Abstract
Deubiquitinase BRISC complex plays important role in the maintenance of spindle structure and function; however, the underlying mechanism remains largely undefined. Here we demonstrated that MERIT40, a core component of BRISC complex, directly interacts with the RXXPEG motif in the ARC‐V domain of Tankyrase1(TNKS1). Mutation of the RXXPEG motif in the MERIT40 (R28A) disrupted its interaction with TNKS1. Consistent with these data, R28A mutant cells displayed multiple mitotic defects including aberrant spindle assembly and chromosome misalignment. These results support a critical role of RXXPEG motif of MERIT40 in BRISC‐mediated regulation of TNKS1 function during spindle assembly.
Keywords: genome stability, MERIT40, RXXPEG motif, TNKS1
Abbreviation
- K63 polyUb
K63‐linked ubiquitination
- DUB
deubiquitinase
- BRISC
BRCC36 isopeptidasecomplex
- USPs
ubiquitin‐specific proteases
- UCHs
ubiquitin carboxy‐terminal hydrolases
- OTUs
ovarian tumor‐related proteases
- MJDs
Machado–Joseph disease protein domain proteases
- JAMMs
Jab1/Pab1/MPN domain containing metalloenzymes
- MERIT40
MEdiator of RAP80 Interaction and Targeting40
- PARP
poly(ADP‐ribose) polymerase
- MT
microtubule
- WT
wild type
- TNKS1
Tankyrase1
Introduction
Protein ubiquitination is a dynamic process which can be reversed by a family of deubiquitinating enzymes (DUBs). Approximately 100 DUBs are encoded by the human genome and classified into five subfamilies based on the structural features of their catalytic domains: ubiquitin‐specific proteases (USPs), ubiquitin carboxy‐terminal hydrolases (UCHs), ovarian tumor‐related proteases(OTUs), Machado–Joseph disease protein domain proteases(MJDs), and Jab1/Pab1/MPN domain containing metallo enzymes(JAMMs). BRISC is a DUB complex containing four subunits, including MERIT40 (MEdiator of RAP80 Interaction and Targeting 40), BRCC36, ABRO1 and BRCC45 (Cooper et al., 2009; Feng et al., 2010; Patterson‐Fortin et al., 2010; Hu et al., 2011). It can specifically hydrolyze lysine63 polyubiquitin chains (K63Ub), and involved in multiple biological processes, including IFNs mediated antiviral immune regulation and inflammatory reaction (Py et al., 2013; Zheng et al., 2013; Chi et al., 2017). Recently, we demonstrated that BRISC complex plays an essential role in bipolar spindle assembly by regulating the ubiquitination level of NuMA. Depletion of ABRO1, a component of BRISC complex, can induce severe mitotic defects including multi‐polar spindles, lagging chromosomes, aberrant cytokinesis, and consequently leading to formation of bi‐nucleated or multi‐nucleated cells (Yan et al., 2015). MERIT40 is a core subunit of BRISC, presumably serving as a scaffold protein by integrating other components to form a functional unit. In addition, MERIT40 can also bind to Rap80, BRCC36, BRCC45, and Abraxas to form Rap80 complex, another K63‐Ub specific DUB complex playing crucial roles in BRCA‐mediated DNA damage repair (Feng et al., 2009; Sobhian et al., 2007; Wang et al., 2007).
