Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Apr 1;109(1):494–505. doi: 10.1111/jfb.70435

Intestinal characteristics and microbial community composition of rapid‐growing golden‐backed carp (Cyprinus carpio var. Jinbei) in rice fields

Lan Ma 1, Julin Wang 1, Guotao Yan 1, Jiayao Li 2, Junjie Yao 1,✉, Liangchao Gong 3, Li Yang 1, Qingmi Meng 1
PMCID: PMC13397276  PMID: 41920017

Abstract

The golden‐backed carp (Cyprinus carpio var. Jinbei) is a fish species that thrives in rice fields. Some populations of this species are known to demonstrate rapid growth; however, the underlying mechanisms and characteristics of rapidly growing groups remain unclear. To investigate these mechanisms, offspring from a single pair of golden‐backed carp parents, which were of similar initial body size and morphological specifications, were stocked in a rice field and reared for 93 days. Histological, enzymatic and high‐throughput sequencing methods were used to compare differences in intestinal histological morphology, digestive enzyme activity and intestinal microbial communities among different growth groups. Histomorphologically, villus height and the villus‐height‐to‐crypt‐depth ratio significantly differed among the three growth groups, whereas villus width, crypt depth, muscle layer thickness and goblet cell abundance did not vary. Amylase and trypsin levels in the rapid‐growth group were significantly higher than those in the moderate‐ and slow‐growth groups. The gut microbiota in the rapid‐growth group was characterized by the presence of the phyla Firmicutes (41.40%), Proteobacteria (35.33%), Clostridia (16.21%) and Actinobacteria (3.52%). At the genus level, the dominant taxa included Streptococcus (31.22%), Bartonella (29.45%) and Cetobacter (16.21%). In rice fields, golden‐backed carp with different growth rates exhibit different survival strategies. The adjustment of survival strategies results from the combined effects of digestive tract morphology, key digestive enzyme activity and specific intestinal microbial communities. This study further demonstrates the adaptability of golden‐backed carp to paddy‐field culture, providing a reference for improving the efficiency of ecological farming and breeding systems in paddy fields.

Keywords: golden‐backed carp (Cyprinus carpio var. jinbei), intestine, microbial community, rapid‐growth group, rice paddies

1. INTRODUCTION

In nature, differences in the growth rate and size of individuals within a group are widespread. For instance, Atlantic sturgeons (Acipenser oxyrinchus) from the same population differed in growth performance, with significant proportional variation in overall length and body weight (Adamek et al., 2017). Even when reared under the same feeding conditions, fish fry from the same batch often exhibit individual growth differences (Seong et al., 2019). Previous studies have explored the reasons for the rapid growth of some individuals in a population in terms of growth hormones, muscle‐cell proliferation rates, intestinal morphology and nutrient absorption efficiency. For example, IGF‐1 is the principal mediator of growth‐hormone function and regulates cell division, differentiation and growth. After intraperitoneal injection of recombinant IGF‐1 into tilapia (Oreochromis niloticus) (Ayaso et al., 2002), after 5 weeks of rearing, body weight increased by 73% compared with that in the control group (Chen et al., 2000). Juvenile red‐headed cichlids (Vieja melanura) exhibiting superior growth performance also showed greater intestinal folding height. Furthermore, Myog and Myf6 promote myoblast proliferation and differentiation into muscle cells, ultimately contributing to muscle fibre formation (Perry & Rudnick, 2000). Research on oysters (Crassostrea gigas) (Bayne, 1999) and mussels (Mytilus edulis) (Ibarrola et al., 2017) has shown that fast‐growing individuals exhibit faster feeding and absorption rates than those in slow‐growing ones. Feng reported that differences in feeding behaviour significantly influence individual growth variations in Japanese sea cucumber (Apostichopus japonicus). Growth differences in A. japonicus may also be associated with variation in physiological structure, energy metabolism, digestive capacity and intestinal microbiota (Feng, 2023).

Considering intestinal microbiota, grass carp (Ctenopharyngodon idella) and silver crucian carp (Carassius auratus gibelio) harbour various strains that can produce proteases, lipases and amylases, thereby promoting nutrient digestion and absorption in fish (Feng et al., 2008). Fast‐growing largemouth bass larvae (Micropterus salmoides) contain more immune‐related microbial communities than those in slow‐growing larvae, which affects their growth rate (Su et al., 2022). Because feed sources vary, even within the same fish species, significant differences in intestinal microbiota can occur. For example, in rainbow trout (Oncorhynchus mykiss) fed plant‐based diets, Firmicutes tends to dominate the intestinal community, whereas Proteobacteria dominates in rainbow trout fed animal‐based diets (Ingerslev et al., 2014).

Rice‐paddy fish farming in Guizhou Province has a history dating back thousands of years. The rice–fish–duck agricultural ecosystem in Congjiang County, Guizhou Province, is a Globally Important Agricultural Heritage System (Ji et al., 2022). The rice‐field golden‐backed carp (Cyprinus carpio var. Jinbei) is a native fish species that has thrived in rice fields for generations in Guizhou Province. Belonging to the Cyprinidae family, Cyprininae subfamily and Cyprinus genus, it is named for the two stable inherited golden stripes on both sides of its dorsal fin and the golden butterfly‐like pattern on its head (Ji et al., 2022). During its growth period in rice fields, it relies on organisms within the rice‐field ecosystem for food. The occurrence of large fish populations with pronounced individual growth differentiation is widespread; however, few studies have explored the characteristics and underlying causes of dominant, rapidly growing groups.

This study focused on golden‐backed carp reared in paddy fields. Individuals exhibiting markedly faster growth rates and larger sizes were referred to as the rapid‐growth group. By comparing the offspring of the same parental pair raised within the same paddy‐field environment, we aimed to characterize the rapid‐growth group from three perspectives: intestinal morphology, digestive enzyme activity and intestinal microbial community. We also sought to explore the reasons underlying divergent growth rates.

