA (n = 6). k Kaplan-Meier survival curves for 20-month-old male C57BL/6 J mice ± MIA, were analyzed (n = 7-8). l–m IHC was performed to detect S100A6 in the heart, lung, and muscle of 24-month-old male C57BL/6 J mice ± MIA (l, scale bars, 50 μm; n  =  5). The quantification scores of S100A6 were also determined (m). n,o IHC was performed to detect PARP1 in the heart, liver, lung, and muscle of 24-month-old male C57BL/6 J mice ± MIA (n, scale bars, 50 μm; n  =  5). The quantification scores of PARP1 were also determined (o). Source data are provided as Source Data File. All data are presented as mean ± S.D. Statistical significance was determined by two-tailed unpaired Student’s t-test (f, i, j) or one-way ANOVA analysis (m, o).

We next examined the effects of MIA on naturally aging mice by administering 20-month-old male C57BL/6 J mice with 10 mg/kg MIA or an equal volume of 0.9% saline solution intraperitoneally every two days (Fig. 8d). After four months, mice in the MIA treatment group had significantly larger body sizes and their fur was glossy and dense (Fig. 8e, f). Furthermore, MIA treatment alleviated the spinal curvature of 24-month-old mice and significantly alleviated leg osteoporosis (Fig. 8g). MIA treatment also slowed the body weight loss of naturally aging mice (Fig. 8h, i). In addition, MIA enhanced the motor abilities of naturally aging C57BL/6 J mice (Fig. 8j). Moreover, MIA significantly extended the median survival period of naturally aging C57BL/6 J mice from 823 days to 967 days, which represented a 17.496% increase in median survival (Fig. 8k). The maximum lifespan was extended from 869 days to 1055 days. Histochemically, MIA was found to reduce S100A6 expression levels in the heart, lung, and muscle of naturally aging C57BL/6 J mice (Fig. 8l–m), as well as increased PARP1 expression levels in the heart, liver, lung and muscle (Fig. 8n, o). In summary, MIA can improve the aging phenotypes and extend the lifespan of naturally aging C57BL/6 J mice.

Discussion

In this study, we demonstrated that disruption of Ca²⁺ homeostasis resulted in the cytoplasmic accumulation of S100A6 during HGPS and natural aging. Mechanistically, we showed that S100A6 promotes the ubiquitination and degradation of PARP1 through recruiting CacyBP, which triggers DNA damage and the formation of CCF, subsequently activating the cGAS-STING-NF-κB signaling pathway to promote secretion of SASP factors. Importantly, treatment with the serotonin receptor antagonist MIA reduced the senescence of cells derived from HGPS patients, naturally aged human skin fibroblasts and aged human mesenchymal stem cells by restoring Ca²⁺ homeostasis. MIA also improved a variety of aging phenotypes and significantly extended the lifespan of both Lmna^G609G/G609G progeriod mice and naturally aging mice (Fig. 9).

Fig. 9. A proposed model for MIA ameliorated calcium homeostasis in progeroid and naturally aging.

The disruption of Ca²⁺ homeostasis resulted in the cytoplasmic accumulation of S100A6 during HGPS and natural aging. S100A6 promotes the ubiquitination and degradation of PARP1, which triggers DNA damage and the formation of CCF, subsequently activating the cGAS-STING-NF-κB signaling pathway to promote secretion of SASP factors. Treatment with the serotonin receptor antagonist MIA reduced the senescence of cells derived from HGPS patients, naturally aged human skin fibroblasts and aged human mesenchymal stem cells by restoring Ca²⁺ homeostasis. MIA also improved a variety of aging phenotypes and significantly extended the lifespan of both Lmna^G609G/G609G progeric mice and naturally aging mice. Created in BioRender. Tian, L. (2026) https://BioRender.com/ddd358i.

