Transcriptomic evidence suggesting a Trojan horse‐like synergistic effect in exposures to nanoplastics and benzo[a]pyrene on a yellowfin sea bream muscle derived cell line

Abstract

In this study, a new cell line named yellowfin sea bream muscle (YSBM) was successfully established by using muscle tissue from yellowfin seabream, Acanthopagrus latus, a widespread saline fish cultivated in China. The YSBM cell line was subcultured more than 100 passages and appeared to be suitable for researching gene functions in vitro, as it was able to be transfected successfully with pEGFP‐N3 plasmid. Additionally, YSBM cells were found to be susceptible to red‐spotted grouper nervous necrosis virus (RGNNV), suggesting that this cell line can be a valuable resource for fish virology research. Further, YSBM cells were employed in environmental pollutant exposure experiments to investigate the mechanisms of damage caused by these pollutants to muscle tissue of aquatic organisms. We exposed YSBM cells to nanoplastics (NPs), benzo[a]pyrene (BaP) and a mixture of both, and performed transcriptome analysis on the samples. Our transcriptome analyses revealed discernible variations in the effects on the cells between the groups where BaP and NPs were processed separately. Interestingly, joint treatment with the two pollutants resulted in a synergistic toxicity, an effect reminiscent of the hypothesized ‘Trojan horse’ mechanism, where the mixture of BaP and NPs demonstrated mutually augmenting toxicities on aquatic organisms. Overall, our results suggest that the YSBM cell line could be a valuable tool in aquatic environmental pollution toxicological analysis. It is particularly useful for evaluating the effects of environmental pollutants on fish and their potential impact on humans via the food chain. A graphical abstract is provided to illustrate the methodology and key findings of this study. Thus, our study sheds new light on the potential risks of environmental contaminants and illustrates the usefulness of YSBM cells for environmental toxicology research.

1. INTRODUCTION

Yellowfin seabream (Acanthopagrus latus) is an ecologically and commercially important marine fish in the Indo‐West Pacific (Nasari et al., 2014). In China, it is valued for its appearance, taste and nutritional value (Iwatsuki, 2013). However, intensive aquaculture and environmental pollutants have led to significant disease outbreaks, causing economic losses. Various bacterial pathogens (e.g. Aeromonas hydrophila, Vibrio harveyi) and viruses (e.g. nervous necrosis virus) have been reported in A. latus, making it a potential model for studying fish disease and pollutant impacts (Azadbakht et al., 2019; Esmaeili et al., 2019; Fu et al., 2022; Tsai et al., 2012).

The safety of aquatic products is a major public concern, particularly regarding the transmission of pollutants through the food chain to humans. Benzo[a]pyrene (BaP), a widespread environmental contaminant, is known to pose risks to human health (e.g. cardiovascular disease, endocrine disruption) and aquatic organisms (Grung et al., 2009; Yazdani, 2020). Similarly, nanoplastics (NPs), increasingly prevalent in aquatic ecosystems, can infiltrate tissues, accumulate in organisms and be transferred along the food chain, affecting behaviour, growth and survival (Bouwmeester et al., 2015; Chae et al., 2018; Lee et al., 2019; Toussaint et al., 2019).

In aquatic environments, NPs often coexist with hydrophobic pollutants like BaP. Due to their large surface area and hydrophobic properties, NPs can adsorb and concentrate BaP, potentially altering its bioavailability and toxicity. Studying the combined effects of such pollutants is crucial for risk assessment.

Fish cell lines are valuable tools for immunological, genetic, virological and toxicological research (Abdul Majeed et al., 2014; Bermejo‐Nogales et al., 2017; Wang et al., 2014). The construction of fish cell lines is essential for the isolation, identification and characterization of fish pathogenic viruses (Ruiz‐Palacios et al., 2020; Swaminathan et al., 2015). In yellowfin seabream, its fin (ALF), liver (ALL) and brain (YFSBB) cell lines have been shown to be useful for virus propagation (Fu et al., 2022; Jia et al., 2022). However, a muscle‐derived cell line has not yet been established or characterized.

In this study, we established and characterized a new muscle‐derived cell line (YSMB) from yellowfin seabream. We evaluated its molecular properties, optimal growth conditions and transfection efficiency. Furthermore, we demonstrated its susceptibility to red‐spotted grouper nervous necrosis virus (RGNNV) infection through cytopathic effect observation and viral gene expression analysis. Finally, using transcriptomics, we investigated the mechanisms of cell damage induced by NPs, BaP and their mixture in YSMB cells. This cell line provides a robust in vitromodel for studying virus–host interactions and the toxicological effects of environmental pollutants on aquatic organisms.

2. MATERIALS AND METHODS

2.1. Preparation of muscle tissue for primary cell culture

Robust Acanthopagrus latus were sourced from a fish farm in Shenzhen, China, measuring an average body length of 5 cm. Fish were anaesthetised by adding MS‐222 (Sigma‐Aldrich) to water at a concentration of 5 g L⁻¹, followed by surface sterilization using 70% ethanol. Muscle tissue was aseptically extracted using sterile cutting tools. Subsequently, the tissue underwent four washes with Leibovitz's L‐15 medium supplemented with antibiotics (400 IU mL⁻¹ penicillin, 400 μg mL⁻¹ streptomycin; Gibco). Next, the muscle tissue was sliced into tiny fragments (1 mm³) and moved to a culture dish with 2 mL of Leibovitz's L‐15 medium, supplemented with 20% fetal bovine serum (FBS) and antibiotics. The muscle clips were evenly distributed at the base of a tissue culture flask measuring 25 cm², inverted and incubated at a temperature of 37°C for a duration of 2 h. Subsequently, the muscle clips were introduced into another 25 cm² tissue culture flask, along with the addition of 5 mL of Leibovitz's L‐15 medium, 20% FBS and antibiotics. The growth medium was changed every 3 or 4 days, up to about 3 weeks, with 50% of it being changed each time.

2.2. Subculture, maintenance and cryostorage

Once a continuous layer was formed, the medium was removed by using a 0.25% trypsin–EDTA solution (Life Technologies) to separate the cells. The isolated cells were cultured again (1/2 ratio) in Leibovitz's L‐15 medium supplemented with 20% FBS and antibiotics (400 IU mL⁻¹ penicillin, 400 μg mL⁻¹ streptomycin). Throughout the initial five to 10 iterations, half of the volume of the culture medium was consistently substituted with new medium. Over time, the FBS level in the culture medium decreased to 10%, while the antibiotics were reduced to standard concentrations of 100 IU mL⁻¹ penicillin and 100 μg mL⁻¹ streptomycin. After the 15 passages, the 10% FBS‐containing culture medium L15 was antibiotics‐free.

To assess the survival of YSBM cells stored at a temperature of −196°C in liquid nitrogen, a freezing solution comprising of L‐15 growth medium supplemented with 10% dimethyl sulfoxide (DMSO; Sigma‐Aldrich) and 20% FBS was employed. After treating the confluent cells with a 0.25% trypsin solution, they were subjected to centrifugation at 200 × g for 10 min and then suspended in suitable amounts of the freezing medium. Subsequently, the cell suspensions were transferred into cryovials (1.5 mL per vial), slowly frozen (at 4°C for 30 min, −30°C for 2 h and −80°C overnight) and subsequently stored in liquid nitrogen containers at −196°C.