2. MATERIALS AND METHODS

2.1. Ethics statement

All experiments were conducted in accordance with the guidelines of the Guizhou University Animal Care Advisory Committee (China) (EAE‐GZU‐2025‐E027) and were approved by the relevant institutional ethics committee(s).

2.2. Experimental site and grouping

The experiments were conducted in Wengdong Village, Majiang County, Guizhou Province, in 2025. The experimental rice fields comprised three relatively concentrated paddies in Wengdong Village, with areas of 4.32, 3.14 and 3.04 ha, totalling 10.50 ha. Two weeks after rice transplanting, golden‐backed carp (body weight 95.3 ± 8.06 g, body length 15.2 ± 0.31 cm) were introduced at a stocking density of 225 kg hm−2. During the experiment, no pesticides were applied, no supplemental feed was provided and natural food was made available to the fish in the paddies. The experiment was conducted from 24 June to 25 September 2025, lasting 93 days.

After the experiment, the largest, medium‐sized and smallest golden‐backed carp from the three rice fields were selected and assigned to three groups based on their body weights: large, medium and small. We selected 10 individuals from each group, measured their body length and mass, and designated them as the rapid‐, moderate‐ and slow‐growth groups, as shown in Table 1.

TABLE 1.

Sampling of the different growth groups.

Growth group a Body length (cm) Weight (g)
Rapid 29.50 ± 2.20 535.40 ± 88.37
Moderate 24.54 ± 2.18 326.42 ± 68.56
Slow 21.28 ± 1.62 257.78 ± 46.80
Open in a new tab
a

Ten individuals were randomly selected from each growth group.

2.3. Sample preparation

After the experiment, 10 fish from each group (30 fish in total) were placed in labelled oxygenation bags. The corresponding rice‐paddy water in the oxygenation bags was transported to a laboratory at the School of Animal Science, Guizhou University. Subsequently, 30 experimental fish were temporarily placed in 30 breeding boxes and fasted for 24 h before sampling. During sampling, each fish was first washed, and the surface, mouth and gills were rinsed with sterile water. Thereafter, the fish were anaesthetised with MS222, the abdomen was cut open using sterile scissors, and the intestine was separated from the abdominal cavity with sterile forceps then rinsed with phosphate buffered saline (PBS). Within each group (rapid‐, moderate‐, and slow‐growth), intestinal contents were randomly collected from nine fish. Samples from every three individuals were pooled into a single 10 mL sterile tube, snap‐frozen in liquid nitrogen and stored at −80°C for gut microbiome analysis. For the remaining one fish, a 1 cm intestinal tissue segment was excised from the mid‐foregut, rinsed with PBS, fixed in 4% (φ) formaldehyde solution and placed in a 50 mL centrifuge tube for histomorphological observation. The remaining intestinal tissue was placed into a 10 mL sterile centrifuge tube, snap‐frozen in liquid nitrogen and stored at −80°C for digestive enzyme activity assays.

2.4. Intestinal histological observation

Intestinal tissues were sectioned and observed using haematoxylin and eosin staining (Zhang, 2023). Intestinal histological analysis was performed morphometrically using Image‐Pro Plus 6.0 (Media Cybernetics Inc.).

2.5. Assessment of intestinal morphological parameters

An Eclipse Ci‐L microscope (Nikon) was used to capture images and measure villus height, muscle layer thickness, villus width and crypt depth. The goblet cells in the small intestine were counted. Each sample was randomly measured at 10 points, with three replicates (Rawski et al., 2021; Su et al., 2022).

2.6. Intestinal enzyme activity determination

Intestinal samples were accurately weighed and homogenized on ice with sterile physiological saline at a ratio of 1 g of tissue to 9 mL of saline. The homogenate was centrifuged at 4°C and 1118 xg for 10 min, and the supernatant was collected as the crude enzyme extract for subsequent assays. The total protein concentration of the crude extract was determined using the Coomassie Brilliant Blue (Bradford) method (kit code: A045‐2‐1; Nanjing Jiancheng Bioengineering Institute). A standard curve was generated using bovine serum albumin and the absorbance was measured at 595 nm. Enzyme activities were finally normalized and expressed as U mg−1 prot (where ‘prot’ denotes the protein content of the crude enzyme extract). Lipase activity was determined using a colorimetric method (kit code: A054‐1‐1; Nanjing Jiancheng Bioengineering Institute), amylase activity by the starch–iodine colorimetric method (kit code: C016‐1‐1) and trypsin activity by a UV spectrophotometric method (kit code: A080‐2).

2.7. DNA extraction and PCR amplification

The samples were preserved using dry ice and transported to Chengdu Novogene Metabolomics Biotechnology Co., Ltd for 16S rRNA high‐throughput sequencing. DNA was extracted using the MagBind® Stool DNA Kit (Omega), and the DNA concentration and purity were measured using a NanoDrop 2000. DNA integrity was assessed by 1% agarose gel electrophoresis. The 16S rRNA gene was amplified based on the Illumina MiSeq sequencing platform, using primers 338F: ACTCCTACGGGAGGCAGCAG and 806R: GGACTACHVGGGTWTCTAAT. A 20 μL reaction system with Pro Taq was used for the amplification, and the amplified samples were sequenced using the Illumina HiSeq 3000 platform (PE300).

2.8. Statistical analysis

Intestinal histological analysis was performed morphometrically using Image‐Pro Plus 6.0. Digestive enzyme activities were analysed in SPSS (version 26.0; SPSS Inc.) using one‐way analysis of variance (ANOVA), followed by Duncan's multiple range test for post hoc comparisons. Differences were considered significant at p < 0.05 and highly significant at p < 0.01. Data are presented as mean ± standard deviation. For gut microbiome analysis, α‐ and β‐diversity indices were calculated in QIIME2. The β‐diversity distance matrix was constructed based on the Jaccard distance, and intergroup differences were assessed using PERMANOVA, ANOSIM and PERMDISP. Other microbiome‐related analyses were performed using R packages (R Foundation for Statistical Computing).