Ca²⁺ is a highly versatile intracellular signal that operates over a wide temporal range to regulate many different cellular processes. Ca²⁺ signals are mainly transmitted by the binding of Ca²⁺ to Ca²⁺ binding proteins, such as S100 family proteins. S100A6 is not only a Ca²⁺ binding protein but can also modulate the concentration of Ca²⁺ in cells. We found that intracellular Ca²⁺ concentrations in the heart, lung, skin, muscle and liver were all elevated in aging Lmna^G609G/G609G mice (Fig. 1h-j and Supplementary Fig. 3a-b). Furthermore, elevated S100A6 expression levels were consistently observed in all these tissues, with the exception of the liver (Fig. 6u-v, Supplementary Fig. 8a-b). Studies showed that high expression of the related proteins S100A8 and S100A9 can promote liver injury and fibrosis⁴⁶, suggesting that Ca²⁺ might promote liver aging in Lmna^G609G/G609G mice by activating other Ca²⁺ binding proteins such as S100A8/A9. Besides heart, lung, and muscle, Ca²⁺ plays an important role in neurons, regulating neurotransmitter release and synaptic plasticity⁴⁷. In our study, MIA improved heart, lung, and muscle function in HGPS mice by reducing Ca²⁺ concentration. Patients with HGPS show systemic premature aging, but usually do not show any significant cognitive impairment because a brain-specific miRNA, miR-9, which prevents the accumulation of progerin and their associated toxic effects in brain⁴⁸. Therefore, in this study, we did not focus on the role of Ca²⁺ in the nervous system.

In the present study, S100A6 was found to be upregulated in multiple tissues in Lmna^G609G/G609G mice, as well as in several physiologically senescent cells and tissues (Fig. 1d, e, Fig. 7b, c, f, g, h, i Supplementary Fig. 2a). However, previous studies have also found that S100A6 is highly expressed in lung cancer cell, liver cancer and breast cancer^49–51. Upregulation of S100A6 in cancer cells mainly occurs in the nucleus, which is crucial for proliferation, invasion, migration and angiogenesis of the cancer cells. High nuclear S100A6 level is significantly associated with poor survival in pancreatic cancer patients¹³. However, in HGPS and physiologically senescent cells, S100A6 is predominantly upregulated in the cytoplasm (Fig. 1m–o, Fig. 7d, e), where it degrades PARP1 and triggers DNA damage (Fig. 2, Fig. 3). We also found that a reduction in S100A6 levels in premature senescence models, including Ras-induced, H₂O₂-induced, and etoposide-induced senescence in IMR90 cells (Fig. 7m–o), suggesting that during premature senescence, cell cycle arrest requires inhibition of the proliferative function of intranuclear S100A6. Our findings suggest that both the levels and localization of S100A6 are important for cell fate determination. Thus, cytoplasmic localization of S100A6 is a characteristic of chronic senescence.

PARP1 is a crucial enzyme for DNA damage repair, playing an important role in maintaining genomic stability^40,52. PARP1 is involved in over 90% of PARylation events and is highly conserved in all higher eukaryotes⁵³. During the aging process, PARP1 is a protein with dual roles. On one hand, PARP1 inhibitors can improve the function of senescent cells by increasing NAD⁺ levels and SIRT1 activity⁵⁴. On the other hand, studies have also found that PARP1, acting as a telomere-binding protein, can prevent abnormal shortening of telomeres⁵⁵. The activity of PARP1 in lymphoblasts of centenarians is significantly higher than in lymphoblasts of adults and elderly individuals (aged 20-70)^56,57. We found that PARP1 expression is downregulated during the senescence of HGPS and natural aging (Fig. 2f, Fig. 7h, Supplementary Fig. 10a, b). After MIA treatment, multi-tissue PARP1 expression was increased in Lmna^G609G/G609G mice and 24-month-old C57BL/6 J mice (Fig. 8n, o, Supplementary Fig. 8c, d). These results suggest that PARP1 can delay aging in both HGPS and natural aging.

The IP3R inhibitor 2-APB not only delays HGPS cellular senescence but also partially ameliorates aging phenotypes in Lmna^G609G/G609G progeroid mice; however, long-term use causes side effects such as tremors in the mice (Fig. 4). Thus, we examined the effects of MIA on Lmna^G609G/G609G mice. As a widely used tetracyclic antidepressant, MIA acts as an antagonist for serotonin and adrenergic receptors by reducing 5-HT reuptake and thus increasing the concentration of 5-HT in the synaptic cleft. MIA can also antagonize serotonin receptors to further reduce intracellular Ca²⁺ concentrations by affecting IP3Rs. Here, we found that serum 5-HT levels were lower in Lmna^G609G/G609G mice, together with high levels of the 5-HT receptors HTR2B and HTR2C in multiple tissues (Fig. 5a–e), these results indicate that HTR2B and HTR2C play important roles in the senescence of multi-tissue cells in HGPS. MIA was found to delay HGPS and natural aging by restoring Ca²⁺ homeostasis (Fig. 5u-z). In addition, we found that MIA treatment led to increased 5-HT levels in the serum of Lmna^G609G/G609G mice (Supplementary Fig. 9a). Previous studies have shown that maintaining high levels of 5-HT/dopamine can improve the aging indices of elderly nematodes⁵⁸. Therefore, it is possible that MIA delays HGPS and natural aging by both restoring intracellular Ca²⁺ homeostasis of cells of multiple tissues and increasing 5-HT levels.