TNKS1 is a member of poly(ADP‐ribose) polymerase(PARPs) superfamily which use nicotinamide adenine dinucleotide (NAD+) as a substrate for transferring ADP‐ribose onto their protein acceptors. Structure analysis reveals that TNKS1 contains at least four domains: an N‐terminal histidine, proline, and serine‐rich (HPS) domain, ankyrin domain, sterile alpha motif (SAM) domain, and PARP domain (Smith et al., 1998). The ankyrin domain consisted of 24 ankyrin repeats which forms five subdomains termed ankyrin repeat clusters (ARC I–V), each of which is predicted to bind to substrates (Smith et al., 1998; Seimiya and Smith, 2002; Lehtio et al., 2008; Karlberg et al., 2010). The SAM domain and ARCs of TNKS1 can oligomerize and interact with different substrates to fulfill its diverse functions (De Rycker and Price, 2004). To date, more than 20 proteins have been reported to interact with TNKS1 and these proteins share a common RXXA/PD/EG motif (Sbodio and Chi, 2002; Seimiya and Smith, 2002; De Rycker et al., 2003; Seimiya et al., 2004). Distinct type of post‐translational modifications could occur in TNKS1, which in turn may exert influence on their catalytic activity. For example, K48‐linked polyubiqutination catalyzed by E3 ligase RNF146 can regulate TNKS activity (Callow et al., 2011; Zhang et al., 2011). Phosphorylation of TNKS1 by glycogen synthase kinase (GS3K‐β) (Yeh et al., 2006; Biard‐Piechaczyk et al., 2012), mitogen activated protein kinase (MAPK) (Chi and Lodish, 2000), and Akt has also been reported (Ruan and Kazlauskas, 2012). Recently, we found BRISC play a role in mitosis through regulating the K63Ub level and function of NuMA, a key spindle assembly factor essential for spindle assembly (Du et al., 2002). TNKS1 can localize to spindle pole and plays a crucial role in spindle assembly (Chang et al., 2005b). We therefore ask whether K63‐linked ubiquitination play a role in regulating the function of TNKS1, and whether K63Ub modification of TNKS1 could be regulated by BRISC.
Here we identified that TNKS1 directly interacts with MERIT40 through a consensus tankyrase1‐binding motif (RXXPEG), mutation of which (MERIT40 R28A) significantly reduced its interaction with TNKS1, and led to aberrant spindle structure. These data indicate that interaction between TNKS1 and the RXXPEG motif of MERIT40 is required for spindle structure and function.
Materials and methods
Antibodies
Anti‐TNKS1 (sc‐8337; Santa Cruz Biotechnology); anti‐αTubulin (DM1A; Cell Signaling); anti‐HA (MMS‐101P, Covance); rabbit polyclonal anti‐MERIT40 and anti‐BRCC36 were generated as previously described (Shao et al., 2009a).
Plasmids construction, protein expression and purification
pcDNA3.1‐HA‐MERIT40 WT plasmid was constructed by subcloning MERIT40 into pcDNA3.1(−) plasmid using pOZ‐C‐MERIT40 as a template.pcDNA3.1‐HA‐MERIT40 R28A/R28P plasmid were generated by site‐directed mutagenesis using a commercial kit(NEB), pGEX‐6P‐3‐MERIT40 were constructed by subcloning MERIT40 into pGEX‐6P‐3 plasmid using pEYFP‐C1‐MERIT40 as template. For protein expression and purification, vector construct was transformed into Escherichia coli BL21(DE3) cells (NEB). Protein expression was carried out by inducing with 0.1 mM IPTG (Sigma) for 4 h at 28°C when LB culture at O.D600 between 0.6 and 0.8. The culture was harvested and re‐suspended in lysis buffer (50 mMTris pH 7.5,150 mMNaCl, 0.05% NP‐40) containing protease inhibitors. Cells suspension was sonicated (Branson Sonifier) twice with 1 min sonication and 1 min rest in ice at duty cycle of 60 and power 60 unit. The supernatant was collected after centrifugation of culture at 13,000 rpm for 15 min.The soluble protein was passed through the pre‐equilibrated glutathione‐sepharose 4B beads with lysis buffer. The fusion protein was allowed to bind with the glutathione‐sepharose 4B beads and then after washed with 10 column volumes of lysis buffer to remove non‐specifically bound proteins. The bound fusion protein was eluted with elution buffer (50 mM Tris pH 8.0 +10 mM fresh reduced Glutathione). The elution fractions were spinned at 500g for 5 min. The supernatant was collected and added 20 mM DTT was added. The purification of protein was analyzed on SDS–PAGE and stored at −80°C for further experiments.
