Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2019 Jan 25;43(2):125–135. doi: 10.1002/cbin.11061

IRGM promotes glioma M2 macrophage polarization through p62/TRAF6/NF‐κB pathway mediated IL‐8 production

Yanwen Xu 1,2,3, Chuanpeng Liao 1,3, Renli Liu 1, Jing Liu 1,3, Zhongping Chen 2, Huafu Zhao 1,3, Zongyang Li 1,3, Lei Chen 1,3, Changpeng Wu 1,3, Hui Tan 1,3, Wenlan Liu 1,3,✉, Weiping Li 1,3,✉
PMCID: PMC13397409  PMID: 30288851

Abstract

Alternatively activated (M2) macrophage promotes glioma progression and immune escape as the most immunocyte in glioma microenvironment. Finding out the key protein regulating M2 macrophage polarization is necessary for improving treatment. Whether immunity related GTPase M (IRGM) is involved in glioma development and M2 macrophage polarization is unknown. IRGM and M2 macrophage marker CD206 expression were examined using immunohistochemistry among 35 glioma and 11 non‐cancerous brain specimens. We found IRGM scores were positively correlated with CD206 scores in glioma specimens and monocyte proportion in blood samples. A172 glioma cells transfected with either IRGM knock‐down lentivirus (Lenti‐IRGM) or control lentivirus (Lenti‐HK) were subcutaneously injected into nude mice. In vivo, xenografted glioma size of the Lenti‐IRGM group was smaller and had weaker fluorescence signal than Lenti‐HK control group. Immunofluorescence results showed that there was obviously decreased IRGM, CD206, and IL‐8 expression in the mice glioma of Lenti‐IRGM group than Lenti‐HK control group. In vitro, flow cytometry results showed that M2 polarization from THP‐1 cocultured with Lenti‐IRGM glioma cells decreased in contrast to that with Lenti‐HK glioma cells; there were less interleukin‐8 (IL‐8) and macrophage inflammation protein 3‐α (MIP‐3α), but more interleukin‐6 (IL‐6) in the supernatant of Lenti‐IRGM glioma cells than matched control. Western blot and immunofluorescence displayed that IRGM strongly promoted sequestosome‐1 (p62/SQSTM1), necrosis factor receptor‐activating factor 6 (TRAF6) expression and NF‐κB transportation to the nucleus. Realtime PCR results demonstrated IRGM also promoted NF‐κB downstream cytokines IL‐8 and MIP‐3α mRNA expression. These data suggested that IRGM could promote glioma development and M2 macrophage polarization by regulating p62/TRAF6/NF‐κB pathway‐mediated IL‐8 production.

Keywords: glioma, immunity related GTPase M, interleukin‐6, interleukin‐8, macrophage inflammation protein 3‐α, M2 macrophage


Abbreviations

GAM

glioma‐associated microglia/macrophages

IL‐6

interleukin‐6

IL‐8

interleukin‐8

IRGM

immunity related GTPase M

M2 macrophage

alternatively activated macrophage

MIP‐3α

macrophage inflammation protein 3‐α

p62/SQSTM1

sequestosome‐1

TAM

tumor‐associated macrophages

TILs

tumor‐infiltrating lymphocytes

TRAF6

necrosis factor receptor‐activating factor 6

Introduction

Glioma is the most common malignant brain tumor of adults (Reardon and Mitchell, 2017). Although aggressive treatment methods including surgery, radiation, and temozolomide are improving, glioma, in particular its highest grade glioblastoma remains incurable (Stupp et al., 2009). It is difficult for surgical resection to cleanup tumor tissue completely. Recently, T cells expressing chimeric antigen receptors (CARs) have impressive therapeutic potential, but their ability is limited within glioma immune microenvironment (O'Rourke et al., 2017). It is admitted that immunocytes and molecules participate in pathogenesis by promoting the formation of immune microenvironment. There is a pressing need to explore the mechanism underlying the formation of immune microenvironment for improving treatment.

IRGM resists to the intracellular bacterium as a member of the GTPases family (Kim et al., 2012). Recent studies have shown that IRGM is mainly associated with chronic infectious diseases or inflammatory bowel diseases (Song et al., 2014; Iida et al., 2017). Importantly, IRGM can promote tumorigenesis and cell growth in melanoma and hepatocellular carcinoma (Dong et al., 2015; Wang et al., 2017). Immunity‐related GTPase family member 1 (mouse: Irgm1; human: IRGM) promotes pro‐inflammatory macrophage subset polarization under autoimmune disease environment (Xu et al., 2017). IRGM looks like a cross point between immunity and tumor. However, the role of IRGM in glioma pathogenesis and whether IRGM is related to immune microenvironment (immunocytes, cytokines, and chemokines) in glioma are not clear.