As a clinically approved drug, the clinical safety of MIA is well-characterized. It has been shown that an overdose does not cause fatal arrhythmia and that long-term treatment does not create dependence, and thus MIA is generally considered to be suitable for patients with cardiovascular diseases and elderly patients⁵⁹. Our data shows that MIA not only significantly prolongs the life span of Lmna^G609G/G609G mice and naturally aged C57BL/6 J mice, but also improves aging-related disorders associated with the heart, lung, muscle and musculoskeletal system. Moreover, MIA not only increases serum 5-HT levels in Lmna^G609G/G609G mice, but also improves their preference for sugar water (Supplementary Fig. 9a-b), and does not further impair liver function (Supplementary Fig. 9c-d). Notably, although improved exercise ability was observed in Lmna^G609G/G609G mice and aged C57BL/6 J mice following treatment with 10 mg/kg MIA for eight weeks and four months, respectively, the exercise ability of Lmna^G609G/G609G mice was inhibited following treatment with 20 mg/kg MIA, suggesting a relatively low dose of MIA is suitable for delaying aging with high safety. Our study demonstrating the rejuvenating properties of MIA support the exploitation of MIA as a potential therapy to alleviate age-related disorders, providing a rapid and cost-saving opportunity for clinical translation.

Methods

Cell cultures

CRL-1474, HEK-293T and IMR90 cells were obtained from the American Type Culture Collection (ATCC). HGAFDFN127, HGAFDFN155, and HGADFN167 cells were obtained from The Progeria Research Foundation (PRF). AG05247 (88-years-old) and AG09602 cells (92-years-old) were obtained from the Coriell Cell Repository (CCR). Cells were tested by a MycoBlue Mycoplasma Detector (Vazyme Biotech, Nanjing, China) to exclude Mycoplasma contamination before experiments. CRL-1474, HEK-293T and IMR90 were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Dakewe Biotech, China); HGPS patient cells and skin fibroblasts from 88-year-old and 92-year-old individuals supplemented with 15% fetal bovine serum), and penicillin–streptomycin. HEK-293T cells were cultured at 37 °C in 5% CO₂. CRL-1474, IMR90, HGAFDFN127, HGAFDFN155, HGADFN167, AG05247, and AG09602 were cultured at 37 °C in 5% CO₂ and 5% O₂.

Ras treatment

IMR90 cells were transfected with Vector Ctrl or Ras for 8 h. Then the cells were cultured with fresh complete medium for 5 days before analysis.

H₂O₂ treatment

IMR90 cells were treated with 150 μM H₂O₂ for 2 h. Then the cells were cultured with fresh complete medium for another 48 hours before analysis.

Etoposide treatment

IMR90 cells were incubated with the culture medium containing 10 μM Etoposide for 48 h. Then the cells were cultured with fresh complete medium for another 3 days before analysis.

Plasmids and antibodies

The following vectors were used in this study: pCDH-CMV-3×Flag-progerin, pCDH-CMV-3× Flag-S100A6, pLKO.1-shS100A6#1 and pLKO.1-shS100A6#2. S100A6 interfering oligonucleotides were designed and cloned into the lentiviral RNAi system (pLKO.1). The sequences of shRNAs are described below:

shCtrl_fwd (5′CCGGAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG-3′) and shCtrl_rev (5′AATTCAAAAAAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATT-3′);

shS100A6#1_fwd (5′CCGGCCTGAGCAAGAAGGAGCTGAACTCGAGTTCAGCTCCTTCTTGCTCAGGTTTTTG-3′) and shS100A6#1_rev (5′AATTCAAAAACCTGAGCAAGAAGGAGCTGAACTCGAGTTCAGCTCCTTCTTGCTCAGG −3′);

shS100A6#2_fwd (5′CCGGCGTGGCCATCTTCCACAAGTACTCGAGTACTTGTGGAAGATGGCCACG TTTTTG −3′) and

shS100A6#2_rev(5′AATTCAAAAACGTGGCCATCTTCCACAAGTACTCGAGTACTTGTGGAAGATGGCCACG-3′).