Co‐immunoprecipitation and Western blotting
Cells were harvested and lysed in NETN‐400 buffer (50 mM Tris‐HCl, pH 8.0, 400 mM NaCl, 1 mM EDTA, 0.5% Nonidet P‐40) with protease inhibitors and protein phosphatase inhibitors for 20 min on ice. The samples were centrifugated at 13000 rpm/min for 30 min, and the supernatants were diluted with the same buffer without NaCl (NETN‐0) (50 mM Tris‐HCl, pH 8.0, 1 mM EDTA, 0.5% Nonidet P‐40) to obtain final concentration of NaCl at 150 mM (NETN‐150) (50 mM Tris‐HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet P‐40). The samples were then cleared by centrifugation and incubated with pre‐equilibrated M2 agarose gel (Sigma) with NETN‐150 buffer at 4°C and slowly shaked on rocker for 4 h. Then the beads were then washed three times using the NETN‐150 buffer containing protease inhibitors. The bound proteins were eluted using 100 mM glycine, pH2.5 and then neutralized by adding 1/10 volume of 1M Tris‐Cl, pH8.0. The eluted proteins were separated on 4–12% SDS–PAGE and blotted with the corresponding antibodies as indicated. The experiments were repeated three times to check the consistency.
GST pull down assay
GST (control) and GST‐MERIT40 were expressed in bacterial system (as describe above). For in vitro GST‐pull down, GST and GST‐MERIT40 immobilized on glutathione‐agarose beads were incubated with mitotic HeLa cell lysate at 4°C for 2 h. The beads were collected and washed extensively with lysis buffer, and then the proteins were eluted by adding 1xSDS loading buffer, boiled and analyzed by Western blotting.TNKS1 was probed with anti‐TNKS1 antibody. This experiment was repeated three times.
Immunofluorescence microscopy
Cells grown on coverslip (Thermo Fisher Inc.) were fixed in −20°C with methanol for 10 min, blocked with 10% goat serum at 37°C for 30 min and then incubated at 37°C with the primary antibodies for 2h.After that, the cells were washed extensively and probed with the FITC‐ and Rhodamine Red‐conjugated goat anti‐rabbit or anti‐mouse IgG (Jackson Immuno Research laboratories Inc.) at 37°C for 30 min. Coverslips were mounted in VECTASHIELD® Mounting Medium with DAPI (Vector). The images were captured using a fluorescence microscope (DM5000, Leica) and a 63x oil objective lense(PLAPO; NA, 1.40, Leica). This experiment was repeated three times.
RNA interference
All siRNAs including MERIT40 and the negative control were synthesized from Invitrogen. The siRNAs targeting sequences were: Control siRNA, 5′GGUCAACUGUCCAGAGAAA3′; siMERIT40‐4 (3′UTR), 5′CCAUCCCUGUACAUCUGCACCUUCU3′; siMERIT40‐5(3′UTR), 5′ CCUUGGCCUAAAGCCUUGGUUCUCA3′. For the experiments, cells were transfected with siRNA oligo nucleotides using lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's protocol.
Results
TNKS1 directly interacts with MERIT40
Structure analysis reveals that MERIT40 harbors two potential TNKS‐binding motifs. To validate whether MERIT40 could interact with TNKS1, GST pull‐down assay was performed (Figure 1A). Endogenous TNKS1 was readily pulled down by the GST‐MERIT40 recombinant protein (Figures 1B and 1C). These data suggest that MERIT40 directly interacts with TNKS1.
Figure 1.

TNKS1 directly interacts with MERIT40. (A) GST and GST‐MERIT40 proteins were purified from bacterial cells and separated by SDS–PAGE and then stained using Comassie brilliant blue. (B and C) TNKS1 directly binds to MERIT40 in vitro. GST pull‐down assay was performed using the purified GST‐fusion proteins and HeLa mitotic cell lysate.The bound protein complexes were analyzed by SDS‐PAGE and visualized by ponseau staining (B), or immunoblotting with an anti‐TNKS1 antibody (C).
The ARC‐V subdomain of TNKS1 mainly interacts with MERIT40 and BRCC36
The Ankyrin repeats of TNKS1 forms five subdomains termed ankyrin repeat clusters I to V (ARC‐I to ‐V) (Guettler et al., 2011), each of which was reported to bind to their partner proteins. To determine the binding domain of TNKS1 that is associated with MERIT40, we generated a series of FLAG‐tagged ARCs (I–V) as previous described (Hatsugai et al., 2010), and their interaction with TNKS1in 293T cells was evaluated. The results showed that ARC‐V is the main domain of TNKS1 responsible for its binding with MERIT40 and BRCC36 (Figures 2A and 2B).
