Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2019 Jan 25;43(2):108–116. doi: 10.1002/cbin.11028

Bcl6 knockdown aggravates hypoxia injury in cardiomyocytes via the P38 pathway

Yang Gu 1,2, Man Luo 1,2, Yong Li 1, Zhongping Su 1, Yaqing Wang 1, Xiru Chen 1, Siqi Zhang 1, Wei Sun 1,✉, Xiangqing Kong 1,✉
PMCID: PMC13397402  PMID: 29972264

Abstract

B‐cell lymphoma 6 (Bcl6) functions as a sequence‐specific transcriptional repressor and negative regulator of many signaling proteins. The effects of Bcl6 on cardiomyocyte injury are not clear. This study was designed to determine whether Bcl6 affects hypoxia‐induced cardiomyocyte injury and, if so, to identify the underlying mechanism. To meet this aim, cardiomyocytes were exposed to hypoxia and Bcl6 siRNA was used to silence Bcl6 in cardiomyocytes. Bcl6 knockdown under physiological conditions caused increased oxidative stress, apoptosis, and expression of pro‐inflammatory cytokines. Increased inflammatory response, oxidative stress, and apoptosis were observed after cells were exposed to hypoxia for 24 h. Bcl6 knockdown aggravated cardiomyocyte injury when exposed to hypoxia. Bcl6 knockdown increased P38 activation without affecting JNK and ERK phosphorylation levels. Treatment with a P38 inhibitor reversed the Bcl6 silencing‐induced deteriorating phenotype, as evidenced by reduced inflammatory response, improved oxidative stress response, and increased cell viability. The results indicate that Bcl6 knockdown causes cardiomyocyte injury at baseline conditions and aggravates cardiomyocyte hypoxia injury via activating the P38 pathway.

Keywords: Bcl6, cardiomyocytes, hypoxia, P38


Abbreviations

Bcl6

B‐cell lymphoma 6

DAMPs

danger associated molecular patterns

ERK

extracellular regulated protein kinases

IL‐1

Interleukin‐1

JNK

c‐Jun N‐terminal kinase

MAPK

mitogen‐activated protein kinase

MDA

malondialdehyde

MI

myocardial infarction

PPAR

peroxisome proliferators‐activated receptor

PRRs

pattern recognition receptors

ROS

reactive oxygen species

SOD

superoxide dismutase

STAT

signal transducers and activators of transcription

TNFα

Tumor necrosis factor α

Introduction

Myocardial infarction (MI), one of the leading causes of death worldwide, is mainly caused by coronary artery occlusion and ischemia (Stanton and Dunn, 2017). The primary consequence of ischemia is insufficient delivery of oxygen and nutrients to tissues, which induces bio‐energetic failure (Kurian et al., 2016). The high metabolic demand of the heart makes this organ particularly susceptible to ischemic insults (Heusch, 2016). Oxidative stress, metabolic derangements, and inflammation all involve the pathological process of cardiac ischemia (Wang and Yoshioka, 2017). The complex mechanisms of ischemic injury in the heart have not been fully elucidated. Hence, an understanding of the molecular and cellular mechanisms of ischemia in the heart is of vital importance for the identification of new therapeutic targets.