The sequences of siRNAs are described below:

hCACYBP si#1_fwd (5′GAGUUACUCCAUGAUUGUGAATT-3′) and

hCACYBP si#1_rev (5′UUCACAAUCAUGGAGUAACUCTT-3′);

hCACYBP si#2_fwd (5′CAUCAAGUUCCCACUGAGAAUTT-3′) and

hCACYBP si#2_rev (5′AUUCUCAGUGGGAACUUGAUGTT-3′).

The following antibodies were used: antibodies against progerin (ab66587, Abcam); S100A6 (10245-1-AP, Proteintech); β-actin (A1978, Sigma,); Ki67 (GTX16667, GeneTex); Lamin B1 (ab16048, Abcam); Cyclin A2 (667955S, Cell Signaling Technology); Flag (M20008, Abmart); PARP1 (YT6210, Immunoway); IL6 (YT5348, Immunoway); IL8 (abs116134, absin); γH2AX (#9718, Cell Signaling Technology); IRF3 (A2172, Abclonal); p-IRF3(AP1412, Abclonal); p65(sc-8008X, Santa); p-p65(sc-101749, Santa); GAS (YT7062, Immunoway), STING (13647 T, Cell Signaling Technology); p21 (10355-1-AP, Proteintech); p16 (YM8152, Immunoway). Normal mouse IgG (sc-2025, Santa Cruz Biotechnology), normal rabbit IgG (#2729, Cell Signaling Technology), secondary goat anti-mouse, and goat anti-rabbit antibodies were obtained from ZSGB-BIO.

Lentiviral production and infection

The lentivirus packaging plasmids pMDlg/pRRE, VSV-G, pRSV-Rev and the core plasmids were transfected into HEK-293T cells together in a suitable ratio mixed with transfection reagent polyethylenimine. The supernatant was filtered through a 0.45 μm filter after collected in 48 h, and the concentrated virus was then used to infect recipient cell lines with 5 mg/ml polybrene.

RNA preparation and reverse transcription-PCR

Cells and mouse tissues were lysed with TRIzol reagent RNAiso Plus (9109, Takara), and total messenger RNA was isolated according to the manufacturer’s instructions. Reverse transcription was performed with strand cDNA Synthesis SuperMix for qPCR (Hifair, 11141ES60) to obtain complementary DNA. Gene expression levels were determined by quantitative PCR (qPCR) with the Taq SYBR Green qPCR Fremix (Universal) (Yugong Biotech Co., Ltd, EG20117M). β-actin was used as the internal control.

The PCR primer sequences were synthesized by Comate Bioscience, and the specific sequences were as follows:

β-actin (human)_fwd (5′-GAGCACAGAGCCTCGCCTTT-3′) and β-actin_rev (5′-ATCCTTCTGACCCATGCCCA-3′);

PARP1 (human)_fwd (5′-TTTCCATCAAACATGGGCGAC-3′) and PARP1_rev (5′- CGGAGTCTTCGGATAAGCTCT-3′);

HTR2B (human)_fwd (5′-TGATTTGCTGGTTGGATTGTTTG-3′) and HTR2B_rev (5′- ATGGATGCGGTTGAAAAGAGAA-3′);

HTR2C (human)_fwd (5′- CTAATTGGCCTATTGGTTTGGCA-3′) and HTR2C_rev (5′- CCACCATCGGAGGTATTGAAAA-3′);

β-actin (mouse)_fwd (5′-CTAAGGCCAACCGTGAAAAG-3′) and β-actin (mouse)_rev (5′- ACCAGAGGCATACAGGGACA-3′);

HTR2B (mouse)_fwd (5′-TGTTCTCTTTTCAACTGCCTCC-3′) and HTR2B (mouse)_rev (5′- TGCACTGATTGGCCTGAATTG-3′);