Figure 2.

ARC‐V subdomain of TNKS1 mainly interacts with MERIT40 and BRCC36. (A and B) 293T cells were transfected FLAG‐HA‐TNKS1 subdomains (ARCI–V), and cell lysates were immunoprecipitated with anti‐FLAG M2 agarose gel and separated by SDS–PAGE. Immunoblotting analyses werecarried out using antibodies against HA, MERIT40 and BRCC36.
The RXXPEG motif of MERIT40 is responsible for its association with TNKS1 and spindle pole
To date, more than 20 TNKS‐interacting proteins have been identified, a consensus binding motif, RXXP/ADG, is found in most of these TNKS binding proteins. Further examination of the amino acid sequence revealed a consensus TNKS1‐interacting motif (RXXPEG) at amino acid 28–33 of MERIT40 that was highly conserved across species (Figure 3A). To determine whether MERIT40 could interact with TNKS1 through RXXPEG motif, we generated HA‐tagged MERIT40 mutants by substituting the amino acid residue arginine(R) at position 28 with alanine(A) or proline(P).Immunoprecipitation showed that both R28A and R28P MERIT40 mutants significantly reduce the interaction with TNKS1 (Figure 3B). These data suggested that the RXXPEG motif of MERIT40 is essential for its binding to TNKS1. Next, we examined whether the RXXPEG motif is required for MERIT40 to localize to spindle poles. As predicted,while wild type eYFP‐tagged MERIT40 (WT) was readily localized to spindle poles in HeLa cells, the R28A MERIT40 mutant was found to be dispersed in the plasma and did not localize to spindle poles (Figure 3C).
Figure 3.

Conserved RXXPEG motif of MERIT40 is responsible for its association with TNKS1 and spindle pole. (A) The alignments of the RXXPEG TNKS‐ binding motif in MERIT40, MERIT40 sequences (Homo sapiensNP_054892.2, BosTaurusNP_001070269.1, DaniorerioNP_001003752.1, Musmusculus NP_080912.2, Xenopus laevisNP_001086385.1); (B) 293T cells were co‐transfected with FLAG‐TNKS1 and HA‐MERIT40 WT or mutant, respectively. The cell lysates were co‐immunoprecipitated with anti‐FLAG M2 affinity agarose beads and separated by SDS–PAGE. Western blotting analysis was performed with anti‐Flag, HA and BRCC36 antibodies. (C) The analysis of Immunofluorescence analysis shows the localization of eYFP‐MERIT40 WT and eYFP‐MERIT40 R28A in the HeLa cells.
The RXXPEG motif of MERIT40 is required for proper spindle structure and function
To explore the functional significance of the RXXPEG TNKS1‐binding motif of MERIT40 in mitosis, Hela cells were transiently transfected with eYFP‐MERIT40 WT or R28A mutant, and treated with siRNA targeting the 3′UTR of MERIT40 to deplete the endogenous MERIT40.Transfection efficiency was confirmed by Western blotting (Figure 4A). Interestingly, overexpression of mutant MERIT40(R28A) and simultaneously silencing of endogenous MERIT40 by siRNA treatment caused aberrant mitotic spindle structure, whereas no significant effect in spindle assembly was observed in cells overexpressing wild type MERIT40 (WT) (Figures 4B and 4C). These results suggest that the RXXPEG TNKS1‐binding motif in MERIT40 is essential for maintaining the proper mitotic spindle structure.
Figure 4.

The RXXPEG motif of MERIT40 is required for proper spindle structure and function. (A) Western blotting analysis of HeLa cells co‐transfected with control siRNA and eYFP‐MERIT40 WT or eYFP‐MERIT40 R28A, MERIT40 siRNA and eYFP‐MERIT40 WT or eYFP‐MERIT40 R28A, respectively. α‐tubulin was used as a loading control. (B) Representative images of mitotic spindle structure in HeLa cells transfected with Control siRNA and eYFP‐MERIT40 WT/eYFP‐MERIT40 R28A or MERIT40 siRNA and eYFP‐MERIT40 WT/eYFP‐MERIT40 R28A. Bars: 5 µm. (C) Quantification of the percentage of cell with aberrant spindle structures are shown; Data from three independent experiments, means ± s.d. ***P < 0.001, Student's t‐test.