For the revival procedure, frozen cells were quickly defrosted in a water bath at a temperature of 37°C, followed by centrifugation at room temperature (200 × g, 5 min). Following the elimination of the freezing solution, the pellets were reconstituted in Leibovitz's L‐15 medium containing 10% FBS and incubated overnight at 28°C in 25cm² tissue flasks. Trypan blue staining was used to determine cell viability using a haemocytometer.

2.3. PCR amplification and sequencing

To verify the origin of A. latus cells, we amplified and sequenced partial segments of 18S rRNA and CytB. The Tissue gDNA Kit (Biomiga) was used to isolate genomic DNA from YSBM cells at passage 10. Two primer pairs (CytB‐F: ATTGGACGAGTGTTCCGCCA, CytB‐R: GAAAAACACATCCTTTGCTA; 18SrRNA‐F: CTAGCGGACATACGAATGCCCCCG, 18SrRNA‐R: ACTTTCTGTGCCTACCATGGTGAC) were designed to amplify internal sequences of the CytB gene and 18S rRNA gene of A. latus. After being separated on agarose gels with a concentration of 1.2%, the PCR products underwent purification in preparation for Sanger sequencing. Afterwards, the obtained sequences were compared to known sequences in the NCBI database using the Basic Local Alignment Search Tool.

2.4. Cell growth properties

The analysis of cell growth focused on investigating the impact of varying temperatures and concentrations of FBS on the rate of growth. Cells from the YSBM cell line were seeded into a 12‐well plate at a density of 2 × 10⁵ cells per well, at passage 25, under varying temperature and FBS concentrations. The cells were cultivated in Leibovitz's L‐15 solution supplemented with 10% fetal bovine serum (FBS) and subjected to incubation at 15°C, 24°C and 28°C. Afterward, the cells were detached and enumerated using six separate haemocytometer counts at 2‐, 4‐, 6‐ and 8‐days following cell passage. The same protocols were conducted to assess the cellular growth reaction to different levels of FBS (5%, 10%, 15% and 20%) mentioned earlier, under incubation at a temperature of 28°C.

2.5. Transfection with pEGFP‐N3 plasmid

To analyse gene expression, the pEGFP‐N3 enhanced green fluorescent protein plasmid was utilized for transfection into YSBM cells. At passage 50, YSBM cells were placed separately into 24‐well plates and cultured at a concentration of 2 × 105 cells mL⁻¹ for a duration of 16 h. After the formation of a subconfluent monolayer, the cells were transfected with 800 ng of pEGFP‐N3 plasmid using Lipofectamine 2000 from Invitrogen. Following a 24‐h period, the Leica fluorescence microscope detected the presence of green fluorescent signals.

2.6. Virus infection, replication and electron microscopy analysis

RGNNV was utilized to assess the vulnerability of YSBM cells. The YSBM cells were cultured in 24‐well dishes for a duration of 16 h. Following infection with RGNNV, the YSBM cells exhibited cytopathic effects (CPE), and cell lysates were obtained at 24 and 48 h after infection (p.i.). qRT‐PCR was performed on an Applied Biosystems QuantStudio 5 Real Time PCR System (Thermofisher) using the SYBR Green Real‐Time PCR Kit (Toyobo) to detect the levels of RGNNV CP and RdRp in YSBM cells following RGNNV infection, according to the manufacturer's protocol. Moreover, cells infected with RGNNV were readied for electron microscopy following the methods described in a previous study (Wei et al., 2020). The mean ± standard deviation represents all the outcomes. The data underwent statistical analysis using one‐way analysis of variance and subsequently underwent Student's t‐test. Statistically significant differences were deemed at a significance level of p < 0.05. The data presented in this study are the result of three separate experiments.

2.7. Toxicological effects of pharmaceutical agents

2.7.1. NPs and characterization

Polystyrene NPs that emit green fluorescence were acquired from Tianjin BaseLine ChromTech Research Centre in Tianjin, China. These plastics have a particle size of 100 nm and a concentration of 1.8189 × 10¹³ items mL⁻¹. They exhibit excitation and emission peaks at 488 and 518 nm, correspondingly. The identification of the polystyrene material utilized in the trial was confirmed using a micro‐Fourier transform infrared (μ‐FTIR) spectroscope, following the approach suggested by Gu et al. (2020). The NPs were obtained as an aqueous stock suspension (1.8189 × 10¹³ items/mL) and were diluted directly into complete cell culture medium (L‐15 with 10% FBS) for exposure. No organic solvent was used for NP dispersion. BaP in methanol was obtained from Sigma‐Aldrich. BaP was delivered using dimethyl sulfoxide (DMSO) as the solvent. A BaP stock solution in DMSO was diluted into culture medium for exposure, with a final DMSO concentration of <0.1% (v/v). The BaP analysis was conducted following methods described in previous studies (Jarvis et al., 2014).

2.7.2. YSMB cells exposure and cytotoxicity

To determine cytotoxicity, 96‐well plates were used to seed four sets of YSMB cells, each containing 2.5 × 10⁴ cells per well, and left to adhere overnight. The experiment involved exposing three different groups to BaP (referred to as the BaP group), NP (named the NP group) and a combination of BaP and NPs (named the BaP‐NP group). The control group, named the NC group, was treated with an equal volume of L15 medium. Each group was exposed for a duration of 24 h. Finally, groups of cell samples were collected for RNA extraction.

2.7.3. RNA extraction and transcriptome library construction

Cell samples were used to extract the total RNA using the Trizol kit (Invitrogen) according to the instructions provided by the manufacturer. The extracted RNAs were subsequently evaluated on an Agilent 2100 Bioanalyzer (Agilent Technologies). Simultaneously, RNA quality was analysed using a 1.5% agarose gel in a horizontal electrophoresis device. Afterwards, the RNA samples were dispatched to Gene Nenovo located in Guangzhou, China for transcriptome sequencing.

2.7.4. Bioinformatics analysis of transcriptome databases

To achieve reads of excellent quality, the sequencing reads underwent thorough filtration using the fastp (version 0.18.0) (Chen et al., 2018) software for obtaining high‐quality, unblemished reads. The filtration procedure involved (1) discarding reads with adapters, (2) excluding reads with over 10% of unidentified nucleotides and (3) eliminating low‐quality reads that display more than 50% of low‐quality bases with a Q‐value of ≤20. Following the filtration process, the clean reads underwent short‐read alignment using Bowtie2 (version 2.2.8) (Langmead & Salzberg, 2012) software against the ribosome RNA (rRNA) database, and any reads that were successfully mapped were subsequently eliminated. The remaining reads were thusly employed for assembly. Afterwards, the clean reads from paired‐end sequencing were computationally aligned to a reference genome using HISAT2.2.4 (Kim et al., 2015).