Bcl6 is a sequence‐specific transcriptional repressor, originally characterized as a regulator of B‐lymphocyte development and growth, and has been shown to function in many other diseases (Wei et al., 2015). By targeting diverse factors, including transcription factors such as signal transducers and activators of transcription (STAT3 and STAT5B), and microRNA interaction, Bcl6 contributes to the progression of various types of cancer (Hatzi and Melnick, 2014; Wei et al., 2015; Cardenas et al., 2017). Bcl6 can also relieve renal inflammation by negatively regulating nucleotide‐binding domain, leucine‐rich‐containing family, pyrin domain‐containing‐3 (NLRP3) inflammasomes (Chen et al., 2017). Bcl6 also promotes the polarization of M2‐like macrophages and protects macrophages against oxidative stress and apoptosis (Jia et al., 2017). Furthermore, Bcl6 regulates early adipogenesis of mesenchymal stem cells by activating STAT1 (Hu et al., 2016). In the heart, Bcl6 inhibits doxorubicin‐induced senescence by interacting with peroxisome proliferator‐activated receptor delta (Altieri et al., 2012). Bcl6 deficiency causes severe myocarditis, indicating that Bcl6 negatively regulates inflammation in heart tissue (Yoshida et al., 1999). Given the anti‐inflammation, ‐oxidative stress, and ‐apoptosis effects of Bcl6, we hypothesized that Bcl6 participates in the pathological process of cardiac ischemia injury and may become a therapeutic target of cardiac ischemia injury. The aim of this study was to elucidate the functional role of Bcl6 in cardiomyocyte hypoxia injury.

Materials and methods

The primary antibodies used in this study were purchased from Cell Signaling Technology (Danvers, MA, USA) and include: phosphorylated (P)‐P38 (4511P); total (T)‐P38 (9212P); P‐JNK (4668P); T‐JNK (9258); P‐ERK (4370P); T‐ERK (4695); Bax (2722); Bcl‐2 (2870); and GAPDH (2118). Fetal bovine serum was ordered from Gibco (Grand Island, USA). Cell culture reagents were purchased from Gibco. Bcl6 siRNA was purchased from Santa Cruz (Bcl6‐1: 5′‐GCTTGTGCCACAGCAATAT‐3′; Bcl6‐2: 5′‐GCAGACGCACAGTGACAAA‐3′; Bcl6‐3: 5′‐GCCTCAATCAGAATGCCAA‐3′, CA, USA). SB209063 was purchased from Medchem Express (New Jersey, USA). SP600129 was purchased from Sigma (Santa Clara, CA, USA). SCH772984 was purchased from Selleck (Houston, TX, USA).

Cell culture

H9c2 cells were prepared as previously described (Gu et al., 2017). H9c2 cardiomyocytes were obtained from the Cell Bank of the Chinese Academy of Sciences, in Shanghai, China and cultured in DMEM (C11995; GIBCO, Thermo Fisher, Waltham, MA, USA) supplemented with 10% fetal bovine serum (10099; GIBCO) in 5% CO2 inside a humidified incubator (SANYO 18 M, Osaka, Japan) at 37°C. The cells were divided into four treatment groups: siRNA‐Normoxia; siBcl6‐Normoxia; siRNA‐Hypoxia; and siBcl6‐Hypoxia. After cells were treated with siBcl6 or the negative control siRNA, they were exposed to hypoxia for 24 h. The hypoxia model was induced as described previously (Gu et al., 2017).

Quantitative reverse‐transcriptase polymerase chain reaction (qRT‐PCR)

Total RNA was extracted from cardiomyocytes as described previously (Gu et al., 2017) using TRIzol™ (15596‐026; Roche Diagnostics, Mannheim, Germany). In brief, RNA yield and purity were evaluated using a SmartSpec Plus Spectrophotometer (Bio‐Rad, Hercules, CA, USA), comparing the A260/A280 and A230/260 ratios. The RNA (2 μg of each sample) was reverse‐transcribed into cDNA using oligo(dT) primers and the Transcriptor First Strand cDNA Synthesis kit (04896866001; Roche Diagnostics). The PCR products were quantified using the LightCycler 480 SYBR® Green 1 Master Mix (04707516001; Roche Diagnostics). Results were normalized against GAPDH gene expression. The sequences of the oligonucleotide primers (Sangon Biotech, Shanaghai, China) used are: Tumor necrosis factor α (TNFα), forward 5′‐AGCATGATCCGAGATGTGGAA‐3′, reverse 5′‐TAGACAGAAGAGCGTGGTGGC‐3′; Interleukin‐1 (IL‐1), forward 5′‐GGGATGATGACGACCTGCTAG‐3′, reverse 5′‐ACCACTTGTTGGCTTATGTTCTG‐3′; IL‐6, forward 5′‐GTTGCCTTCTTGGGACTGATG‐3′, reverse 5′‐ATACTGGTCTGTTGTGGGTGGT‐3′; P67, forward 5′‐GACCATTGCAAGTGAACACCC‐3′, reverse 5′‐AAATGAAGTGGACTCCACGCG‐3′, Gp91, forward, 5′‐GACCATTGCAAGTGAACACCC‐3′, reverse 5′‐AAATGAAGTGGACTCCACGCG‐3′.