Discussion
A precise division of duplicated chromosome into daughter cells requires proper spindle structure and function. This process involves participation of a variety of mitotic proteins including spindle assembly factors, and is tightly regulated by protein ubiquitination and deubiquitination. BRCC36, a component of the BRCA1–BRCA2‐containing complex (BRCC) (Dong et al., 2003), is a JAMM/MPN+ −containing DUB that preferentially hydrolyzes K63Ub chains (Cooper et al., 2009). It exists in at least two distinct complexes, the BRCA1‐A complex and the BRISC. The BRCA1‐A complex, which is consisting of Rap80, BRCC36, MERIT40, BRCC45 and Abraxas proteins, is required for DNA damage repair and check point control (Sobhian et al., 2007; Feng et al., 2009; Shao et al., 2009b; Wang et al., 2009). The BRISC complex comprises four proteins: ABRO1, BRCC36, MERIT40, and BRCC45 (Cooper et al., 2009; Feng et al., 2010; Hu et al., 2011). Recently BRISC was shown to be involved in the regulation of interferon response by deubiquitinating IFNAR1 (Zheng et al., 2013). More importantly, BRISC has been demonstrated to play a crucial role in the spindle assembly by deubiquitinating NuMA (Yan et al., 2015). MERIT40 is a scaffold protein containing two TNKS binding motif in its N‐terminus (Guettler et al., 2011), and contributes to the integrity and stability of both BRCA1‐A and BRISC complex (Cooper et al., 2010; Feng et al., 2010; Hu et al., 2011). Our study showed that MERIT40 could interact with TNKS1 through its TNKS1‐binding motif. Consistent with this, mutation of this TNKS1‐bingding motif significantly reduced its association with TNKS1 (as shown in Figure 2B), and further disrupted its localization to spindle pole (as shown in Figure 2C). These results suggest that the TNKS1‐binding motif of MERIT40 is essential for spindle function.
NuMA is a major acceptor of PARsylation by TNKS1 during mitosis. PARsylation can affect the structural integrity of the poles and/or essential protein interactions required for spindle function (Chang et al., 2005a, 2009; Palazzo et al., 2014). For example, centrosome‐associated proteins such as CPAP can be PARsylated by TNKS1 and subsequently degraded through proteasome, leading to failure of centriole duplication. In contrast, depletion of TNKS1can stabilizes CPAP in G1 phase and give rise to elongated procentrioles and multipolarity (Kim et al., 2012). Miki, another centrosome‐associated protein, can also be PARsylated by TNKS1 and then translocated to mitotic centrosomes where it anchores CG‐NAP (Centrosome and Golgi‐localized PKN‐associated protein). As a result of impaired microtubule aster formation, cells depleted of TNKS1, Miki, or CG‐NAP caused disturbance in prometaphase processes, which is evidenced by formation of scattered and lagging chromosomes (Ozaki et al., 2012). Therefore, the interaction and further coordination of MERIT40 with TNKS1 are essential to maintain proper spindle structure and function. The activity of TNKS1 can be regulated by PARsylation (Huang et al., 2009; Callow et al., 2011; Zhang et al., 2011), phosphorylation (Biard‐Piechaczyk et al., 2012; Chi and Lodish, 2000; Guo et al., 2012), and ubiquitination. The ubiquitination of TNKS1 is mediated either by RNF146 (Callow et al., 2011; Zhang et al., 2011), or by RNF8, and can be reversed by deubiquitination though BRISC (Tripathi and Smith, 2016). The interference of interaction between TNKS1 and MERIT40 in cells stably expressing the mutant MERIT40 (R28A) resulted in aberrant spindle structure (as shown in Figure 4B).This finding suggests that MERIT40 is a core mediator for organization of functional bipolar spindle structure (Figure 4B). Taken together, our study suggests that BRISC‐mediated organization of functional spindle structure may serve as a potential therapeutic avenue for cancer.