HTR2C (mouse)_fwd (5′-ATTGGCCTATTGGTTTGGCAG-3′) and HTR2C (mouse)_rev (5′-CCACCATCGGAGGAATTAAAAGT-3′);

IL-6 (mouse)_fwd (5′-CTGCAAGAGACTTCCATCCAG-3′) and IL-6 (mouse)_rev (5′- AGTGGTATAGACAGGTCTGTTGG-3′);

CXCL10 (mouse) _fwd (5′-CCAAGTGCTGCCGTCATTTTC-3′) and CXCL10 (mouse)_rev (5′- GGCTCGCAGGGATGATTTCAA-3′);

IL-1β _fwd (5′-TGAAATGCCACCTTTTGACA-3′) and IL-1β (mouse)_rev (5′- CTTCTCCACAGCCACAATGA-3′);

TNF-α _fwd (5′-TCTCGAACCCCGAGTGACAA-3′) and TNF-α (mouse)_rev (5′- TCAGCCACTGGAGCTGCC-3′);

Western blot

Cells were washed three times with ice-cold PBS, harvested, and lysed in 1× Laemmli sample buffer. Following separation via SDS-PAGE, the proteins were transferred to 0.45 μm hydrophobic PVDF membranes (Merck Millipore, Cork, Ireland). The membranes were probed with specific primary antibodies and enzyme-conjugated secondary antibodies. Signal detection was carried out using an Enhanced Chemiluminescence (ECL) kit, and images were acquired with a Tanon 5500 CCD imaging system.

Co-IP assay

Cells were harvested, washed twice with ice-cold PBS, and lysed in Buffer A [20 mM Tris-HCl (pH 8.0), 10 mM NaCl, 1 mM EDTA, and 0.5% NP-40] supplemented with protease inhibitors. The lysates were incubated on ice and subjected to vortex oscillation for 10 times (1 min each). Following centrifugation at 12000×g for 15 min at 4 °C, the supernatants were collected and incubated with 2-5 μg of specific primary antibodies overnight at 4 °C with gentle agitation. Subsequently, 40 μL of Protein A/G magnetic beads were added, and the mixture was incubated for 2-4 h at room temperature. After washing the beads three times with PBS containing protease inhibitors (5 min per wash), the samples were resuspended in 80 μL of 2× loading buffer and denatured at 100 °C for 8 min. The supernatants were then collected for analysis by immunoblotting.

SA-β-gal staining

Cells were fixed with 1% formaldehyde at room temperature for 15 min, washed three times with PBS (pH 6.0) containing 1 mM MgCl₂, and subsequently incubated with the staining solution at 37 °C for 16 h. Finally, the cells were observed and analyzed using a fluorescence microscope.

Immunofluorescence

Cells were seeded the day prior to the experiment. For immunofluorescence staining, cells were fixed with 1% formaldehyde in PBS at room temperature for 10 min, followed by permeabilization with 0.2% Triton X-100 in PBS for another 10 min. To block non-specific binding, cells were incubated in a blocking solution containing 2% bovine serum albumin (BSA) and 0.2% Triton X-100 in PBS at 37 °C for 1 h. Subsequently, the cells were incubated with primary antibody overnight, followed by incubation with secondary antibody for 40 min at room temperature. Nuclei were counterstained with DAPI. After mounting, images were acquired and analyzed using a confocal laser scanning microscope.

Mass spectrometry analysis

Flag-S100A6 and empty lentiviral vector (pCDH-CMV-3×Flag) was transfected into HEK-293T cells, cells were harvested and lysed in buffer A (20 mM Tris-HCl pH 8.0, 10 mM NaCl, 1 mM EDTA, 0.5% NP-40) including a protease inhibitor cocktail tablet (Roche) for 30 min at 4 °C. Total protein lysates were incubated overnight with anti-Flag gentle shacking at 4 °C, followed by the addition of 30–50 μL of pure proteome protein A/G mix magnetic beads for another 2 h at room temperature. The beads were washed 3 times with Buffer A and resuspended in 60–100 μL of 2×loading buffer and boiled for 8 min. The purified Flag-S100A6 protein and the pCDH-CMV-3×Flag control, separated by 15% SDS-PAGE and visualized with Coomassie bright blue staining (n = 1), were excised and analyzed by mass spectrometry at APT Biotech (Zhejiang, China).