Cell viability

Cell viability was evaluated using the MTT assay, in accordance with the manufacturer's instructions. In brief, cells were cultured in a 96‐well plate and 20 µL of MTT (5 mg/mL) was added to each well and the plate incubated at 37°C for 4 h. The MTT solution was then discarded, and 100 µL of dimethyl sulfoxide was added to the cells. Cell viability was determined at 495 nm using an ELISA plate reader (Synergy HT, Bio‐tek, VT, USA). Cell viability was normalized to that of the control group, which was set at 100%.

Oxidative stress

The level of intracellular reactive oxygen species (ROS) generation was assessed using the fluorescent dye, 2′, 7′‐dichlorofluorescin diacetate (DCFH‐DA) as previously described (Gu et al., 2017). In brief, cells were incubated with 1 × 10−5 mol/L DCFH‐DA in a 37°C incubator for 30 min. After washing with phosphate buffered saline three times, flow cytometry (BD Bioscience, San Jose, CA) was used to evaluate DCFH florescence. To determine the total superoxide dismutase (SOD) activity and malondialdehyde (MDA) levels we used a commercial kit (Beyotime, Beijing, China) according to the manufacturer's instructions.

TUNEL staining

Tunel staining was detected as described previously (Gu et al., 2017). In brief, cells were fixed in 4% paraformaldehyde and then permeabilized in 0.1% Triton X‐100. Cells were incubated in TUNEL reaction mixture for 1 h at 37°C. Nuclei were labeled with 4′, 6 diamidino‐2‐phenylindole (DAPI) and DNA fragmentation was quantified under high‐power magnification (×200). The percentages of TUNEL‐positive cells relative to DAPI‐positive cells were calculated by an investigator in a blinded manner.

Caspase‐3 activity assay

Caspase‐3 activity was analyzed using caspase‐3 (Promega, G8090), assays according to the manufacturer's instructions. Briefly, cells were lysed using the manufacturer‐provided homogeneous caspase reagent. The lysates were incubated at room temperature for 1.5 h before being read with a fluorometer at 485/530 nm. Luminescence values were detected by Fluoroskan Ascent FL (Thermo Scientific, MA, USA).

Western blot analysis

Western blotting was performed as described previously (Gu et al., 2017). In brief, cells were lysed in radioimmunoprecipitation lysis buffer and proteins were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis, then transferred to polyvinylidene difluoride membranes (Millipore). The following primary antibodies were used at a dilution of 1:1,000: P‐P38, T‐P38, P‐ERK, T‐ERK, P‐JNK, T‐JNK, Bax, Bcl‐2, and GAPDH. The secondary antibodies, goat anti‐rabbit IRdye® 800 CW (LI‐COR, 926‐32211) IgG and goat anti‐mouse IRdye® 800 CW (LI‐COR, 926‐32210), were used at a 1:10,000 dilution at 37°C in 5% milk blocking for 1 h. The blots were scanned using an infrared Li‐Cor scanner. Expression levels of specific phosphorylated proteins were normalized to total protein levels.