Conflict of interest
The authors declare that they have no conflict of interest with the contents of this article
Author contributions
K.Y. and W.X. performed most of the experimental work and analyzed the data; G.S. helped in the design of some experiments and helped the data analysis; D.Z and K.Y designed the experiments and wrote the manuscript.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Acknowledgments and funding
This work was funded by National Natural Science Foundation of China (31701175), China Postdoctoral Science Foundation (2017M612188), Natural Science Foundation of Shandong Province (ZR2017BC003), Beijing Natural Science Foundation (5172013) and Shenzhen Municipal Government of China (JCYJ20160427105140594).
Contributor Information
Duo Zheng, Email: dzheng@szu.edu.cn.
Kaowen Yan, Email: yankaowen@qdu.edu.cn.
References
- Biard‐Piechaczyk M, Borel S, Espert L, de Bettignies G, Coux O (2012) HIV‐1, ubiquitin and ubiquitin‐like proteins: the dialectic interactions of a virus with a sophisticated network of post‐translational modifications. Biol Cell 104: 165–87. [DOI] [PubMed] [Google Scholar]
- Callow MG, Tran H, Phu L, Lau T, Lee J, Sandoval WN, Liu PS, Bheddah S, Tao J, Lill JR, Hongo JA, Davis D, Kirkpatrick DS, Polakis P, Costa M (2011) Ubiquitin ligase RNF146 regulates tankyrase and Axin to promote Wnt signaling. PLoS ONE 6: e22595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chang P, Coughlin M, Mitchison TJ (2005a) Tankyrase‐1 polymerization of poly(ADP‐ribose) is required for spindle structure and function. Nat Cell Biol 7: 1133–9. [DOI] [PubMed] [Google Scholar]
- Chang P, Coughlin M, Mitchison TJ (2009) Interaction between Poly(ADP‐ribose) and NuMA contributes to mitotic spindle pole assembly. Mol Biol Cell 20: 4575–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chang W, Dynek JN, Smith S (2005b) NuMA is a major acceptor of poly(ADP‐ribosyl)ation by tankyrase 1 in mitosis. Biochem J 391: 177–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chi NW, Lodish HF (2000) Tankyrase is a golgi‐associated mitogen‐activated protein kinase substrate that interacts with IRAP in GLUT4 vesicles. J Biol Chem 275: 38437–44. [DOI] [PubMed] [Google Scholar]
- Chi W, Hua X, Chen X, Bian F, Yuan X, Zhang L, Wang X, Chen D, Deng R, Li Z, Liu Y, de Paiva CS, Pflugfelder SC, Li DQ (2017) Mitochondrial DNA oxidation induces imbalanced activity of NLRP3/NLRP6 inflammasomes by activation of caspase‐8 and BRCC36 in dry eye. J Autoimmun 80: 65–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cooper EM, Boeke JD, Cohen RE (2010) Specificity of the BRISC deubiquitinating enzyme is not due to selective binding to Lys63‐linked polyubiquitin. J Biol Chem 285: 10344–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cooper EM, Cutcliffe C, Kristiansen TZ, Pandey A, Pickart CM, Cohen RE (2009) K63‐specific deubiquitination by two JAMM/MPN+ complexes: BRISC‐associated Brcc36 and proteasomal Poh1. EMBO J 28: 621–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- De Rycker M, Price CM (2004) Tankyrase polymerization is controlled by its sterile alpha motif and poly(ADP‐ribose) polymerase domains. Mol Cell Biol 24: 9802–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- De Rycker M, Venkatesan RN, Wei C, Price CM (2003) Vertebrate tankyrase domain structure and sterile alpha motif (SAM)‐mediated multimerization. Biochem J 372: 87–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dong Y, Hakimi MA, Chen X, Kumaraswamy E, Cooch NS, Godwin AK, Shiekhattar R (2003) Regulation of BRCC, a holoenzyme complex containing BRCA1 and BRCA2, by a signalosome‐like subunit and its role in DNA repair. Mol Cell 12: 1087–99. [DOI] [PubMed] [Google Scholar]