3. RESULTS

3.1. Intestinal morphology across different golden‐backed carp growth groups

The intestinal morphology of the rapid‐, moderate‐ and slow‐growth groups of rice‐field golden‐backed carp is shown in Figure 1. Overall, the intestinal morphology of each growth group appeared intact, with well‐organized intestinal villi and a smooth mucosal surface. The rapid‐growth group exhibited intact, well‐organized, numerous, tightly packed and elongated intestinal villi, with a relatively large surface area, and the epithelial cells along the mucosal folds were arranged in an orderly manner (Figure 1a,b).

FIGURE 1.

FIGURE 1

Open in a new tab

Intestinal microstructure of golden‐backed carp in different growth groups. Rapid‐growth group at (a) 20× and (b) 200× magnification. Moderate‐growth group at (c) 20× and (d) 200× magnification. Slow‐growth group at (e) 20× and (f) 200× magnification. dC, crypt depth; GC, goblet cells; hS, villus height; M, muscle layer thickness; SM, submucosal layer; wS, villus width.

The intestinal morphology of the moderate‐growth group is shown in Figure 1c,d. The intestinal villi were sparse and short, with a small amount of damage and shedding. The intestinal mucosa was relatively smooth, and the epithelial cells along the mucosal folds were arranged in an orderly manner, with smooth, striated borders on the surface.

In the slow‐growth group, the height of the intestinal villus was the shortest relative to that of the rapid‐ and moderate‐growth groups. The intestinal villi were irregularly arranged, with minor damage and shedding, and reduced structural integrity. The epithelial cell nuclei along the mucosal folds were also arranged irregularly.

3.2. Intestinal morphological parameters across different golden‐backed carp growth groups

Villus height and width, crypt depth, muscle layer thickness, goblet cell abundance and the villus‐height‐to‐crypt‐depth ratio in various parts of the intestine were determined (Table 2). Villus height in the rapid‐growth group was significantly higher than that in the moderate‐ and slow‐growth groups (p < 0.05), while that in the moderate‐growth group was significantly higher than in the slow‐growth group (p < 0.05). The villus‐height‐to‐crypt‐depth ratio did not significantly differ between the rapid‐ and moderate‐growth groups (p > 0.05), whereas the ratios in both the rapid‐ and moderate‐growth groups were significantly higher than that in the slow‐growth group (p < 0.05). No significant differences were observed in villus width, crypt depth, muscle layer thickness and goblet cell abundance among the three groups (p > 0.05).

TABLE 2.

Intestinal morphological parameters of golden‐backed carp in different growth groups.

Growth group Villus height (μm) Villus width (μm) Crypt depth (μm) Muscle layer thickness (μm) Goblet cell (individual) Villus height/ crypt depth
Rapid 922.93 ± 33.77a 197.40 ± 22.90 61.25 ± 3.05 111.16 ± 2.33 28.33 ± 5.31 15.13 ± 1.29a
Moderate 771.23 ± 39.66b 208.00 ± 7.08 63.35 ± 5.06 108.97 ± 4.68 17.67 ± 2.05 12.30 ± 1.52a
Slow 447.93 ± 8.26c 209.64 ± 13.47 65.56 ± 1.10 111.02 ± 2.59 24.33 ± 5.91 6.84 ± 0.24b
Open in a new tab

Note: Values with different lowercase superscript letters in the same column indicate significant differences (p < 0.05).

3.3. Intestinal digestive enzyme activity across different golden‐backed carp growth groups

Intestinal amylase, lipase and trypsin activities in golden‐backed carp were measured separately in the rapid‐, moderate‐ and slow‐growth groups (Table 3). Amylase activity in the rapid‐growth group was significantly higher than those in the moderate‐ and slow‐growth groups (p < 0.05). Lipase activity did not significantly differ among the three groups (p > 0.05). Trypsin activity in the rapid‐growth group was significantly higher than in the moderate‐ and slow‐growth groups (p < 0.05). The moderate‐growth group exhibited significantly higher trypsin activity than that in the slow‐growth group (p < 0.05).

TABLE 3.

Intestinal digestive enzyme activity in different golden‐backed carp growth groups.

Growth group Amylase (U mg−1 prot) Lipase (U mg−1 prot) Trypsin (U mg−1 prot)
Rapid 14.10 ± 0.05a 11.08 ± 0.60 6932.40 ± 1028.07a
Moderate 7.52 ± 0.42b 13.41 ± 0.52 3448.09 ± 545.27b
Slow 7.53 ± 0.02b 9.16 ± 0.22 1525.54 ± 172.99c
Open in a new tab

Note: Values with different lowercase superscript letters in the same column indicate significant differences (p < 0.05).

3.4. Intestinal microbiota composition across different golden‐backed carp growth groups

3.4.1. Sequencing characteristics of gut microbiota

Illumina MiSeq sequencing yielded 682,531 high‐quality reads, which were resolved into amplicon sequence variants (ASVs) with 100% similarity. After quality filtering and taxonomic annotation, 3333 ASVs were retained. Changes in shared and unique ASVs among the three groups of golden‐backed carp are shown in Figure 2. Among the 3333 ASVs, 1055 were unique to the moderate‐growth group, 1052 were unique to the slow‐growth group and 698 were unique to the rapid‐growth group. Additionally, 252 were shared between the rapid‐ and moderate‐growth groups, 346 between the moderate‐ and slow‐growth groups, 264 between the rapid‐ and slow‐growth groups, and 167 were common to all three groups. Illumina MiSeq sequencing revealed 35 phyla, 103 classes, 192 orders, 331 families and 586 genera.

FIGURE 2.