Mass spectrometry analysis was performed using a Q Exactive (Thermo Fisher) mass spectrometer coupled with an Easy-nLC 1000 system (Thermo Fisher). The samples were reduced and alkylated, followed by digestion with trypsin (enzyme-to-substrate ratio of 1:50) at 37 °C for 20 h. The digested peptides were desalted, lyophilized, and reconstituted in 0.1% formic acid (FA) solution, then stored at −20 °C prior to analysis. Mobile phase A consisted of 0.1% formic acid in water, and mobile phase B consisted of 0.1% formic acid in 84% acetonitrile. The chromatographic column was equilibrated with 95% mobile phase A. Samples were loaded onto a trap column via an autosampler and subsequently separated by chromatography prior to mass spectrometric analysis. Full MS scans were acquired in positive ion mode over a mass range of m/z 300–1800 at a resolution of 70,000 (at m/z 200). The automatic gain control (AGC) target was set to 1e6, with a maximum injection time (IT) of 50 ms. A dynamic exclusion time of 30.0 s was applied. Tandem mass spectra (MS/MS) were acquired using a Top20 data-dependent acquisition method. Following each full scan, the 20 most intense precursor ions were isolated with a window of 2 m/z and fragmented using Higher-energy Collisional Dissociation (HCD) with a normalized collision energy of 27 eV. The MS/MS spectra were recorded at a resolution of 17500 (at m/z 200). An Underfill ratio of 0.1% was applied. The raw mass spectrometry data files were processed using the Proteome Discoverer 2.5 search engine against the corresponding database to identify proteins.

Ca²⁺ concentration level visualization

CRL-1474 and HGADFN127 cells were cultured in glass bottom cell culture dishes. Upon reaching 70 − 80% confluency, the Ca²⁺ levels were measured by Fluo-4 Calcium Assay Kit (Beyotime, S1061S) according to manufacturer’s instructions.

Ca²⁺ concentration analysis

The Ca²⁺ concentration in cells (CRL-1474, HGADFN127, HGADFN155 and HGADFN167) and mice tissue cells was measured using a Fluo-4 Calcium Assay Kit (Beyotime, S1061S) according to manufacturer’s instructions.

Measurement of ER Ca²⁺

CRL-1474 and HGADFN127 cells were cultured in glass bottom cell culture dishes. Upon reaching 70 − 80% confluency, the calcium levels were measured by Mag-Fluo-4 AM (MCE, HY-D1498) according to manufacturer’s instructions.

Measurement of mitochondrial Ca²⁺

CRL-1474 and HGADFN127 cells were cultured in glass bottom cell culture dishes. Upon reaching 70 − 80% confluency, the calcium levels were measured by rhod-2-AM (Beyotime, S1062S) according to manufacturer’s instructions.

Endoplasmic reticulum staining

ER was stained using ER-Tracker™ Red (Invitrogen, E34250) according to the manufacturer’s instructions.

Mitochondrial staining

Mitochondrial was stained using Mito-Tracker Green (Beyotime, C1048) according to the manufacturer’s instructions.

Primary human bone marrow mesenchymal stem cells isolation

Bone marrow blood from individuals of different ages was collected at the First Hospital of Jilin University with the approval from the hospital’s Ethics Committee (22K095-002) Bone marrow blood, obtained as an inevitable byproduct of the surgical procedure, was collected and filtered through a 70 μm sterile strainer. The filtrate was centrifuged at 1000×g for 10 min to remove the plasma supernatant, and the resulting cell pellet was resuspended in Hank’s solution (Solarbio, China). Subsequently, the cell suspension was carefully layered onto Ficoll lymphocyte separation medium (TBD Science, China) and centrifuged at 2000×g for 20 min for density gradient separation. The mononuclear cell layer was harvested and transferred to a new centrifuge tube, then washed with phosphate-buffered saline (PBS) by centrifugation at 1000×g for 10 min, after which the supernatant was discarded. Finally, the cells were resuspended in complete MEM-α medium and seeded into culture dishes. After 72 h, the medium was changed to remove non-adherent cells, and the remaining adherent cells were identified as human bone marrow mesenchymal stem cells (hBMSCs)⁶⁰.