2.7.5. GO and KEGG analysis of differentially expressed genes

The StringTie software was used to estimate gene expression levels, which were based on the FPKM values, representing fragments per kilo base of transcript per million mapped reads. The DESeq2 software tool (Love et al., 2014) was used to perform differential expression analysis of RNAs in two separate groups. Genes/transcripts were classified as differentially expressed if they had a false discovery rate (FDR) value below 0.05 and a fold change of at least ≥2. Therefore, we utilized the GO seq R package (Young et al., 2010) and the KEGG Orthology database (Ogata et al., 1999) to conduct the analysis of Kyoto Encyclopedia of Genes and Genomes (KEGG) and annotate the differentially expressed genes (DEGs) with Gene Ontology (GO) information. Moreover, we discovered GO terms and KEGG pathways that exhibited adjusted p values below 0.05, indicating significant enrichment.

3. RESULTS

3.1. The cellular structure and molecular properties of YSBM cells

The growth of YSBM cells in muscle tissue explants was observed for 6 days. The cells showed significant migration from the edges of the tissue clips and thrived extensively, forming a monolayer within the first 15 days of the initial culture, as shown in Figure S1a. After the passage 20, the cells were subcultured every 3–5 days at a ratio of 1:2, as shown in Figure S1b. Surprisingly, the YSBM cells experienced more than 100 rounds of subculture, displaying dense monolayers with a decreased FBS of 10% in the Leibovitz's L‐15 medium, as shown in Figure S1c. Moreover, the confirmation of YSBM's source was established through the amplification of CytB and 18S rRNA gene extracted from the DNA of YSBM cells. The YSBM cells yield PCR products of 469 and 589 bp, as shown in Figure S1d,e. Through comparative sequence analysis, it was found that the YSBM cells were derived from A. latus, as they showed a 99% similarity to the known CytB and 18S rRNA sequences of this species (GenBank accession no YP_006666107 and AB089345, respectively).

3.2. Optimum growth studies

The cultivation of the newly established YSBM cells in vitro was dependent on the temperature and concentration of FBS, as per our findings. The YSBM cells exhibited optimal growth at temperatures ranging from 15°C to 28°C, while surprisingly growing significantly faster at 28°C, as depicted in Figure S2a. The YSBM cells experienced an increase in their growth rate when FBS was added to the L‐15 medium. Notably, the addition of FBS in concentrations ranging from 5% to 20% at 28°C resulted in significant enhancements. The findings from our study showed that the cells exhibited robust growth in 10% FBS and 20% FBS with minimal fluctuations, but their growth rate was considerably impaired in 5% FBS, as illustrated in Figure S2b. Therefore, considering our objective of decreasing expenses related to media, we determine that the most effective upkeep for YSBM cells requires utilizing a 10% FBS level.

3.3. Transfection efficiency

Figure S3 demonstrates the successful transfection of plasmid pEGFP‐N3 in YSBM cells at passage 50 (Figure S3). Surprisingly, within just 24 h after transfection, there were noticeable and intense signals of green fluorescence, which clearly suggests that the YSBM cell line is exceptionally suitable for studying gene expression and transfection.

3.4. Virus susceptibility

In our study, we observed that YSBM cell line was prone to RGNNV infection, resulting in the presence of characteristic CPE and noticeable cytoplasmic vacuoles within 24 and 48 h after being infected with RGNNV, as shown in (Figure 1a). Significantly, the transcriptional expression of the indicative genes for RGNNV showed a notable increase according to qRT‐PCR. Both the CP and RDRP genes exhibited an elevated level of expression, as depicted in Figure 1b. Additionally, the examination of ultrastructure revealed a significant quantity of viral particles within cells infected by RGNNV, with the particles gathering in the cytoplasmic vacuoles, as illustrated in Figure 1c. Taken together, these findings in Figure 1 suggest that RGNNV could effectively infect and reproduce in the recently developed YSBM cells.

FIGURE 1.

Replication characteristics of red‐spotted grouper nervous necrosis virus (RGNNV) in yellowfin sea bream muscle (YSBM) cells. (a) The cytopathology of YSBM cells infected by RGNNV at 24 h p.i. (left) and 48 h p.i. (right). (b) Relative mRNA levels of RGNNV capsid protein (CP) and RDRP in YSBM cells after RGNNV infection were assessed by quantitative real‐time PCR. Results are presented as mean ± standard deviation of three independent experiments. (c) Transmission electron micrographs of RGNNV‐infected YSBM cells. As indicated by arrows, virus particles were observed in the cytoplasm of YSBM cells at 24 h p.i.

To investigate the toxicity of BaP, NPs and the mixture of the two pollutants on YSBM cells, we set up BaP at concentrations of 0, 1, 2, 4, 6, 8, 10 and 20 μM, which indicated that the concentration of BaP at 0–4 μM could promote cell proliferation, the concentration of BaP at 4–8 μM did not have a significant effect on the viability of the cells, and the concentration of BaP at greater than 20 μM concentration of BaP was significantly toxic to YSBM cells, with a significant decrease in cell viability (Figure 2a), thus we chose a 10 μM concentration of BaP as the optimal concentration. Similarly, we set up four different concentrations of NPs and detected its cell survival rate using CCK‐8 kit, in which 5–500 μM concentration of NPs had no significant effect on cell viability, and 5000 μM concentration of NPs inhibited cell viability significantly, while the cell survival rate was still higher than 90% (Figure 2b), therefore we chose 5000 μM NPs as the optimal concentration. In addition, we set up six different concentrations of mixed pollutants based on the effects of the previous two pollutants on cell viability by separately infecting the cells at different concentrations, and selected 10 μM BaP mixed with 5000 μM NPs as the most suitable mixed infection concentration (Figure 2c).

FIGURE 2.

Effects of different concentrations of benzo[a]pyrene (BaP) (a), nanoplastics (NPs) (b) and mixture of BaP and NPs on cell activity, with asterisks indicating significance. (a) Eight gradient concentrations of BaP were set up and cell survival was detected at 12, 24 and 48 h. The 20 μM concentration of BaP was significantly toxic to the cells. (b) Four concentration gradients of NP were set up and the cell survival rate was detected at 12, 24 and 48 h. The 5000 μM NPs was higher than 90%, although the cell survival rate decreased. (c) Based on the effect of different concentrations of BaP as well as NPs on cell viability, we selected six mixtures with different concentrations and tested their effect on cell viability. The asterisk indicating significance.

3.5. Transcriptome information from cells exposed to BaP and NPs

3.5.1. Transcriptome sequencing and annotation

Table 1 provides a summary of the sequencing data quality and the ratio of clean reads mapped for the four libraries. After filtering the raw data, a total of 8151, 806,707, 7969, 959,573, 7019, 331,657 and 7872,834,257 clean read entries were obtained from the four libraries. The GC content varied between 48.88% and 49.33%. The exceptional calibre of these pristine readings was apparent due to the error rate being less than 0.05, Q20 exceeding 97.47% and Q30 surpassing 93%. Significantly, the proportion of mapped reads exceeded 95.73%, suggesting that the annotation was not only precise but also reliable. The original sequence data mentioned in this article have been stored in the Genome Sequence Archive (Chen et al., 2021) at the National Genomics Data Center (Xue et al., 2022), which is part of the China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (GSA CRA011503). These data are available to the public at https://ngdc.cncb.ac.cn/gsa.

TABLE 1.

The quality of sequencing data and the mapping ratio of clean reads.