FIGURE 2

Open in a new tab

Shared and unique amplicon sequence variants among the rapid‐, moderate‐ and slow‐growth groups of golden‐backed carp. A, Moderate‐growth group; B, rapid‐growth group; C, slow‐growth group.

3.4.2. Diversity of gut microbiota

Alpha diversity analysis was performed based on the number of ASVs detected in each growth group (Figure 3). The coverage index reflects the coverage rate of sequencing results. The coverage index of all samples was ≥99.9%, indicating that the microbial communities were thoroughly captured, and the sequencing quality was high. Across all three groups, Simpson's, Shannon's and Pielou's evenness indices were all significantly higher in the rapid‐growth group than those in the slow‐growth group (p < 0.05), indicating that the rapid‐growth group exhibited the greatest diversity and evenness, whereas the slow‐growth group showed the lowest values for these indices. No significant differences were observed among the moderate‐, rapid‐ and slow‐growth groups (p > 0.05). The Chao1 index, observed species index, Faith's phylogenetic diversity index and Good's coverage index did not significantly differ among the three growth groups (p > 0.05).

FIGURE 3.

FIGURE 3

Open in a new tab

Alpha diversity of gut microbiota in the rapid‐, moderate‐ and slow‐growth groups of golden‐backed carp. A, Moderate‐growth group; B, rapid‐growth group; C, slow‐growth group.

The β‐diversity patterns based on the principal coordinate analysis (PCoA) similarity matrix are shown in Figure 4. Beta diversity reflects the similarity of the bacterial communities in the gut samples of the three golden‐backed carp groups. At the ASV level, PCoA based on the Jaccard distance revealed that within‐group dissimilarities were relatively low and markedly smaller than those between groups, indicating strong repeatability within the sample groups. The between‐group distances were relatively large and showed no overlap, indicating clear differences in gut microbiota composition among the three groups.

FIGURE 4.

FIGURE 4

Open in a new tab

Beta diversity based on the PCoA similarity matrix. A, Moderate‐growth group; B, rapid‐growth group; C, slow‐growth group.

3.4.3. Gut microbiota composition

At the phylum level, the relative abundances of the top 20 bacterial taxa were compared among the rapid‐, moderate‐ and slow‐growth groups (Figure 5). In the rapid‐growth group, the dominant phyla included Firmicutes (41.40%), Proteobacteria (35.33%) and Fusobacteria (16.21%). The dominant phyla in the moderate‐growth group were Firmicutes (62.92%), Fusobacteria (17.94%) and Proteobacteria (8.76%). In the slow‐growth group, Firmicutes (73.63%), Actinobacteria (11.05%) and Proteobacteria (7.12%) were dominant. Overall, Firmicutes and Proteobacteria were consistently dominant in all three growth groups.

FIGURE 5.

FIGURE 5

Open in a new tab

Phylum‐level gut microbiota composition and differences in dominant phyla among golden‐backed carp with different growth rates. A, Moderate‐growth group; B, rapid‐growth group; C, slow‐growth group. * and ** indicate significant differences at p < 0.05 and p < 0.01, respectively.

At the genus level, analysis of the relative abundances of the top 20 bacterial genera among the three groups revealed that the dominant bacterial groups in the rapid‐growth group included Streptococcus (31.22%), Bartonella (29.45%) and Cetobacterium (16.21%) (Figure 6). The dominant bacteria in the moderate‐growth group were Streptococcus (51.59%), Cetobacterium (17.93%) and Enterobacter (4.42%). In the slow‐growth group, Streptococcus (54.29%), Enterococcus (15.57%) and Actinomyces (6.28%) were dominant. Overall, Streptococcus was the dominant bacterial genus in all three growth groups.

FIGURE 6.

FIGURE 6

Open in a new tab

Genus‐level gut microbiota composition and differences in dominant genera among golden‐backed carp with different growth rates. A, Moderate‐growth group; B, rapid‐growth group; C, slow‐growth group. * and ** indicate significant differences at p < 0.05 and p < 0.01, respectively.

4. DISCUSSION

4.1. Intestinal histology reflects the feeding and nutrient absorption capacity of golden‐backed carp

Golden‐backed carp are a traditional rice‐field carp that has inhabited rice paddies for generations. Their long‐term residence in this environment has driven strong ecological adaptation. Golden‐backed carp exhibiting different growth rates show corresponding adaptive modifications in intestinal structure, reflecting distinct survival strategies in rice‐paddy environments. Variation in food intake further drives structural adjustments in the intestine to optimize nutrient absorption. The rice‐field environment is characterized by a limited quantity of natural feed, although the diversity of available feed is relatively high. After the same batch of similarly‐sized golden‐backed carp fry is introduced into a rice field, some individuals continue growing and become larger as they consume available resources. As these individuals increase in size, their feeding capacity is strengthened, further accelerating their growth. Intensified competition for food subsequently restricts the growth space and resources for smaller individuals, thereby inhibiting their growth.

Villus height in the rapid‐growth group was significantly higher than that in the moderate‐ and slow‐growth groups, and the villi were more densely arranged, thereby increasing the surface area of the intestinal structure. A larger intestinal surface area corresponds to a greater capacity to absorb nutrients. The intestinal surface area, determined by gross morphological features, such as villus height and epithelial thickness, can affect intake and absorption, thereby influencing the net utilization of dietary nutrients (Vechklang et al., 2011). In a study on largemouth bass (Micropterus salmoides), the intestinal villi of fast‐growing fish were longer and more closely arranged than those of slow‐growing ones (Shi et al., 2019). Assessment of the fore‐, mid‐ and hindgut of largemouth bass with different growth rates revealed that the height of foregut villi in the rapid‐growth group was significantly higher than that in the slow‐growth group (Su et al., 2022).