- Du Q, Taylor L, Compton DA, Macara IG (2002) LGN blocks the ability of NuMA to bind and stabilize microtubules. A mechanism for mitotic spindle assembly regulation. Curr Biol 12: 1928–33. [DOI] [PubMed] [Google Scholar]
- Feng L, Huang J, Chen J (2009) MERIT40 facilitates BRCA1 localization and DNA damage repair. Genes Dev 23: 719–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng L, Wang J, Chen J (2010) The Lys63‐specific deubiquitinating enzyme BRCC36 is regulated by two scaffold proteins localizing in different subcellular compartments. J Biol Chem 285: 30982–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guettler S, LaRose J, Petsalaki E, Gish G, Scotter A, Pawson T, Rottapel R, Sicheri F (2011) Structural basis and sequence rules for substrate recognition by Tankyrase explain the basis for cherubism disease. Cell 147: 1340–54. [DOI] [PubMed] [Google Scholar]
- Guo HL, Zhang C, Liu Q, Li Q, Lian G, Wu D, Li X, Zhang W, Shen Y, Ye Z, Lin S, Lin S (2012) The Axin/TNKS complex interacts with KIF3A and is required for insulin‐stimulated GLUT4 translocation. Cell Res 22: 1246–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hatsugai K, Ohishi T, Sugimoto Y, Seimiya H (2010) Tankyrase‐1 assembly to large protein complexes blocks its telomeric function. FEBS Lett 584: 3885–90. [DOI] [PubMed] [Google Scholar]
- Hu X, Kim JA, Castillo A, Huang M, Liu J, Wang B (2011) NBA1/MERIT40 and BRE interaction is required for the integrity of two distinct deubiquitinating enzyme BRCC36‐containing complexes. J Biol Chem 286: 11734–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang SM, Mishina YM, Liu S, Cheung A, Stegmeier F, Michaud GA, Charlat O, Wiellette E, Zhang Y, Wiessner S, Hild M, Shi X, Wilson CJ, Mickanin C, Myer V, Fazal A, Tomlinson R, Serluca F, Shao W, Cheng H, Shultz M, Rau C, Schirle M, Schlegl J, Ghidelli S, Fawell S, Lu C, Curtis D, Kirschner MW, Lengauer C, Finan PM, Tallarico JA, Bouwmeester T, Porter JA, Bauer A, Cong F (2009) Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature 461: 614–20. [DOI] [PubMed] [Google Scholar]
- Karlberg T, Markova N, Johansson I, Hammarstrom M, Schutz P, Weigelt J, Schuler H (2010) Structural basis for the interaction between tankyrase‐2 and a potent Wnt‐signaling inhibitor. J Med Chem 53: 5352–5. [DOI] [PubMed] [Google Scholar]
- Kim MK, Dudognon C, Smith S (2012) Tankyrase 1 regulates centrosome function by controlling CPAP stability. EMBO Rep 13: 724–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lehtio L, Collins R, van den Berg S, Johansson A, Dahlgren LG, Hammarstrom M, Helleday T, Holmberg‐Schiavone L, Karlberg T, Weigelt J (2008) Zinc binding catalytic domain of human tankyrase 1. J Mol Biol 379: 136–45. [DOI] [PubMed] [Google Scholar]
- Ozaki Y, Matsui H, Asou H, Nagamachi A, Aki D, Honda H, Yasunaga S, Takihara Y, Yamamoto T, Izumi S, Ohsugi M, Inaba T (2012) Poly‐ADP ribosylation of Miki by tankyrase‐1 promotes centrosome maturation. Mol Cell 47: 694–706. [DOI] [PubMed] [Google Scholar]
- Palazzo L, Della Monica R, Visconti R, Costanzo V, Grieco D (2014) ATM controls proper mitotic spindle structure. Cell Cycle 13: 1091–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Patterson‐Fortin J, Shao G, Bretscher H, Messick TE, Greenberg RA (2010) Differential regulation of JAMM domain deubiquitinating enzyme activity within the RAP80 complex. J Biol Chem 285: 30971–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Py BF, Kim MS, Vakifahmetoglu‐Norberg H, Yuan J (2013) Deubiquitination of NLRP3 by BRCC3 critically regulates inflammasome activity. Mol Cell 49: 331–8. [DOI] [PubMed] [Google Scholar]