To investigate S100A6 expression in hBMSCs of varying ages and MIA’s role in elderly hBMSCs, experiments were performed, which were approved by the Ethics Committee of Northeast Normal University (202402068). The human bone marrow mesenchymal stem cell samples included both male and female participants. The biological sex of all participants was verified through a review of medical records.

Human skin histochemical analysis

The skin tissues from different ages individuals were collected from the Second Hospital of Jilin University with the approval from the Medical Ethics Committee of the hospital (2024-439). The expression of S100A6 in human skin tissues of different ages was performed, which was approved by the Ethics Committee of Northeast Normal University (202402069). The human skin tissue samples were incidental specimens from breast resection surgeries, and thus all donors were female. The biological sex of all participants was verified through a review of medical records.

Animal experiments

All animal experiments were approved by Ethics Committee of School of Life Sciences, Northeast Normal University, China (202402050, 202402051, 202402052). Lmna^G609G/G609G mice on an ICR background were generated using the BE4-Gam gene editing system²⁰. 20-month-old C57BL/6 J mice were purchased from Zhejiang Weitong Lihua Laboratory Animal Technology. 4-month-old and 20-month-old rats were purchased from HFK Bioscience (Beijing, China). Mice were maintained at 24 °C and 40% humidity with a 12 h light/dark cycle (06:00–18:00) and had ad libitum access to water and standard rodent chow. To ensure the comprehensiveness and representativeness of our conclusions, the main experiments using HGPS mouse models included both male and female animals. For aged C57BL/6 J mice, only male animals were used due to the difficulty in acquiring aged female mice.

Tandem mass tag (TMT) proteomics sequencing analysis

Lung tissues of 12-week-old Lmna^+/+ and Lmna^G609G/G609G mice were collected for TMT proteomic sequencing, which was performed in APT Biotech (Zhejiang, China).

MIA treatment

MIA (MCE, HY-B0188A) was dissolved in 0.9% saline and intraperitoneally injected into 4-week-old Lmna^G609G/G609G mice at a dose of 10 mg/kg or 20 mg/kg (every other day). 10 mg/kg MIA was intraperitoneally injected into 20-month-old C57BL/6 J mice every other day.

2-APB treatment

2-APB (Selleck, S6657) was dissolved in a cosolvent (5% DMSO, 40% PEG300, 5% Tween 80, and 50% ddH₂O) and intraperitoneally injected into 4-week-old Lmna^G609G/G609G mice at a dose of 2 mg/kg (every other day).

Open field experiments in mice

Let the animals acclimate in the lab an hour earlier. Before each mouse is tested, the test unit needs to be cleaned with 75% ethanol. The mice were placed in a quiet environment to prevent interference with the test results. Ethovision XT10 was used to record the movement distance and trajectory of mice for 20 min.

Grip strength

Grip strength was measured by grip strength tester (BIOSEB). After grasping the metal grid, the mice were pulled backward horizontally, and the value displayed on the instrument represents their grip strength.

Echocardiography

After inhalation of isoflurane gas in mice, echocardiography was detected using the Feinol small animal color Doppler ultrasound imaging system. Left ventricular ejection fraction and left ventricular shortening fraction were obtained by echocardiography.

Detection of lung function in mice

The NAM system measured respiratory rate, tidal volume, and airway resistance in mice.

Detection of 5-HT concentration in serum

The concentration of 5-HT in serum of 12-week-old mice was detected by ST/5-HT ELISA kit (Sangon Biotech, D751013).

Masson’s trichrome staining

Masson staining was performed using a Masson dyeing kit (Absin, abs9347) according to manufacturer’s instructions. The fibrosis in heart, lung and muscle were calculated by Image J, unpaired Student’s t-test.

In situ muscle force

Mice were anesthetized with an i.p. injection of Avertin (Avertin: 200 mg/kg). The distal tendon of the right TA muscle was isolated and attached in turn with surgical 4.0 silk to the lever arm of a 300 C-LR servomotor (Aurora Scientific Instruments, Aurora, ON, Canada). The Dynamic Muscle Control and Analysis Software Suite (Aurora Scientific Instruments) was used for collection and data analysis. The partially exposed muscle surface of the TA was kept moist for the contractile stimulation protocol and was directly stimulated with an electrode placed on the belly of the muscle. Muscle length was adjusted to a fixed baseline of ~40-mN resting tension for all muscles/conditions. The pulse duration was set to 0.2 ms for twitch contractions. Tetanic contractions are the following: frequency, 100 Hz; pulse width, 0.2 ms; duration, 0.5 s; stimulation, 100 mA. Specific force was normalized to the physiological cross-sectional area (CSA) of the tibialis anterior (TA) muscle, calculated using the formula: CSA = muscle mass / (Lf × 1.06), where Lf is the fiber length estimated as Lo × 0.6 (with Lo being the optimal muscle length), based on the established fiber length-to-muscle length ratio for mouse TA, and 1.06 g/cm³ is the assumed density of skeletal muscle.”