Statistical analysis

Data are expressed as the mean ± standard error of the mean. Differences among groups were determined by two‐way analysis of variance followed by Tukey's post‐hoc test. Comparisons between two groups were performed using an unpaired Student's t‐test. Statistical analyses were conducted using SPSS version 19.0 (SPSS Inc., Chicago, IL, USA). P < 0.05 was considered to indicate a statistically significant difference.

Results

Bcl6 knockdown caused increased inflammatory response in cardiomyocytes

First we evaluated the expression level of Bcl6 under hypoxia xondition. As shown in Figure 1A, Bcl6 was down‐regulated in hypoxia cardiomyocytes compared in normaxia cardiomyocytes. Bcl6 siRNA was used to silence Bcl6 gene expression. A 1 µg Bcl6 siRNA exert best knock down efficiency, thus we chose it for the further study (Figure 1B). We found that, under physiological conditions, Bcl6 knockdown decreased cell viability (Figure 1C), increased pro‐inflammatory cytokine (TNFα, IL‐1, IL‐6) expression, and decreased HIF‐1a expression in cardiomyocytes (Figures 1D–F). When cells were exposed to hypoxia for 24 h, cell viability decreased markedly, pro‐inflammatory cytokine expression increased, and HIF‐1a decreased. Bcl6 knockdown further increased these inflammatory responses and further decreased cell viability (Figures 1C–G).

Figure 1.

Figure 1

Bcl6 knockdown caused increased inflammatory response in cardiomyocytes. H9c2 cardiomyocytes were pretreated with Bcl6 siRNA and then exposed to hypoxia for 24 h. A, Western blot analysis of Bcl6 expression in cardiomyocytes expose to hypoxia (n = 6). *P < 0.05 versus Normoxia group B. Western blot analysis of Bcl6 expression in cardiomyocytes after treatment with different concentrations of Bcl6 siRNA or the negative control (siRNA) (n = 6). C, Cell viability was detected by MTT assay in the indicated groups (n = 6). D–G, RT‐PCT analysis of pro‐inflammatory cytokine (D–F) and HIF‐1a (G) expression in the indicated groups (n = 6). *P < 0.05 versus siRNA‐Normoxia group; # P < 0.05 versus siRNA‐Hypoxia group.

Bcl6 knockdown increased oxidative stress in cardiomyocytes

Under physiological conditions/Bcl6 knockdown increased the transcription of NADPH oxidase subunits, P67 and gp91 (Figures 2A and 2B). Furthermore, Bcl6 knockdown increased ROS levels (Figures 2C and 2D), decreased total SOD activity (Figure 2E), and increased the production of lipid peroxidation intermediate metabolites (MDA) (Figure 2F). When exposed to hypoxia, cells were under increased oxidative stress (Figure 2), which was further augmented by Bcl6 knockdown (Figure 2).

Figure 2.

Figure 2

Bcl6 knockdown increased oxidative stress in cardiomyocytes. A and B, RT‐PCT analysis of P67 and gp91 NADPH oxidase subunit expression in the indicated groups (n = 6). C and D, ROS level was detected and analyzed by flow cytometry (n = 6). E and F, Total SOD activity and MDA production in the indicated groups (n= 6). *P < 0.05 versus siRNA‐Normoxia group; # P < 0.05 versus siRNA‐Hypoxia group.

Bcl6 knockdown exacerbated apoptosis in cardiomyocytes

Under baseline conditions, tunel staining revealed that Bcl6 knockdown increased the proportion of apoptotic cells (Figures 3A and 3B). The number of apoptotic cells also increased after cells were exposed to hypoxia for 24 h. Bcl6 silencing increased apoptosis induced by hypoxia (Figures 3A and 3B). Moreover, Bcl6 silencing resulted in a decrease in the level of the anti‐apoptosis protein Bcl2 in both normoxic and hypoxic conditions. Moreover, pro‐apoptosis protein Bax was up‐regulated by Bcl6 deficiency. Bcl6 silencing also increased cytochrome C release as well as caspase‐3 activity in both normoxic and hypoxic conditions (Figures 3C–E).