Library	CleanData (bp)	Q20 (%)	Q30 (%)	GC%	Total mapped (%)
NC	8,151,806,707	97.61%	93.48%	49.33%	96.19%
NPs	7,969,959,573	97.52%	93.36%	49.22%	96.06%
BaP	7,019,331,657	97.56%	93.47%	49.18%	95.90%
BaP + NPs	7,878,834,257	97.47%	93.28%	48.88%	95.73%

Abbreviations: BaP, benzo[a]pyrene; NPs, nanoplastics.

3.5.2. DEGs between different comparison groups

The four transcriptome databases were utilized for five pairwise comparisons, namely NC versus BaP, NC versus NPs, NC versus BaP‐NPs, BaP versus BaP‐NPs and NPs versus BaP‐NPs. The transcriptomic data were validated by quantitative real‐time PCR (qPCR) on key DEGs, with results consistent with RNA‐seq. These data are presented in Table S1. The data illustrates the genes that are expressed differently among various comparison groups (Figures 3a,b, 4a,b, 5a,b, 6a,b and 7a,b). In the comparison between NC and BaP, a total of 674 significant DEGs were detected, comprising 307 genes that were upregulated and 367 genes that were downregulated (Figure 3a,b). The comparison between NC and NPs resulted in 3543 DEGs, consisting of 2505 genes that were upregulated and 1038 genes that were downregulated (Figure 4a,b). Moreover, when comparing NC and BaP‐NPs, a total of 1038 DEGs were identified, consisting of 748 genes that were upregulated and 290 genes that were downregulated (Figure 5a,b). The comparison between BaP and BaP‐NPs resulted in the identification of 730 DEGs, consisting of 556 genes that were upregulated and 174 genes that were downregulated (Figure 6a,b). In conclusion, the comparison between NPs and BaP‐NPs resulted in 3005 DEGs, with 969 genes showing upregulation and 2036 genes showing downregulation (Figure 7a,b).

FIGURE 3.

The transcriptome data of NC versus BaP group. (a) Volcano map of differentially expressed genes. Red dots indicate significantly upregulated genes, blue dots indicate significantly downregulated genes. (b) Heat map of clustering analysis of differential expressed genes. Red represents significantly upregulated genes, blue represents significantly downregulated genes. (c) GO enrichment map of differential expressed genes. BP, biological processes; CC, cellular component; MF, molecular function. (d) KEGG enrichment map of differential expressed genes. Different colours indicate KEGG classification: purple, cellular processes; green, environmental information processing; blue, metabolism; yellow, genetic information processing; orange, organismal systems; pink, human diseases.

FIGURE 4.

The transcriptome data of NC versus nanoplastics (NPs) group. (a) Volcano map of differentially expressed genes. Red dots indicate significantly upregulated genes, blue dots indicate significantly downregulated genes. (b) Heat map of clustering analysis of differential expressed genes. Red represents significantly upregulated genes, blue represents significantly downregulated genes. (c) GO enrichment map of differential expressed genes. BP, biological processes; CC, cellular component; MF, molecular function. (d) KEGG enrichment map of differential expressed genes. Different colours indicate KEGG classification: purple, cellular processes; green, environmental information processing; blue, metabolism; yellow, genetic information processing; orange, organismal systems; pink, human diseases.

FIGURE 5.

The transcriptome data of NC versus benzo[a]pyrene (BaP)‐nanoplastics (NPs) group. (a) Volcano map of differentially expressed genes. Red dots indicate significantly upregulated genes, blue dots indicate significantly downregulated genes. (b) Heat map of clustering analysis of differential expressed genes. Red represents significantly upregulated genes, blue represents significantly downregulated genes. (c) GO enrichment map of differential expressed genes. BP, biological processes; CC, cellular component; MF, molecular function. (d) KEGG enrichment map of differential expressed genes. Different colours indicate KEGG classification: purple, cellular processes; green, environmental information processing; blue, metabolism; yellow, genetic information processing; orange, organismal systems; pink, human diseases.

FIGURE 6.

The transcriptome data of benzo[a]pyrene (BaP) versus the BaP‐nanoplastics (NPs) group. (a): Volcano map of differentially expressed genes. Red dots indicate significantly upregulated genes, blue dots indicate significantly downregulated genes. (b) Heat map of clustering analysis of differential expressed genes. Red represents significantly upregulated genes, blue represents significantly downregulated genes. (c) GO enrichment map of differential expressed genes. BP, biological processes; CC, cellular component; MF, molecular function. (d) KEGG enrichment map of differential expressed genes. Different colours indicate KEGG classification: purple, cellular processes; green, environmental information processing; blue, metabolism; yellow, genetic information processing; orange, organismal systems; pink, human diseases.

FIGURE 7.

The transcriptome data of nanoplastics (NPs) versus the benzo[a]pyrene (BaP)‐NPs group. (a) Volcano map of differentially expressed genes. Red dots indicate significantly upregulated genes, blue dots indicate significantly downregulated genes. (b) Heat map of clustering analysis of differential expressed genes. Red represents significantly upregulated genes, blue represents significantly downregulated genes. (c) GO enrichment map of differential expressed genes. BP, biological processes; CC, cellular component; MF, molecular function. (d) KEGG enrichment map of differential expressed genes. Different colours indicate KEGG classification: purple, cellular processes; green, environmental information processing; blue, metabolism; yellow, genetic information processing; orange, organismal systems; pink, human diseases.

3.5.3. GO and KEGG analysis of differentially expressed genes

The DEGs in each of the five pairwise comparison groups were categorized into three gene ontology groups: biological process (BP), cellular component (CC) and molecular function (MF) (Figures 3c, 4c, 5c, 6c and 7c). In the BP category, the NC versus BaP group showed a predominance of genes related to cell division processes, including the process of mitotic cell cycle, cell cycle process and mitotic nuclear division. The top 20 significantly enriched GO terms were mainly associated with these processes. The MF category contained primarily DEGs that were linked to binding with macromolecular complexes, collagen, ATP, adenyl ribonucleotides, protein complexes and more. The CC category had a predominant association with genes involved in chromosome structure, including the chromosome, centromeric region, chromosomal region, condensed chromosome and centromeric region. These genes accounted for the top 20 significantly enriched GO terms (Figure 3c).

Within the NC versus the NPs group, the BP category exhibited the top five GO terms that were notably enriched, including reaction to injury, inflammatory reaction, reaction to lipid, promotion of cell motility and promotion of cell migration. The MF category primarily consisted of DEGs related to collagen binding, calcium ion binding, glycosaminoglycan binding, extracellular matrix binding, heparin binding and so forth. The CC category had the following top five GO terms with significant enrichment: extracellular region part, extracellular region, extracellular space, extracellular matrix and endoplasmic reticulum lumen (Figure 4c).

Within the comparison of NC and BaP‐NPs groups, the BP category exhibited the top five GO terms that were notably enriched, including oxidation–reduction process, defence response, inflammatory response, response to interleukin‐1 and cellular response to interleukin‐1. The DEGs in the MF category were primarily linked to ion binding, glycosaminoglycan binding, oxidoreductase activity, carbohydrate derivative binding, deoxyribodipyrimidine photo‐lyase activity and other functions. The CC category had the following top five GO terms that were significantly enriched: extracellular region part, extracellular space, extracellular region, collagen trimer and endoplasmic reticulum lumen (Figure 5c).