- Ruan GX, Kazlauskas A (2012) Axl is essential for VEGF‐A‐dependent activation of PI3K/Akt. EMBO J 31: 1692–703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sbodio JI, Chi NW (2002) Identification of a tankyrase‐binding motif shared by IRAP, TAB182, and human TRF1 but not mouse TRF1. NuMA contains this RXXPDG motif and is a novel tankyrase partner. J Biol Chem 277: 31887–92. [DOI] [PubMed] [Google Scholar]
- Seimiya H, Muramatsu Y, Smith S, Tsuruo T (2004) Functional subdomain in the ankyrin domain of tankyrase 1 required for poly(ADP‐ribosyl)ation of TRF1 and telomere elongation. Mol Cell Biol 24: 1944–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Seimiya H, Smith S (2002) The telomeric poly(ADP‐ribose) polymerase, tankyrase 1, contains multiple binding sites for telomeric repeat binding factor 1 (TRF1) and a novel acceptor, 182‐kDa tankyrase‐binding protein (TAB182). J Biol Chem 277: 14116–26. [DOI] [PubMed] [Google Scholar]
- Shao G, Lilli DR, Patterson‐Fortin J, Coleman KA, Morrissey DE, Greenberg RA (2009a) The Rap80‐BRCC36 de‐ubiquitinating enzyme complex antagonizes RNF8‐Ubc13‐dependent ubiquitination events at DNA double strand breaks. Proc Natl Acad Sci USA 106: 3166–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shao G, Patterson‐Fortin J, Messick TE, Feng D, Shanbhag N, Wang Y, Greenberg RA (2009b) MERIT40 controls BRCA1‐Rap80 complex integrity and recruitment to DNA double‐strand breaks. Genes Dev 23: 740–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smith S, Giriat I, Schmitt A, de Lange T (1998) Tankyrase, a poly(ADP‐ribose) polymerase at human telomeres. Science 282: 1484–7. [DOI] [PubMed] [Google Scholar]
- Sobhian B, Shao G, Lilli DR, Culhane AC, Moreau LA, Xia B, Livingston DM, Greenberg RA (2007) RAP80 targets BRCA1 to specific ubiquitin structures at DNA damage sites. Science 316: 1198–202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tripathi E, Smith S (2016) Cell cycle‐regulated ubiquitination of tankyrase 1 by RNF8 and ABRO1/BRCC36 controls the timing of sister telomere resolution. EMBO J 36(4): 503–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang B, Hurov K, Hofmann K, Elledge SJ (2009) NBA1, a new player in the Brca1 A complex, is required for DNA damage resistance and checkpoint control. Genes Dev 23: 729–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang B, Matsuoka S, Ballif BA, Zhang D, Smogorzewska A, Gygi SP, Elledge SJ (2007) Abraxas and RAP80 form a BRCA1 protein complex required for the DNA damage response. Science 316: 1194–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yan K, Li L, Wang X, Hong R, Zhang Y, Yang H, Lin M, Zhang S, He Q, Zheng D, Tang J, Yin Y, Shao G (2015) The deubiquitinating enzyme complex BRISC is required for proper mitotic spindle assembly in mammalian cells. J Cell Biol 210: 209–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yeh TY, Sbodio JI, Chi NW (2006) Mitotic phosphorylation of tankyrase, a PARP that promotes spindle assembly, by GSK3. Biochem Biophys Res Commun 350: 574–9. [DOI] [PubMed] [Google Scholar]
- Zhang Y, Liu S, Mickanin C, Feng Y, Charlat O, Michaud GA, Schirle M, Shi X, Hild M, Bauer A, Myer VE, Finan PM, Porter JA, Huang SM, Cong F (2011) RNF146 is a poly(ADP‐ribose)‐directed E3 ligase that regulates axin degradation and Wnt signalling. Nat Cell Biol 13: 623–9. [DOI] [PubMed] [Google Scholar]
- Zheng H, Gupta V, Patterson‐Fortin J, Bhattacharya S, Katlinski K, Wu J, Varghese B, Carbone CJ, Aressy B, Fuchs SY, Greenberg RA (2013) A BRISC‐SHMT complex deubiquitinates IFNAR1 and regulates interferon responses. Cell Rep 5: 180–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