Figure 3.

Figure 3

Bcl6 knockdown exacerbated apoptosis in cardiomyocytes. A and B, Apoptosis was detected by tunel staining. A, representative images (n = 6); B, quantitative results (n > 10 filed). C, caspase‐3 activity in the indicated groups (n = 6). D and E, Western blot analysis of Bax, Bcl2, and cytochrome C protein levels in the indicated groups (n = 6). *P < 0.05 versus siRNA‐Normoxia group; # P < 0.05 versus siRNA‐Hypoxia group.

Bcl6 deficiency activated P38 pathway in cardiomyocytes

To evaluate the underlying mechanism through which Bcl6 affects cardiomyocyte injury, the related signaling pathways were screened. We found that Bcl6 silencing increased P38 activation without affecting JNK and ERK phosphorylation in the normoxic state (Figures 4A–D). The phosphorylation levels of P38, JNK, and ERK increased after cells were expose to hypoxia. Interestingly, in the hypoxic state, Bcl6 silencing only increased P38 activation (Figures 4A–D). These results indicate that Bcl6 silencing accelerates cell inflammation, oxidative stress, and apoptosis via P38 activation.

Figure 4.

Figure 4

Bcl6 deficiency activates the P38 pathway in cardiomyocytes. A and B, Western blot analysis of P38, JNK, and ERK in the indicated groups (n = 6). A, representative images; B, quantitative results. *P < 0.05 versus siRNA‐Normoxia group; # P < 0.05 versus siRNA‐Hypoxia group.

P38 inhibition reversed the Bcl6 knockdown‐induced deteriorating phenotype

To further confirm that P38 is the target of Bcl6, cells were pretreated with P38 inhibitor (SB209063, 10 µM), JNK inhibitor (SP600125, 10 µM), and ERK inhibitor (SCH772984, 5 µM). Only treatment with the P38 inhibitor could reverse Bcl6 knockdown‐induced cell injury as assessed by decreased inflammatory response (Figures 5A–C), decreased ROS level (Figures 5D and 5E), and increased cell viability (Figure 5F).

Figure 5.

Figure 5

P38 inhibition reverses the Bcl6 knockdown‐induced deteriorating phenotype in cardiomyocytes. H9c2 cardiomyocytes were pretreated with Bcl6 siRNA, P38 inhibitor (SB209063, 10 μM), JNK inhibitor (SP600125, 10 μM), or ERK inhibitor (SCH772984, 5 μM) and then exposed to hypoxia for 24 h. A–C, RT‐PCT analysis of pro‐inflammatory cytokine expression in the indicated groups (n = 6). D and E, ROS levels in the indicated groups (n = 6). F, Cell viability in the indicated groups (n = 6). *P < 0.05 versus siRNA group; # P < 0.05 versus siBcl6 group.

Discussion

Coronary artery disease and subsequent myocardial infarction are responsible for more deaths worldwide than any other disease. Advances in clinical cardiology have significantly improved survival after acute MI, but the onset of heart failure continues to increase (Neri et al., 2017). Hypoxia during ischemia impairs cardiomyocytes. If the ischemic period is sufficiently prolonged, cardiomyocyte cell death programs are activated, including necrosis, apoptosis, and autophagy. Necrotic and stressed or injured cells produce danger signals, termed danger associated molecular patterns, which bind to cognate pattern recognition receptors to activate a cascade of inflammatory mediators, including inflammatory cytokines (Prabhu and Frangogiannis, 2016). These prolonged inflammation responses promote adverse left ventricular remodeling and heart failure (Frangogiannis, 2015). Bcl6 is emerging as a key oncoprotein and therapeutic target with a powerful transcriptional repression effect that silences hundreds of genes (Cardenas et al., 2017). Recently, Bcl6 was reported to suppress renal inflammation via negatively regulating NLRP3 transcription in a human renal tubular epithelial cell line (Chen et al., 2017). Bcl6 also attenuates allergic airway inflammation (Seto et al., 2011) and inflammation in the process of atherosclerosis (Barish et al., 2012). In our study, we found that Bcl6 silencing causes reduced viability and elevated inflammation in cardiomyocytes in normoxic and hypoxic conditions. These data indicate that Bcl6 negatively regulates inflammatory associated proteins or signaling.