In the comparison between the BaP and BaP‐NPs groups, the BP category exhibited a notable enrichment of GO terms such as small molecule metabolism, inflammation response, monocyte aggregation, regulation of monocyte aggregation, positive regulation of monocyte aggregation and more. The DEGs in the MF category primarily showed associations with cofactor binding, oxidoreductase activity, specifically acting on the CH‐CH group of donors, deoxyribodipyrimidine photo‐lyase activity, DNA photolyase activity and other forms of oxidoreductase activity. The GO terms that showed significant enrichment in the CC category included extracellular space, parts of the extracellular region, the extracellular region itself, condensed chromosomes, centromeric regions and more (Figure 6c).

In the comparison between the NPs and BaP‐NPs groups, the BP category exhibited significant enrichment in terms such as controlling cell migration, regulating cell motility, promoting cell motility, responding to lipid, regulating movement of cellular components and more. The MF category primarily consisted of DEGs related to collagen binding, calcium ion binding, heparin binding, glycosaminoglycan binding, fibronectin binding and other functions. The GO terms that showed significant enrichment in the CC category included extracellular space, parts of the extracellular region, the extracellular region itself, the extracellular matrix, the cell surface and more (Figure 7c).

In addition, the study conducted KEGG pathway enrichment analysis, which revealed significant enrichment in 37, 108, 66, 42 and 89 pathways for the comparisons of NC versus BaP, NC versus NPs, NC versus BaP‐NPs, BaP versus BaP‐NPs and NPs versus BaP‐NPs, respectively (Figures 3d, 4d, 5d, 6d and 7d). The comparison between NC and BaP revealed that the enriched signalling pathways primarily encompassed cellular activities, metabolism of amino acids and lipids, immune response and inflammation, as well as diseases related to cancer. Cell cycle and cellular activity involved the signalling pathways of DNA replication and ECM‐receptor interaction, among the top 20 important pathways. Immune and inflammatory responses involved the IL‐17 signalling pathway, interaction of viral proteins with cytokines and cytokine receptors, the cytosolic DNA‐sensing pathway, the Toll‐like receptor signalling pathway, human papillomavirus infection and TNF signalling pathways. Amino acid metabolism included the metabolism of cysteine and methionine, as well as the metabolism of tyrosine. Glucose metabolism involved pathways such as the pentose phosphate pathway, fructose metabolism and mannose metabolism. DNA damage repair was associated with base excision repair and cellular senescence. Furthermore, pathways associated with cancer and diseases like bladder cancer, rheumatoid arthritis and viral carcinogenesis were also detected (Figure 3d).

In the comparison between NC and NPs, the top 20 significantly enriched pathways were mainly focused on signal transduction, including pathways like MAPK signalling and PI3K‐Akt signalling. Additionally, there was significant enrichment of immune and inflammatory signalling pathways, such as interaction between cytokines and cytokine receptors, the NF‐kappa B signalling pathway, regulation of TRP channels by inflammatory mediators, the NOD‐like receptor signalling pathway, the IL‐17 signalling pathway and the C‐type lectin receptor signalling pathway. Additional pathways that were enriched included signalling pathways related to the growth and survival of cells, such as interaction with extracellular matrix receptors and the pathway involving phospholipase D. There were also pathways associated with cancer, such as the central carbon metabolism in cancer, proteoglycans in cancer and transcriptional mis‐regulation in cancers. Furthermore, metabolic pathways like glutathione metabolism and the AGE‐RAGE signalling pathway in diabetic complications were identified (Figure 4d).

The NC versus BaP‐NPs pathway enrichment analysis revealed that the top 20 significantly enriched signalling pathways primarily focused on immune and inflammatory signalling pathways, including IL‐17 signalling pathway, Epstein–Barr virus infection, NOD‐like receptor signalling pathway, Toll‐like receptor signalling pathway, Kaposi sarcoma‐associated herpesvirus infection, influenza A, antigen processing and presentation, TNF signalling pathway, NF‐kappa B signalling pathway, human cytomegalovirus infection and human papillomavirus infection. Additionally, there were signalling pathways related to amino acid metabolism, such as cysteine and methionine metabolism, and lipid metabolism, such as the PPAR signalling pathway. Additional significant pathways comprised of glucose metabolism‐associated signalling pathways like glycosaminoglycan breakdown, other pathways linked to metabolism such as the AGE‐RAGE signalling pathway in diabetic complications, and signalling pathways associated with cancer and diseases like Legionellosis, small cell lung cancer, rheumatoid arthritis and bladder cancer (Figure 5d).

The analysis of pathway enrichment in BaP versus BaP‐NPs revealed that the predominant signalling pathways among the top 20 were primarily focused on immune and inflammatory processes. These included the IL‐17 signalling pathway, antigen processing and presentation, Epstein–Barr virus infection, human cytomegalovirus infection, viral protein interaction with cytokine and cytokine receptor, and cytokine–cytokine receptor interaction. Enrichment was observed in pathways related to cell growth and survival, including ECM‐receptor interaction and p53 signalling pathway, as well as signal transduction pathways like the PI3K‐Akt signalling pathway. In diabetic complications, various metabolism‐related signalling pathways including metabolic pathways, steroid biosynthesis, carbon metabolism and the AGE‐RAGE signalling pathway were discovered, as well as the amino acid metabolism pathway of tyrosine metabolism and the lipid metabolism signalling pathways of cholesterol metabolism and citrate cycle (TCA cycle). Figure 6d shows the enrichment of disease‐related signalling pathways such as legionellosis and DNA damage‐related signalling pathways like the Fanconi anaemia pathway (Figure 6d).

In the analysis of enrichment pathways comparing NPs and BaP‐NPs, the top 20 pathways mainly focused on immune and inflammatory signalling. These included pathways such as human papillomavirus infection, interaction between cytokines and cytokine receptors, regulation of TRP channels by inflammatory mediators, and cascades of complement and coagulation. Significant enrichment was observed in pathways related to cell growth and survival, including ECM–receptor interaction and phospholipase D signalling pathway, as well as signal transduction pathways such as the PI3K‐Akt signalling pathway and MAPK signalling pathway. Signalling pathways associated with cancer and diseases such as amoebiasis, systemic lupus erythematosus, proteoglycans in cancer and microRNAs in cancer were discovered. Additionally, metabolism‐related signalling pathways like alcoholism, retinol metabolism and the AGE‐RAGE signalling pathway in diabetic complications were also identified. The identification of signalling pathways related to cell adhesion, such as focal adhesion and the Rap1 signalling pathway, was also demonstrated in Figure 7d.

4. DISCUSSION

The rise of contagious illnesses has caused significant financial damages in the commercial aquaculture industry, endangering the health and welfare of aquatic creatures (Walker & Winton, 2010). NPs and BaP, ubiquitous pollutants within aquatic ecosystems, are frequently found within the dietary and ambient surroundings of fish (Bouwmeester et al., 2015; Chae et al., 2018; Grung et al., 2009; Yazdani, 2020). Such pollutants have been found to have far‐reaching and deleterious impacts on the behaviour, consumption, growth, reproduction and survival of aquatic organisms (Lee et al., 2019; Wang et al., 2018). Constructing cell lines from fish enables the establishment of a reliable experimental model to study the harmful impacts of biological and environmental factors on aquatic organisms. The present study focused on the combined effects of BaP and NPs on a newly established fish muscle cell line. This focus was strategically chosen because (1) both are ubiquitous and persistent in aquatic ecosystems, making co‐exposure highly relevant, (2) they represent a classic “carrier‐pollutant” model (BaP as a hydrophobic toxicant, NPs as an adsorbent vector) ideal for studying synergistic interactions, (3) there is a critical knowledge gap regarding their combined cellular toxicity, particularly in edible tissues, and (4) understanding their interaction is vital for assessing food safety risks related to the aquatic food chain.