The nutrient absorption capacity reflected by changes in the intestinal structure of golden‐backed carp in the paddy‐field environment can be inferred from the ratio of villi height to crypt depth, which is highest in the rapid‐growth group. In largemouth bass and carp, increases in the villus‐height‐to‐crypt‐depth ratio enhance intestinal digestive and absorptive capacities (Ou et al., 2020; Zhang et al., 2023). The intestinal structures of the rapid‐growth group exhibited larger surface areas. This is likely attributable to the fact that, in rice fields, larger individuals in the rapid‐growth group have a stronger feeding capacity and can obtain food for extended periods. Food‐derived stimuli promote dense and elongated growth of intestinal villi, thereby enhancing the capacity to absorb nutrients and supporting growth.

4.2. The rapid‐growth group of golden‐backed carp exhibits higher amylase and trypsin activities

The expression of digestive enzymes is influenced by the type and quantity of food present in the intestine. In fish, the activity of digestive enzymes is directly related to nutrient absorption and utilization, thereby affecting fish growth and developmental rate (Jiang et al., 2022). Amylases, trypsins and lipases are important digestive enzymes in fish. Trypsin plays a crucial role in protein digestion within the fish intestinal tract. Pepsin primarily functions in the stomach, while trypsin primarily functions in the small intestine. Because the absorptive capacity of the fish stomach is limited, most digestion and absorption occur in the intestinal tract. The protein content of feed affects trypsin activity in the intestinal tract. Research has shown that the higher the proportion of protein in the feed, the higher the trypsin activity (Zhao et al., 2020). In the present study, trypsin activity in the rapid‐growth group of golden‐back carp was significantly higher than that in the moderate‐ and slow‐growth groups. In the ecological environment of paddy fields, the primary sources of protein for golden‐backed carp include small fish, shrimp, snails, shellfish, zooplankton, aquatic insects and the eggs of insects on rice. Although these protein resources are diverse, their quantities are limited and affected by their temporal and spatial distributions. All golden‐backed carp with different growth rates require proteins to meet their growth and developmental needs. Owing to their stronger activity and feeding capacity, larger golden‐backed carp consume more protein. Smaller fish have a lower feeding capacity than larger fish and thus obtain less protein. Therefore, intestinal trypsin activity in golden‐backed carp differs with different growth rates.

Because plant resources were relatively abundant in the rice fields, the amylase activity of golden‐backed carp across the three growth groups was relatively high. The fat content of feed promotes lipase expression in fish. In the current study, lipase activity in golden‐backed carp did not significantly differ among the three growth groups. Prior studies have demonstrated that when the growth cycle and body weight were similar, the lipase activity of artificially‐fed carp reached 23.78 ± 3.29 U mg−1 (Liu, 2021) and 25.32 ± 2.65 U mg−1 (Qi et al., 2023). The lipase activity of golden‐backed carp was approximately half that of carp raised on artificial feed. In rice fields, fatty feeds are rarer than carbohydrate or protein sources. The observed intake levels indicated that lipase activity in golden‐backed carp in rice fields was relatively low.

The amylase and trypsin activities of the rapid‐growth group were relatively high, indicating that they can consume more carbohydrate and protein feed to achieve rapid body growth. However, the lower lipase activity of the moderate‐ and slow‐growth groups likely reflects physiological self‐adjustment to a food‐limited survival environment.

4.3. Gut microbiota diversity in the rapid‐growth group of golden‐backed carp

Gut microbiota has a symbiotic relationship with its host. Higher gut microbiota diversity is associated with a more stable gut microbiota ecosystem and more significant effects in enhancing host immunity, nutritional metabolism and other aspects. In terms of immunity, the higher the diversity of intestinal microbiota, the stronger the immune functions. In paddy‐field environments, although the quantity of food sources is limited, their variety is relatively high. In the present study, the rapid‐growth group consumed a greater variety of foods, promoting an increase in intestinal diversity. A higher diversity of the intestinal microbial community is conducive to enhancing the balance and stability of the intestinal microbial ecosystem and boosting immunity. Previous studies have shown that maintaining a dynamic balance between beneficial and harmful bacteria is important to ensure healthy host growth (Xiong et al., 2019). An imbalance in the intestinal microbiota can affect microbiota composition, reduce microbial diversity and induce massive reproduction of pathogens (Gao et al., 2024). For instance, sweetfish (Plecoglossus altivelis) exposed to Vibrio anguillarum exhibited reduced intestinal microbiota diversity and compromised immunity (Nie et al., 2017). The addition of nutritional supplements to the feed of Cyprinus carpio increased the diversity of its intestinal microbial community. Consequently, the proliferation of harmful bacteria was inhibited and the abundance of beneficial bacteria increased, indirectly enhancing the immunity of C. carpio (Yang et al., 2019). Therefore, an increase in the diversity of the intestinal microbiota community in the rapid‐growth group enhanced immunity, thereby supporting healthy growth.

In terms of nutritional metabolism, higher gut microbiota diversity is associated with improved metabolic function. Research has shown that the diversity of gut microbiota species in Macrobrachium rosenbergii is higher under rice‐paddy cultivation than under grass‐based cultivation systems. Functional predictions of the gut microbiota indicated that, under both farming modes, microbial functions in M. rosenbergii were concentrated in metabolic regulatory pathways under both farming modes (Liu et al., 2024). In a paddy‐field farming model, the diversity and richness of the intestinal flora of C. carpio var. Jian were, to some extent, higher than those in a pond model (Zhao et al., 2021). The rapid‐growth group of golden‐backed carp exhibited higher intestinal microbial diversity, suggesting that a broader range of microorganisms participated in nutrient‐metabolic processes, thereby enhancing digestion and absorption.

Therefore, the rapid‐growth population of golden‐backed carp is characterized by a high diversity of intestinal microbial communities. On the one hand, a higher intestinal microbiota diversity is linked to a more stable intestinal ecosystem, thereby enhancing immunity. On the other hand, a greater capacity for food digestion and absorption is associated with superior and healthier growth of the rapid‐growth group of golden‐back carp.