The imbalance between oxidants and antioxidants (oxidative stress) favors the accumulation of oxidants. This imbalance results from increased ROS production and decreased ROS scavenging, and leads to protein, lipid, and DNA damage in cardiomyocytes (Chen et al., 2017). Increased ROS levels also increase proteolysis of excitation‐contraction coupling protein (Ayoub et al., 2017). Several preclinical and clinical studies have demonstrated the potential cardio‐protective value of antioxidants (Rodrigo et al., 2013; Zhang et al., 2017). Bcl6 protects against oxidative stress and apoptosis in macrophages and promotes M2‐like polarization (Jia et al., 2017). In our study, Bcl6 knockdown increased ROS levels, MDA production, and transcription of NADPH oxidase subunits, P67 and gp91, and decreased total antioxidant enzyme SOD activity in both normoxic and hypoxic conditions. These results suggest that Bcl6 protects cardiomyocytes from oxidative stress, and once Bcl6 is silenced, cardiomyocytes impairment occurs spontaneously.

MAPKs are central signaling intermediates that coordinate diverse physiological and pathological events such as those occurring in cancer, inflammation, diabetes, memory, and cardiac remodeling (Liu and Molkentin, 2016). MAPK is activated by membrane receptors, or other ill‐defined stress‐sensing effectors, which subsequently activate three major pathways including the p38 MAPK, JNK, and ERK pathways. Once activated, MAPKs phosphorylate a variety of downstream substrates to regulate events such as cell proliferation, differentiation, apoptosis, growth, cellular re‐organization, and metabolism (Liu and Molkentin, 2016). ERK1/2 deficient mice develop cardiac dilation and eccentric left ventricle growth. These results indicate that ERK1/2 regulate the dimensional growth of the heart, which has been linked to the growth of individual cardiomyocytes in either width or length (Kehat et al., 2011). P38 is expressed ubiquitously and implicated in numerous cardiac pathologies including endothelial dysfunction, atherosclerosis, MI, post‐infarction remodeling, contractile dysfunction, arrhythmia, and heart failure (Martin et al., 2015). Generally, p38 is activated by, and contributes to, lethal ischemic injury (Martin et al., 2015). Many P38 inhibitors have proved beneficial in animal models and pre‐clinical studies (Newby et al., 2014; Chen and Maltagliati, 2017). Previous studies have demonstrated that P38 was activated in Bcl6 deficient mice spermatocytes (Kojima et al., 2001). In our study, Bcl6 knockdown increased P38 activation without affecting JNK and ERK activation levels in both normoxic and hypoxic conditions. The P38 inhibitor, but not the JNK or ERK inhibitors, could reverse the pro‐injury effects of Bcl6 silencing. These results indicate that the target of Bcl6 is P38 MAPK, and not JNK or ERK.

In conclusion, Bcl6 may participate in the maintenance of cardiomyocyte balance. Bcl6 deficiency disrupts this balance, causing inflammation, oxidative stress, and apoptosis in cardiomyocytes and aggregates in hypoxia‐induced cardiomyocyte injury. Thus, Bcl6 may become a new therapeutic target for the treatment of cardiovascular disease.

Contributor Information

Wei Sun, Email: weisun7919@outlook.com.

Xiangqing Kong, Email: kongxq_njmu@outlook.com.