Evaluation of hair status

The hair status was evaluated and scored based on factors including shine, fur quality, piloerection, and the extent of hair loss on the back. Score of 1: Indicates a shiny, well-kept, and bright hair coat with no detectable hair loss. Score of 2: Indicates slight shedding, revealing some gray hair, an unkempt coat, and the presence of a few small patches or less than 10% hair loss on the back. Score of 3: Indicates gray hair, a dull coat, mild piloerection, and several small patches or 20%-50% hair loss on the back. Score of 4: Indicates bristled, clumped, and dull fur with piloerection, larger patches, or generalized hair loss (not patchy) exceeding 50% of the back.

Detection of serum AST and ALT levels

The serum AST and ALT levels were detected by Aspartate aminotransferase Assay kit (C010-2-1, Nanjing Jiancheng Bioengineering) and Alanine aminotransferase Assay kit (C009-2-1, Nanjing Jiancheng Bioengineering).

Statistical analysis

The results were compiled from at last three independent replicate experiments and are presented as mean ± SD. Statistical parameters and methods are reported in the figures. Statistical analysis was performed by two-sided unpaired Student’s t-test or one-way ANOVA with GraphPad Prism v.6 software. lmagel v.152a was used for analyzing immunofluorescence signal intensity and calculating the the areas of fibrosis in the tissues. The Log-rank test was used to compare Kaplan-Meier survival curves and evaluate differences in survival rates between groups.

Schematic diagrams were generated using BioRender.com. The specific license identifiers for each figure are as follows:

Figure 1a (https://BioRender.com/5d701ta); Fig. 1u (https://BioRender.com/y476ddv). Figure 2a (https://BioRender.com/2fy9569); Fig. 2q (https://BioRender.com/a7iyqnv); Fig. 4g, Fig. 6a and supplementary fig. 6a (https://BioRender.com/99ll4u9); Fig. 7a (https://BioRender.com/hcigi3k); Fig. 8a (https://BioRender.com/ajcua4m); Fig. 8d (https://BioRender.com/z0yrjy8); Fig. 9 (https://BioRender.com/ddd358i).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Author contributions

W.X., Y.Z., Q.H., B.H., J.L., X.C. and W.L. designed all experiments and wrote the manuscript. W.X and Q.H prepared the figures. W.X., Y.W., P.S., X.W., X.L. and Z.W. performed immunohistochemical experiments on rat, mouse and human skin tissue. W.X., H.J., M.Q., L.L., Y.J. and J.M. performed and/or analyzed celular and mice experiments. D.Z. and H.L. performed and/or analyzed in mice muscle electrophysiology Y.Y.W performed and/or analyzed hBMSCs experiments.

Peer review

Peer review information

Nature Communications thanks Peter de Keizer, Hongyang Xu and the other anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Funding

This work was supported by the grants from the National Natural Science Foundation of China (grant numbers: 32371216 and 32171163 to Y.Z, 32271207 to J.L), the Scientific Research Innovation Capability Support Project for Young Faculty (SRICSPYF-ZY2025126 to Y.Z), the Development and Reform Commission of Jilin Province (grant numbers: 2024C013-1 to Y.Z), the Natural Science Foundation of Jilin Province (20230101153JC to J.L), and the Foundation Research Funds for Central Universities.

Data availability

All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary information. The TMT proteomics and MS data from this study have been submitted to the PRIDE database (http://www.ebi.ac.uk/pride), with project accessions PXD061485 and PXD061708, respectively. Source data are provided with this paper.

Competing interests

The authors declare that they have no conflict of interest.

Supplementary information

The online version contains supplementary material available at 10.1038/s41467-026-74021-z.