4.4. Adjustment of gut microbiota abundance and adaptation to growth status in golden‐backed carp

The dynamic balance among various groups of intestinal microbiota is the foundation for healthy host growth. The natural development of the digestive tract of fish adaptively adjusts the relative abundance and location of microbiota to achieve a balance between the microorganisms, the gut and the host (Liu et al., 2021). Different groups of intestinal microbiota have distinct functional characteristics. The present study indicated that the abundance of different groups of intestinal microbiota in the rapid‐growth group underwent adaptive adjustments.

The first of these was a shift in the relative proportions of Firmicutes and Proteobacteria, reflected in the altered Firmicutes‐to‐Proteobacteria ratio. At the phylum level, the relative abundance of Proteobacteria in the intestinal tract of the rapid‐growth group significantly increased, whereas that of Firmicutes significantly decreased. Firmicutes promotes protein and intestinal fat absorption and digestion, thereby contributing to maintaining the ecological balance of intestinal microorganisms (Kaur et al., 2019; Tran et al., 2020). Proteobacteria are capable of producing proteins (Rawls et al., 2006). The microbial communities of both Proteobacteria and Firmicutes can digest proteins; however, the types of proteins digested differ. The high relative abundance of Proteobacteria in the intestinal tract enhances protease activity, thereby facilitating the digestion and absorption of animal protein and supporting growth‐related adaptation. Prior studies have revealed that relative abundance changes in Firmicutes and Proteobacteria in paddy‐field carp in autumn, compared with those in the pond control group, tended to be consistent with those in the present study (Sun et al., 2021; Zhao et al., 2021).

The second adaptive adjustment involves shifts in the relative abundances of Clostridia and Actinobacteria. In the rapid‐growth group of golden‐backed carp, the intestinal abundance of Clostridia was higher, whereas that of Actinomycetes with similar functional roles was lower. The abundance of Fusobacterium serves as a universal biomarker for healthy fish and shares the same function as Actinomycota in enhancing fish immunity. High Fusobacterium abundance in the intestinal tract of the rapid‐growth group was closely related to its ability to consume and digest more carbohydrates.

Third, at the genus level, adaptive adjustment occurred in the relative abundances of Cetobacterium and Streptococcus. The relative abundance of Cetobacterium in the intestinal tract of the rapid‐growth group golden‐backed carp was significantly higher, whereas that of Streptococcus was significantly lower. Cetobacterium can ferment polypeptide carbohydrates, produce vitamin B12, promote the metabolic growth of fish and enhance immunity (Tsuchiya et al., 2008). Previous studies have found that, under oxygen‐deficient water conditions, the intestinal abundance of Cetobacterium in fish is high (Ramírez et al., 2018). Streptococcus is a pathogen commonly found in many aquaculture fish species (Liu et al., 2020). The adjustment in the relative abundance of Cetobacterium and Streptococcus in the intestinal tract of the rapid‐growth group can be attributed to two factors. First, in the shallow‐water environment of rice fields, larger golden‐backed carp require a stronger oxygen supply capacity to support their physiological activities. Second, due to the antagonistic interactions between beneficial and harmful intestinal bacteria, a reduction in the abundance of harmful bacteria helps lower disease risk.

Studies have shown that throughout the rice‐field rearing period, the abundances of different intestinal microbiota groups in golden‐backed carp adapt to their growth conditions. In the rapid‐growth population of golden‐backed carp, intestinal microbiota adjustment was mainly reflected in the shifts in the relative abundances of Proteobacteria versus Firmicutes, Fusobacteria versus Actinomycetes and Cetaceus versus Streptococcus.

5. CONCLUSION

Owing to their long‐term residence in rice fields, golden‐backed carp have adapted to the ecological environment of rice fields. Here, we revealed that golden‐backed carp with different growth rates adjusted their survival strategies in response to the rice‐field environment. Adaptability adjustments in different growth groups result from the combined effects of digestive tract morphology, key digestive enzyme activities and specific intestinal flora.

The intestinal villi of the rapid‐growth population of golden‐backed carp are more elongated and densely arranged, with a larger intestinal surface area and the highest ratio of intestinal villus height to crypt depth. Intestinal amylase and trypsin activities were significantly increased. High intestinal microbiota diversity stabilizes the intestinal ecosystem, promotes better food digestion and absorption, and enhances immunity. During the growth of the rapid‐growth population, shifts in the relative abundances of Proteobacteria, Actinomycetes and Streptococcus, mediated in part by adjustments within Firmicutes, help achieve balance among microorganisms, the intestinal tract and the host, supporting healthy and rapid growth of golden‐backed carp. These results further demonstrate the adaptability of golden‐backed carp to paddy‐field conditions, providing a reference for improving the efficiency of ecological farming and breeding in paddy fields.

AUTHOR CONTRIBUTIONS

L.M.: Methodology, data generation, manuscript preparation and formal analysis. J.L.W.: Methodology, investigation, and formal analysis. G.T.Y.: Formal analysis and data curation. J.Y.L.: Funding acquisition, supervision, methodology. J.J.Y.: Funding acquisition, validation, supervision, investigation, data curation. L.C.G.: Validation and data curation. L.Y.: Methodology, software, and data curation. Q.M.M.: Methodology, writing of the original draft, project administration.

CONFLICT OF INTEREST STATEMENT

None of the authors have a conflict of interest to disclose.