References

  1. Altieri P, Spallarossa P, Barisione C, Garibaldi S, Garuti A, Fabbi P, Ghigliotti G, Brunelli C (2012) Inhibition of doxorubicin‐induced senescence by PPARδ activation agonists in cardiac muscle cells: cooperation between PPARδ and Bcl6. PLoS ONE 7(9): e46126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ayoub KF, Pothineni NVK, Rutland J, Ding Z, Mehta JL (2017) Immunity, inflammation, and oxidative stress in heart failure: emerging molecular targets. Cardiovasc Drugs Ther 31(5‐6): 593–608. [DOI] [PubMed] [Google Scholar]
  3. Barish GD, Yu RT, Karunasiri MS, Becerra D, Kim J, Tseng TW, Tai LJ, Leblanc M, Diehl C, Cerchietti L, Miller YI, Witztum JL, Melnick AM, Dent AL, Tangirala RK, Evans RM (2012) The Bcl6‐SMRT/NCoR cistrome represses inflammation to attenuate atherosclerosis. Cell Metab 15(4): 554–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cardenas MG, Oswald E, Yu W, Xue F, MacKerell AD, Jr , Melnick AM (2017) The expanding role of the BCL6 oncoprotein as a cancer therapeutic target. Clin Cancer Res 23(4): 885–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen DXX, Zang YH, Tong Y, Zhou B, Chen Q, Li YH, Gao XY, Kang YM, Zhu GQ (2017) BCL6 attenuates renal inflammation via negative regulation of NLRP3 transcription. Cell Death Dis 8(10): e3156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen L, Yan KP, Liu XC, Wang W, Li C, Li M, Qiu CG (2017) Valsartan regulates TGF‐β/Smads and TGF‐β/p 38 pathways through lncRNA CHRF to improve doxorubicin‐induced heart failure. Arch Pharm Res 41(1): 101–9. [DOI] [PubMed] [Google Scholar]
  7. Chen QM, Maltagliati AJ (2017) Nrf2 at the heart of oxidative stress and cardiac protection. Physiol Genomics 50(2): 77–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Frangogiannis NG (2015) Pathophysiology of myocardial infarction. Compr Physiol 5(4): 1841–75. [DOI] [PubMed] [Google Scholar]
  9. Gu Y, Gao L, Chen Y, Xu Z, Yu K, Zhang D, Zhang G, Zhang X (2017) Sanggenon C protects against cardiomyocyte hypoxia injury by increasing autophagy. Mol Med Rep 16(6): 8130–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hatzi K, Melnick A (2014) Breaking bad in the germinal center: how deregulation of BCL6 contributes to lymphomagenesis. Trends Mol Med 20(6)): 343–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Heusch G (2016) Myocardial ischemia: lack of coronary blood flow or myocardial oxygen supply/demand imbalance? Circ Res 119(2): 194–6. [DOI] [PubMed] [Google Scholar]
  12. Hu X, Zhou Y, Yang Y, Peng J, Song T, Xu T, Wei H, Jiang S, Peng J (2016) Identification of zinc finger protein Bcl6 as a novel regulator of early adipose commitment. Open Biol 6(6): 160065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Jia J, Shi X, Jing X, Li J, Gao J, Liu M, Lin CI, Guo X, Hua Q (2017) BCL6 mediates the effects of Gastrodin on promoting M2‐like macrophage polarization and protecting against oxidative stress‐induced apoptosis and cell death in macrophages. Biochem Biophys Res Commun 486(2): 458–64. [DOI] [PubMed] [Google Scholar]
  14. Kehat I, Davis J, Tiburcy M, Accornero F, Saba‐El‐Leil MK, Maillet M, York AJ, Lorenz JN, Zimmermann WH, Meloche S, Molkentin JD (2011) Extracellular signal‐regulated kinases 1 and 2 regulate the balance between eccentric and concentric cardiac growth. Circ Res 108(2): 176–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kojima S, Hatano M, Okada S, Fukuda T, Toyama Y, Yuasa S, Ito H, Tokuhisa T (2001) Testicular germ cell apoptosis in Bcl6‐deficient mice. Development 128(1): 57–65. [DOI] [PubMed] [Google Scholar]