4.1. The YSBM cell lines were susceptible to red‐spotted grouper nervous necrosis virus

The YSBM cell line has undergone subculture for over 2 years and has been passaged more than 100 times (Abdul Majeed et al., 2013). To determine the ideal temperature and FBS concentration range for YSBM cells, multiple experiments were conducted, exploring growth under different temperatures and FBS concentrations. The most efficient growth was observed at 28°C and the growth rate increased as the FBS concentration ranged from 5% to 20% (Abdul Majeed et al., 2013). Opting for a 10% FBS concentration means the most cost‐effective solution is utilized to encourage YSBM cell growth. The culture conditions for YSBM cells (28°C in L‐15 medium) have been consistent with those of other established Yellowfin seabream cell lines (Li et al., 2016, 2017; Yu et al., 2016; Zhou et al., 2017).

Genomic DNA was extracted and amplified using PCR with specific primers for the 18S rRNA and CytB genes (Chaudhary et al., 2013; Gong et al., 2011), which are commonly employed in confirming the source of the YSBM cell line derived from yellowfin seabream. Sequencing of the expected sized PCR products established that the YSBM cell line was indeed derived from yellowfin seabream. The potential usefulness of the YSBM cell line for genetic manipulation studies (Gong et al., 2011) was assessed by measuring transfection efficiency. The study demonstrated that the YSBM cell line has a promising potential for genetic manipulation, as evidenced by the significant increase in transfection efficiency when green fluorescence was present.

Cell lines have a crucial role in virological studies, serving as a valuable resource for identifying and isolating infectious viral pathogens, as well as examining interactions between hosts and viruses (Yu et al., 2016). A cell line's susceptibility to viral infection is critical for the establishment and characterization of fish viruses (Chaudhary et al., 2013). NNV, a pathogen belonging to the Betanodavirus genus of the Nodaviridae family, is responsible for 50%–100% of marine and freshwater species mortalities (Zhu et al., 2013). The YSBM cells exhibited a strong vulnerability to NNV, which was verified by the presence of cytoplasmic vacuoles and the manifestation of cytopathic effects (Bandin & Souto, 2020). Moreover, the substantial rise in transcription rates of the CP and RDRP genes, as the infection time increases, indicates that the recently developed YSBM cell line is a priceless biological resource for monitoring and identifying NNV infections.

The susceptibility of YSBM to RGNNV not only confirms its utility in virology but, more fundamentally, validates the functional integrity of its core cellular stress response pathways, including innate immunity, inflammation and apoptosis. This established biological competency provides a critical foundation for employing YSBM as a relevant model to investigate how cells respond to other types of environmental stressors, such as chemical pollutants and nanoparticles, which may perturb overlapping or convergent molecular networks.

4.2. Many biological processes of YSBM cell lines were disrupted and damaged by BaP and NPs

Building on the characterization of YSBM as a responsive cellular system (as evidenced by its viral susceptibility), we next employed this validated model to assess the toxicological impacts of environmental pollutants directly relevant to aquatic food safety. We exposed YSBM cells to BaP, NPs and their mixture, hypothesizing that these contaminants would elicit significant transcriptomic perturbations, potentially sharing some common stress‐response signatures with viral infection, albeit through distinct initial triggers. The mechanism of cell damage caused by these three substances was analysed using transcriptomic data. Through GO and KEGG enrichment analysis, the comparison of transcriptomic data between the various treatment groups and the control group resulted in the discovery of DEGs primarily focused on immunity, inflammation, energy metabolism, cellular activity, cellular toxicity and genetic toxicity. These results suggest the interference and damage of these toxic substances within numerous biological processes of cells that were investigated.

Prior studies have evaluated the harmfulness of BaP in mammals, revealing its potential to disrupt the endocrine system, damage cells, cause genetic mutations and promote cancer. Regarding numerous marine creatures, their toxicity primarily involves interference with metabolism, disruption of the immune system, oxidative stress and other related effects (Brozman et al., 2020). The toxicity mechanism of BaP in aquatic animals has often been studied using transcriptome technology, which takes advantage of high‐throughput sequencing technology.

In rainbow trout liver cells, BaP decreased the levels of intracellular glutathione, suggesting the presence of oxidative stress. Additionally, BaP induced cytogenotoxicity, resulting in a higher occurrence of DNA strand breaks (Drwal et al., 2017). Transcriptomic data from Takifugu obscurus exposed to BaP revealed significant activation of glycolytic, phagosomal and Foxo signalling pathways. This suggests that BaP disrupts glucose metabolism and the immune system of T. obscurus, leading to the upregulation of specific genes associated with tumorigenesis. These findings highlight the virulence of BaP towards T. obscurus (Jiang et al., 2020). Transcriptomic data analysis revealed that Ruditapes philippinarum exhibited a significant enrichment of stress mechanisms, including metabolism of foreign substances, oxidative stress, apoptosis and the immune system, in response to BaP. Functional analysis of Chlamys farreri using GO and KEGG databases revealed that the expression of genes related to stress response, detoxification and antioxidants was significantly affected by BaP, as indicated by Jiang et al. (2020).

The findings of the experiment showed that the genes with altered expression in yellowfin sea bream muscle cells exposed to BaP were mainly found in the pathways related to cell cycle, metabolism of amino acids and glucose, immune response and inflammation, as well as signalling pathways associated with cytotoxicity and genotoxicity. The group exposed to BaP showed downregulation of genes associated with cell cycle and DNA replication pathways, including CDK1 (Cyclin‐Dependent Kinase 1, CDK1), CDC7 (Cell Division Cycle 7, CDC7), CDC45 (Cell Division Cycle 45, CDC45), MCM2 (Minichromosome Maintenance Complex Component 2, MCM2), MCM3 (Minichromosome Maintenance Complex Component 3, MCM3), MCM6 (Minichromosome Maintenance Complex Component 6, MCM6), POLE2 (DNA Polymerase Epsilon 2, POLE2), RFA1 (Ribonucleotide Reductase Regulatory Subunit M1, RFA1) and DNA2 (DNA Replication Helicase/Nuclease 2, DNA2). Furthermore, genes associated with the metabolism of amino acids and glucose, including TAT (Trans‐Activator of Transcription, TAT), CDO1 (Cysteine Dioxygenase Type 1, CDO1), TST (Thiosulfate Sulfurtransferase, TST), ALDO (Aldolase, ALDO), FBP (Fructose‐1,6‐Bisphosphatase, FBP) and pgm (Phosphoglucomutase, pgm) also exhibited decreased expression. On the other hand, immune and inflammatory‐related DGEs such as AP1 (Activator Protein 1, AP1), IL‐1 (Interleukin‐1, IL‐1), cGAS (Cyclic GMP‐AMP Synthase, cGAS), STING (Stimulator of Interferon Genes, STING), IRF1 (Interferon Regulatory Factor 1, IRF1), IRF8 (Interferon Regulatory Factor 8, IRF8), CXCL8 (Chemokine C‐X‐C Motif Ligand 8, CXCL8), CCR3 (Chemokine C‐C Motif Receptor 3, CCR3) and CCR4 (Chemokine C‐C Motif Receptor 4, CCR4) showed an increase in expression. There is speculation that the presence of BaP in yellowfin sea bream muscle cell lines results in genotoxic effects through the inhibition of genes associated with cell cycle and DNA replication. Additionally, it disrupts cellular energy metabolism by inhibiting genes involved in amino acid and sugar metabolism, while also inducing immune damage through the activation of immune and inflammatory gene expression.