ACKNOWLEDGEMENTS

We gratefully acknowledge the assistance provided during the sampling process by Yunfu Mo, Wen You, Yanshan Qin, Yue Wang, Zemin Wei, Zaien Yang and Yongbing Ma. Their support greatly contributed to the completion of the study. All the authors have read and approved the final version of the manuscript. We extend our appreciation to staff members for their assistance.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

REFERENCES

  1. Adamek, D. , Rzepkowska, M. , Panagiotopoulou, H. , Ostaszewska, T. , Fajkowska, M. , Kamaszewski, M. , & Kolman, R. (2017). Morphological differences of white muscle fibers and genetic diversity of fast and slow growing atlantic sturgeons (Acipenser oxyrinchus). Turkish Journal of Fisheries and Aquatic Sciences, 17, 959–966. [Google Scholar]
  2. Ayaso, E. , Nolan, C. M. , & Byrnes, L. (2002). Zebrafish insulin‐like growth factor‐I receptor: Molecular cloning and developmental expression. Molecular and Cellular Endocrinology, 191(2), 137–148. [DOI] [PubMed] [Google Scholar]
  3. Bayne, B. L. (1999). Physiological components of growth differences between individual oysters (Crassostrea gigas) and a comparison with Saccostrea commercialis . Physiological and Biochemical Zoology, 72(6), 705–713. [DOI] [PubMed] [Google Scholar]
  4. Chen, J. Y. , Chen, J. C. , Chang, C. Y. , Shen, S. C. , Chen, M. S. , & Wu, J. L. (2000). Expression of recombinant tilapia insulin‐like growth factor‐I and stimulation of juvenile tilapia growth by.
  5. Feng, Q. M. (2023). Study on behavioral and physiological mechanism of individual growth differences of Apostichopus japonicus. University of Chinese Academy of Sciences. (in Chinese).
  6. Feng, X. , Wu, Z. X. , Zhu, D. M. , Wang, Y. , Pang, S. F. , Yu, Y. M. , Mei, X. H. , & Chen, X. X. (2008). Study on digestive enzyme producing bacteria from the digestive tract of Ctenopharyngodon idelus and Carassius auratus gibelio . Freshwater Fisheries, 03, 51–57. (in Chinese). [Google Scholar]
  7. Gao, Q. X. , Huang, H. , Zhao, X. X. , Cheng, Z. H. , Dong, J. H. , & Qiao, W. Z. (2024). Progress on gut microbiota of aquatic animals and its effects on host growth performance. Biotic Resources, 46(6), 529–537. (in Chinese). [Google Scholar]
  8. Ibarrola, I. , Hilton, Z. , & Ragg, N. L. (2017). Physiological basis of inter‐population, inter‐familiar and intra‐familiar differences in growth rate in the green‐lipped mussel Perna canaliculus. Aquaculture, 479, 544–555. [Google Scholar]
  9. Ingerslev, H. C. , von Gersdorff Jørgensen, L. , Lenz Strube, M. , Larsen, N. , Dalsgaard, I. , Boye, M. , & Madsen, L. (2014). The development of the gut microbiota in rainbow trout (Oncorhynchus mykiss) is affected by first feeding and diet type. Aquaculture, 424‐425, 24–34. [Google Scholar]
  10. Ji, D. , Su, X. , Yao, J. J. , Zhang, W. Z. , Wang, R. R. , & Zhang, S. H. (2022). Genetic diversity and genetic differentiation of populations of golden‐backed carp (Cyprinus carpio var. jinbei) in traditional rice fields in Guizhou, China. Animals, 12(11), 1377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Jiang, X. N. , Li, Y. , Tian, J. W. , Li, C. T. , Ge, Y. L. , Hu, X. S. , Cheng, L. , Shi, X. D. , Shi, L. , & Jia, Z. (2022). Nutritional components, biochemical characteristics, enzyme activities, and growth differences of five freshwater fish species? Fishes, 7(5), 285. [Google Scholar]
  12. Kaur, A. , Chen, T. , Green, S. J. , Mutlu, E. , Martin, B. R. , Rumpagaporn, P. , Patterson, J. A. , Keshavarzian, A. , & Hamaker, B. R. (2019). Physical inaccessibility of a resistant starch shifts mouse gut microbiota to butyrogenic firmicutes. Molecular Nutrition and Food Research, 63(7), e1801012. [DOI] [PubMed] [Google Scholar]
  13. Liu, C. , Zhao, L. P. , & Shen, Y. Q. (2021). A systematic review of advances in intestinal microflora of fish. Fish Physiology and Biochemistry, 47(6), 2041–2053. [DOI] [PubMed] [Google Scholar]
  14. Liu, J. , Yang, F. , Peng, S. , Geng, Y. , Huang, X. , Ouyang, P. , Li, Z. , & Chen, D. (2020). Molecular characterization and pathogenicity of streptococcus iniae in yellow catfish (Pelteobagrus fulvidraco). Aquaculture Research, 51(12), 5259–5264. [Google Scholar]
  15. Liu, M. W. , Wei, J. , Hong, K. H. , Wang, Y. K. , Liu, F. B. , Zhu, X. P. , & Yu, L. Y. (2024). Comparison of intestinal flora structure, nutritional components and muscle flavor of Macrobrachium rosenbergii under two culture modes. Journal of Shanghai Ocean University, 33(5), 1132–1143. (in Chinese). [Google Scholar]
  16. Liu, Y. (2021). Effects of yeast polysaccharide on growth performance and digestive enzyme activities of carp. Chinese Journal of Traditional Veterinary Science, 7, 10–11. (in Chinese). [Google Scholar]
  17. Nie, L. , Zhou, Q. J. , Qiao, Y. , & Chen, J. (2017). Interplay between the gut microbiota and immune responses of ayu (Plecoglossus altivelis) during vibrio anguillarum infection. Fish and Shellfish Immunology, 68, 479–487. [DOI] [PubMed] [Google Scholar]
  18. Ou, H. X. , Wang, G. J. , Li, Z. F. , Yu, D. G. , & Gong, W. B. (2020). Influence of different diets on intestinal histological morphologic structure of largemouth bass Micropterus salmoides . Fisheries Science, 39(6), 902–907. (in Chinese). [Google Scholar]