  16. Kurian GA, Rajagopal R, Vedantham S, Rajesh M (2016) The role of oxidative stress in myocardial ischemia and reperfusion injury and remodeling: Revisited. Oxid Med Cell Longev 2016: 1656450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Liu R, Molkentin JD (2016) Regulation of cardiac hypertrophy and remodeling through the dual‐specificity MAPK phosphatases (DUSPs). J Mol Cell Cardiol 101: 44–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Martin ED, Bassi R, Marber MS (2015) P38 MAPK in cardioprotection—are we there yet? Br J Pharmacol 172(8): 2101–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Neri M, Riezzo I, Pascale N, Pomara C, Turillazzi E (2017) Ischemia/reperfusion injury following acute myocardial infarction: a critical issue for clinicians and forensic pathologists. Mediators Inflamm 2017: 7018393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Newby LK, Marber MS, Melloni C, Sarov‐Blat L, Aberle LH, Aylward PE, Cai G, de Winter RJ, Hamm CW, Heitner JF, Kim R, Lerman A, Patel MR, Tanguay JF, Lepore JJ, Al‐Khalidi HR, Sprecher DL, Granger CB, SOLSTICE Investigators (2014) Losmapimod, a novel p38 mitogen‐activated protein kinase inhibitor, in non‐ST‐segment elevation myocardial infarction: a randomised phase 2 trial. Lancet 384(9949): 1187–95. [DOI] [PubMed] [Google Scholar]
  21. Prabhu SD, Frangogiannis NG (2016) The biological basis for cardiac repair after myocardial infarction: from inflammation to fibrosis. Circ Res 119(1): 91–112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Rodrigo R, Libuy M, Feliú F, Hasson D (2013) Molecular basis of cardioprotective effect of antioxidant vitamins in myocardial infarction. Biomed Res Int 2013: 437613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Seto T, Yoshitake M, Ogasawara T, Ikari J, Sakamoto A, Hatano M, Hirata H, Fukuda T, Kuriyama T, Tatsumi K, Tokuhisa T, Arima M (2011) Bcl6 in pulmonary epithelium coordinately controls the expression of the CC‐type chemokine genes and attenuates allergic airway inflammation. Clin Exp Allergy 41(11): 1568–78. [DOI] [PubMed] [Google Scholar]
  24. Stanton T, Dunn FG (2017) Hypertension, left ventricular hypertrophy, and myocardial ischemia. Med Clin North Am 101(1): 29–41. [DOI] [PubMed] [Google Scholar]
  25. Wang BF, Yoshioka J (2017) The emerging role of thioredoxin‐interacting protein in myocardial ischemia/reperfusion injury. J Cardiovasc Pharmacol Ther 22(3): 219–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Wei Z, Gao W, Wu Y, Ni B, Tian Y (2015) Mutual interaction between BCL6 and miRNAs contributing to the pathogenesis of various cancers. Clin Transl Oncol 17(11): 841–6. [DOI] [PubMed] [Google Scholar]
  27. Yoshida T, Fukuda T, Hatano M, Koseki H, Okabe S, Ishibashi K, Kojima S, Arima M, Komuro I, Ishii G, Miki T, Hirosawa S, Miyasaka N, Taniguchi M, Ochiai T, Isono K, Tokuhisa T (1999) The role of Bcl6 in mature cardiac myocytes. Cardiovasc Res 42(3): 670–9. [DOI] [PubMed] [Google Scholar]
  28. Zhang W, Li Y, Ge Z (2017) Cardiaprotective effect of crocetin by attenuating apoptosis in isoproterenol induced myocardial infarction rat model. Biomed Pharmacother 93: 376–82. [DOI] [PubMed] [Google Scholar]

Articles from Cell Biology International are provided here courtesy of Wiley

RESOURCES