NPs are oceanic plastic waste particles that have been reduced to less than 1000 nanometres in size by physical, chemical (Nag et al., 2019; Song et al., 2020) or biological processes (Dawson et al., 2018). Because of their nanoscale physicochemical characteristics, they could traverse biological obstacles, such as the walls of the intestines and placental barriers in mammals. Consequently, they have the potential to be among the most dangerous forms of marine debris (Stapleton, 2019).

Extensive research has been conducted on the harmful effects of NPs on aquatic organisms, revealing their ability to effortlessly penetrate cell membranes, accumulate in tissues and travel through food chains, as proven by numerous studies (Bouwmeester et al., 2015; Chae et al., 2018; Lee et al., 2019; Stapleton, 2019; Toussaint et al., 2019). Furthermore, the impact of NPs on fish has been recorded, including modifications in oxidative condition, shifts in hormone levels, disruption of energy metabolism, disturbance of the immune system, imbalance in gut bacteria and alterations in behaviour (Barria et al., 2020; Jacob et al., 2020). After being exposed to NPs for a duration of 30 days, goldfish (Carassius auratus) exhibited an accumulation of NPs in both their liver and muscle. Furthermore, even at lower concentrations, this exposure resulted in the occurrence of DNA damage (Brandts et al., 2022). NPs were observed to greatly enhance the degranulation of primary granules and the release of neutrophil extracellular traps in fathead minnows, suggesting that NPs can disrupt the fish's ability to resist diseases (Greven et al., 2016). Experiments involving zebrafish revealed that nanoparticles, when exposed to NPs, gathered in the digestive system. This led to the activation of reactive oxygen species, a decrease in the expression of the catalase gene (which is responsible for antioxidants), and the initiation of immune cell migration. This discovery was reported in a study (Sendra et al., 2021). Furthermore, it has been discovered that NPs tend to build up in the tissues of zebrafish, leading to an impact on neurobehavioral function, motor dysfunction, changes in the expression of genes that are important for physiological processes and a potential decrease in the ability of organisms to adapt in polluted ecosystems (Pedersen et al., 2020). Through transcriptomic and metabolomic investigations, the detrimental impacts of NPs on tilapia were unveiled, indicating that brief contact with NPs led to irregularities in tilapia's glucose, lipid, energy and amino acid processes. The analysis of gene expression in the transcriptome also indicated that NPs induced varying expression of genes associated with signal interruption and molecules involved in adhesion, implying their potential to trigger an initial inflammatory reaction (Pang et al., 2021). A study examining the impact of varying levels of NPs exposure on young Japanese marsh shrimp (Macrobrachium nipponense) revealed that elevated concentrations of NPs had detrimental effects on cell viability, ion levels, ATPase activity related to ion transport and gene expression associated with ion transport (Li et al., 2022). However, our knowledge regarding NPs and their impact on fish remains restricted.

During this study, the transcriptome analysis indicated that the adverse effects of NPs on YSBM mainly manifested in signal transduction, immune response, inflammatory processes, cellular proliferation and viability, as well as amino acid metabolism. Regarding signal transduction pathways, the NPs displayed diverse functions in controlling essential genes of the MAPK and PI3K‐AKT signalling pathways. These genes include JNK (c‐Jun N‐terminal kinase), p38 (p38 Mitogen‐Activated Protein Kinase), MAP3K5 (Mitogen‐Activated Protein Kinase Kinase Kinase 5), MAPKAPK3 (Mitogen‐Activated Protein Kinase‐Activated Protein Kinase 3), PIK3CG (Phosphoinositide 3‐Kinase Catalytic Subunit Gamma), PIK3CA (Phosphoinositide 3‐Kinase Catalytic Subunit Alpha), PIK3R1 (Phosphoinositide 3‐Kinase Regulatory Subunit 1), and PIK3R5 (Phosphoinositide 3‐Kinase Regulatory Subunit 1), which serve as vital signal transmitters from the surface of the cell to its interior. The signals transmitted by these genes are crucial for regulating significant cellular physiological and pathological processes, such as cell growth, differentiation and adaptation to environmental stress (Chavel et al., 2010; Hemmings & Restuccia, 2012; Hemmings & Restuccia, 2015). Nevertheless, the transcriptome data from this study revealed that the presence of NPs disrupted the regular transmission of these signalling pathways. Furthermore, NPs enhance the expression of numerous genes involved in immune and inflammation‐related signalling pathways, including IL‐1β (Interleukin‐1 Beta), IL‐17RB (Interleukin‐17 Receptor B), IL‐17RC (Interleukin‐17 Receptor C), CXCL8 (Chemokine [C‐X‐C Motif] Ligand 8), CXCL12 (Chemokine [C‐X‐C Motif] Ligand 12), NOD1 (Nucleotide‐binding Oligomerization Domain 1), NFKB (Nuclear Factor Kappa B), and others. These genes play crucial roles in cellular inflammatory responses and immune responses to pathogenic infections (Mathews et al., 2008; Prantner et al., 2009; Rong et al., 2009). The results indicate that the presence of NPs leads to the activation of inflammatory and immune responses in cells. NPs exert a stronger impact on the glutathione signalling pathway in relation to amino acid metabolism, resulting in the activation of genes like NADPH (Nicotinamide adenine dinucleotide phosphate), GST (Glutathione S‐transferase), GSTP (Glutathione S‐transferase Pi), and GSTK1 (Glutathione S‐transferase Kappa 1). The glutathione signalling pathway is associated with the ability to withstand oxidative stress. Numerous studies have suggested that NPs can trigger an excessive production of reactive oxygen species in living organisms, resulting in oxidative harm. However, organisms possess an antioxidant defence system that helps maintain redox homeostasis, reducing damage and protecting them from the effects of reactive oxygen species (Almeida et al., 2019). Furthermore, the findings from the ongoing study suggest that brief exposure of YSBM to NPs enhances the activation of genes associated with cellular oxidative stress.