  19. Perry, R. L. , & Rudnick, M. A. (2000). Molecular mechanisms regulating myogenic determination and differentiation. Frontiers in Bioscience, 5(3), 750–767. [DOI] [PubMed] [Google Scholar]
  20. Qi, F. G. , Wei, D. X. , Wang, Q. , Wei, S. S. , Lin, A. P. , & Yuan, S. (2023). Dietary lactobacillus supplementation on growth performance and intestinal enzyme activities of carp. China Feed, 06, 85–88. (in Chinese). [Google Scholar]
  21. Ramírez, C. , Coronado, J. , Silva, A. , & Romero, J. (2018). Cetobacterium is a major component of the microbiome of giant Amazonian fish (Arapaima gigas) in Ecuador. Animals, 8(11), 189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Rawls, J. F. , Mahowald, M. A. , Ley, R. E. , & Gordon, J. I. (2006). Reciprocal gut microbiota transplants from zebrafish and mice to germ‐free recipients reveal host habitat selection. Cell, 127(2), 423–433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Rawski, M. , Mazurkiewicz, J. , Kieronczyk, B. , & Jozefiak, D. (2021). Black soldier fly full‐fat larvae meal is more profitable than fish meal and fish oil in siberian sturgeon farming: The effects on aquaculture sustainability, economy and fish git development. Animals, 11(3), 604–620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Seong, H. M. , Jin, H. Y. , Hyeon, J. O. , Chi, H. L. , Hea, J. B. , Young‐Don, L. , & Joon, Y. K. (2019). Expression patterns of growth related genes in juvenile red spotted grouper (Epinephelus akaara) with different growth performance after size grading. Development & Reproduction, 23(1), 35–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Shi, C. M. , Jiang, Y. , Zhong, Y. F. , Chen, Y. J. , Luo, L. , & Lin, S. M. (2019). Effects of dietary fiber sources on growth, plasma biochemical indexes, intestinal antioxidant capacity and histology of largemouth bass (Micropterus salmoides). Journal of Fisheries of China, 43(12), 2485–2493. (in Chinese). [Google Scholar]
  26. Su, X. , Ji, D. , Yao, J. J. , Zou, Y. L. , & Yan, M. Z. (2022). Comparative analysis of intestinal characteristics of largemouth bass (Micropterus salmoides) and intestinal flora with different growth rates. Fishes, 7(2), 65. [Google Scholar]
  27. Sun, Y. , Wang, G. J. , Zhang, K. , Xia, Y. , Sun, J. H. , Xie, J. , Yu, E. M. , Li, Z. F. , & Tian, J. J. (2021). Effects of paddy field environment on serum biochemical indexes, intestinal tissue morphology and bacterial community structure of common carp(Cyprinus carpio). Journal of Shanghai Ocean University, 30(4), 601–612. (in Chinese). [Google Scholar]
  28. Tran, N. T. , Li, Z. , Wang, S. , Zheng, H. P. , Aweya, J. J. , Wen, X. , & Li, S. K. (2020). Progress and perspectives of short‐chain fatty acids in aquaculture. Reviews in Aquaculture, 12(1), 283–298. https://www.x-mol.com/paper/journal/533. [Google Scholar]
  29. Tsuchiya, C. , Sakata, T. , & Sugita, H. (2008). Novel ecological niche of Cetobacterium somerae, an anaerobic bacterium in the intestinal tracts of freshwater fish. Letters in Applied Microbiology, 46(1), 43–48. [DOI] [PubMed] [Google Scholar]
  30. Vechklang, K. , Boonanuntanasarn, S. , Ponchunchoovong, S. , Pirarat, N. , & Wanapu, C. (2011). The potential for rice wine residual as an alternative protein source in a practical diet for Nile tilapia (Oreochromis niloticus) at the juvenile stage. Aquaculture Nutrition, 17(6), 685–694. [Google Scholar]
  31. Xiong, J. B. , Nie, L. , & Chen, J. (2019). Current understanding on the roles of gut microbiota in fish disease and immunity. Zoological Research, 40(2), 70–76. (in Chinese). [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Yang, S. , Du, J. , Luo, J. , Zhou, Y. , Long, Y. , Xu, G. , Zhao, L. , Du, Z. , & Yan, T. (2019). Effects of different diets on the intestinal microbiota and immunity of common carp (Cyprinus carpio). Journal of Applied Microbiology, 127(5), 1327–1338. (in Chinese). [DOI] [PubMed] [Google Scholar]
  33. Zhang, W. Z. (2023). Study on Muscle Growth and PI3K/Akt Pathway of Rice Field Golden‐Backed Carp. Guizhou University. 21–22. (in Chinese).
  34. Zhang, W. Z. , Yang, L. , Yao, J. J. , Meng, Q. M. , & Ji, D. (2023). Study on muscle fiber characteristics, metabolic enzymes and gene expression of caudal stalk of golden‐backed carp (Cyprinus carpio var. jinbei). South China Fisheries Science, 19(4), 77–85. (in Chinese). [Google Scholar]
  35. Zhao, L. , Luo, J. , Du, Q. , Liu, Q. , Xu, G. C. , & Yang, S. (2020). Study on the adaptability of common carp (Cyprinus carpio) to diets from the perspective of digestion and absorption. Aquaculture Research, 51(6), 2495–2504. [Google Scholar]
  36. Zhao, L. L. , Long, Y. N. , Luo, J. , Liu, Q. , Zhou, J. , Du, J. , Zhou, Y. , Yang, B. W. , & Yang, S. (2021). Analysis and comparison of intestinal microbiota, immune enzyme activities, and muscle flavor of Jian carp in two culture modes. Journal of Fishery Sciences of China, 28(1), 48–56. (in Chinese). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

Articles from Journal of Fish Biology are provided here courtesy of Wiley

RESOURCES