4.3. Mixtures of BaP and PS‐NPs produce a Trojan horse effect on aquatic organism hazards

NPs have a large ratio of surface area to volume and are hydrophobic, which allows them to absorb harmful substances found in the nearby seawater and transport them to marine organisms (referred to as the Trojan horse effect) (Hu et al., 2022; Ziccardi et al., 2016). Of the plastic particles, BaP have been observed to be heavily adsorbed by NPs (Camacho et al., 2019). Several in vivo experimental studies have demonstrated that NPs can effectively transfer BaP to numerous aquatic animals. Various organs of bivalves have been found to accumulate BaP, leading to disruptions in immunological and antioxidant measures, as well as neurotoxic and genotoxic effects, as stated by scientists. Particles of different sizes (Avio et al., 2015; Gonzalez‐Soto et al., 2019; Magara et al., 2019; Paul‐Pont et al., 2016; Pittura et al., 2018) can collect and transmit different quantities of BaP to the organism, which can be accumulated by NPs and MPs. Katsumiti et al. examined the capacity of polystyrene (PS), NPs and microplastics (MPs) to transmit BaP to mussel hemocytes and induce adverse effects in vitro, and the results showed that polystyrene nanoparticles and microparticles could serve as carriers of BaPs to mussel hemocytes, and the existence of BaP increased the harmful effects of polystyrene particles (Katsumiti et al., 2021). The study conducted by Zhang et al. explored the potential of NPs to increase the absorption of BaP in juvenile rainbow trout. In their study, the researchers discovered that the uptake of BaP was greatly enhanced by 20 nm NPs, leading to higher EROD activity in the gills and liver. This effect was not observed with 500 nm NPs that either adsorbed BaP or exposed BaP alone (Almeida et al., 2019). Nonetheless, further emphasis and comprehension regarding the harmful consequences of combined NPs and BaP exposure in aquatic organisms are still necessary.

The impact of combined exposure to NPs and BaP on YSBM was assessed in this study. The examination of transcriptome data revealed that there was a total of 1038 genes that exhibited differential expression in the NC versus BaP‐NPs combination group. Among these genes, 748 were found to be upregulated, whereas 290 genes showed downregulation. The analysis of GO and KEGG enrichment indicated that the genes showing differential expression were mainly enriched in pathways related to immune and inflammation, amino acid metabolism, lipid metabolism and glucose metabolism. This suggests that the toxicity of combined exposure to cells primarily involves triggering immune and inflammatory responses, as well as disrupting the normal energy metabolism of cells. The mixed exposure and single pollutant exposure groups did not show significant differences in immune system effects, including the signalling pathways related to immune and inflammation such as the IL‐17 signalling pathway, NF‐kappa B signalling pathway and NOD‐like receptor signalling. Nevertheless, with regards to energy metabolism, the mixed exposure group exhibited a notable impact on the PPAR signalling pathway, which is associated with lipid metabolism, in contrast to the group exposed to a single pollutant. The PPAR signalling pathway plays a vital role in controlling lipid metabolism, maintaining energy balance and has a role in regulating cell differentiation, development and the metabolism of carbohydrates, lipids and proteins (Derosa et al., 2018; Hassan et al., 2021). Research has indicated that the PPAR signalling pathway might additionally activate the production of antioxidant enzymes, like catalase, superoxide dismutase or heme oxygenase‐1. This activation results in a decrease in the levels of reactive oxygen species (ROS), which act as secondary messengers in the inflammatory response, thus helping to maintain cellular balance (Korbecki et al., 2019).

In the comparison between the NPs and BaP‐NPs groups, a total of 3005 genes were found to be expressed differently. Out of these genes, 969 showed increased expression, whereas 2036 exhibited decreased expression. The GO and KEGG enrichment analysis revealed that the genes showing differential expression were primarily enriched in signalling pathways associated with immune response and inflammation, cellular proliferation and viability, energy metabolism and cellular adhesion. A total of 730 genes that were expressed differently were identified in the comparison group of BaP versus BaP‐NPs. Out of these, 556 genes experienced an increase in expression, whereas 174 genes showed a decrease in expression. Taken together, these discoveries indicate that the harmfulness of combined exposures to cells, when compared to individual exposures, is manifested through compelling immune pressure, disruption of energy metabolism and impacts on the regular growth and survival of cells. Nonetheless, there are slight variations in the signalling pathways and controlled genes. The research adds to the increasing body of evidence indicating that NPs and BaP's Trojan horse effect present a potential threat to aquatic organisms.

It is important to note that while our transcriptomic data reveal a clear synergistic toxic response upon co‐exposure, which parallels the conceptual framework of the ‘Trojan horse’ effect, they do not provide direct proof of the physicochemical carrier mechanism (e.g. enhanced cellular uptake or co‐transport of BaP by NPs). Future studies incorporating adsorption assays, direct quantification of intracellular BaP in the presence/absence of NPs and imaging co‐localization are warranted to conclusively establish such a delivery mechanism.

5. CONCLUSION

To summarize, this research successfully created and described a novel cell culture, YSBM, obtained from the muscle tissue of A. latus. The YSBM cell line's potential for studying virus isolation and pathogenesis, genetic manipulation in vitro and investigation of virus–host interactions was shown through its high vulnerability to viruses and effective expression of foreign genes. Additionally, YSBM cell line was exposed to NPs, BaP and BaP‐NPs mixtures, and their cell damage mechanisms were analysed using transcriptome data. The findings revealed that these environmental pollutants largely affect immunity and inflammation, energy metabolism, cell activity, cell toxicity and genetic toxicity, thereby interfering with and harming multiple biological processes in these cells. These observations provide valuable reference information for assessing environmental contaminants and their associated damage to aquatic organisms.

AUTHOR CONTRIBUTIONS

Xuezhu Lee and Shina Wei contributed equally to this work. Xuezhu Lee: Investigation, data curation, formal analysis, writing – original draft, writing – review and editing, funding acquisition. Shina Wei: Investigation, data curation, formal analysis, writing – original draft. Kecheng Zhu: Investigation, data curation. Min Guo: Investigation, data curation. Honglin Han: Investigation, data curation. Dikuang Peng: Investigation, data curation. Chuchu Lai: Investigation, data curation. Jiayan Wang: Investigation, data curation. Xinyu Wang: Investigation, data curation. Qiwei Qin: Methodology, resources. Min Yang: Conceptualization, supervision, writing – review and editing, funding acquisition. Jun Wang: Supervision, project administration, funding acquisition.

Supporting information

FIGURE S1. Morphology of the yellowfin sea bream muscle (YSBM) tissue cell line and origin. (a) Cells migrated from the muscle tissue onto the culture dish. (b) Semiconfluent monolayer of YSBM cells at passage 5. (c) Confluent monolayer of YSBM cells at passage 60. (d, e) PCR amplification of CytB and 18s rRNA regions from the YSBM cells at passage 9th.

FIGURE S2. Growth properties of yellowfin sea bream muscle (YSBM) at the passage 25. (a) Effects of temperature on cell growth in Leibovitz's L‐15 medium containing 10% foetal bovine serum (FBS). (b) Effects of FBS concentrations on cell growth in Leibovitz's L‐15 at 28°C. Data are means ± standard deviation of three measurements.

FIGURE S3. Expression of green fluorescent protein in yellowfin sea bream muscle (YSBM) cells at passage 50 after transfection with pEGFP‐N3 plasmid.

TABLE S1. Validation of RNA‐seq data by qPCR. Expression levels of selected DEGs.

DATA AVAILABILITY STATEMENT

Data sharing not applicable to this article as no datasets were generated or analysed during the current study.