Tumor immune microenvironment consists of immunocytes, cytokines, and chemokines. Previous studies have shown that lymphocyte infiltration occurs in glioma and that the presence of tumor‐infiltrating lymphocytes (TILs) is predictive of clinical outcome (Zhang et al., 2017). Microglia/macrophages increase up to 30% of cells in brain tumors as the most immunocytes, while resident microglia cells account for 5–10% of cells in normal brains (Watters et al., 2005; Kettenmann et al., 2011). Glioma‐associated microglia/macrophages (GAM) have two polarization subsets M1 (classically activated, pro‐inflammatory) and M2 (alternatively activated, immunosuppressive) (Gabrusiewicz et al., 2011; Zhai et al., 2011; Szulzewsky et al., 2015). M2 cell is predominant subset within tumor, and helps to establish immunosuppressive tumor environment, promoting glioma cells growth, angiogenesis, and immune escape (Hussain et al., 2006; Hambardzumyan et al., 2016).

Some cytokines and chemokines play an important role during glioma development and M2 cell polarization. IL‐8 promotes a pro‐oncogenic inflammatory microenvironment by inducing M2‐type tumor‐associated macrophages (TAMs) (Xiao et al., 2018; Li et al., 2016). The chemokine MIP‐3α (also called CCL20) could influence tumor growth through mediating macrophage recruitment (Jayaraman et al., 2018). IL‐6 is a multifunctional cytokine released by M1 macrophages as proinflammatory cytokine, and could inhibit M2 macrophages polarization (Sansone et al., 2007; Chishti et al., 2018).

The aim of this study was to determine whether IRGM had an effect on glioma development and cytokines‐regulated M2 macrophage polarization. We found that IRGM expression had positive correlation with M2 macrophage marker CD206 expression, and glioma cells‐derived IRGM protein promoted the glioma growth and polarization of M2 macrophage in vivo and in vitro. IRGM significantly upregulated IL‐8 and MIP‐3α level, but reduced IL‐6 production in vitro. In addition, p62 and TRAF6 expression, NF‐κB nuclear transfer decreased after IRGM knockdown in glioma cells. Our results suggested that IRGM highly expressed by glioma cells promoted IL‐8 release and further M2 macrophages polarization via regulating p62/TRAF6/NF‐κB signaling.

Materials and methods

Patients and samples

Thirty‐five glioma specimens were collected between 2014 and 2016 from the patients with primary glioma without infection, inflammation, hepatitis, diabetes, and so on at the first diagnosis. Eleven non‐cancerous brain tissues were collected from patients with trauma, epilepsy, and vascular malformation after surgery. We declare that the project was approved by our hospital ethics committee (Shenzhen Second People's Hospital). Surgeries were performed before carrying out chemotherapy or radiation. WHO grade II diffuse astrocytoma (n = 16), WHO grade III anaplastic astrocytoma (n = 10), and WHO grade IV GBM (n = 9).

Cell lines and culture

Human glioma cell line A172 was obtained from the Institute of Biochemistry and Cell Biology (Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China). All cells were cultured in DMEM supplemented with 10% heat‐inactivated fetal bovine serum (FBS, Gibco Life Technologies, Carlsbad, CA, USA), and were stored in a humidified incubator at 37 °C containing 5% CO2.

Xenograft experiments

To select stably expressed cells, A172 cells were transfected with pLenti‐IRGM‐GFP or pLenti‐HK‐GFP. Lenti‐IRGM and Lenti‐HK cells were established and inoculated into Balb/c nude mice (4 to 5 weeks old) in subcutaneous (5 × 106) fashions. Caliper measurements were performed to assess tumor growth. The length was examined in the longest direction, and the width was examined at the widest position and vertical direction to length. The size is represented by multiplying the width of subcutaneous tumor and the length of subcutaneous tumor (W*L). Each nude mouse was anesthetized by inhaling fluothane, then animal in vivo imaging system (IVIS spectrum) was used to test GFP fluorescence intensity and assess tumor growth, the nude mice were euthanized and the tumors obtained 4 weeks post‐implantation. All mice experimental procedures were performed according to the Shenzhen Second People Hospital policies.

Immunohistochemistry

Formalin‐fixed, paraffin‐embedded, sectioned tissues (4 µm thick) were performed with clinical samples. IRGM and CD206 were stained with anti‐human IRGM rabbit antibody (1:200, Abcam) and anti‐human/mouse CD206 rabbit antibody (1:200, Abcam), respectively. After deparaffinization and rehydration, tissue sections were incubated with 3% hydrogen peroxide to block endogeneous peroxidase activity. The primary antibodies were incubated at 4 °C overnight. The second antibodies followed by DAB were used to detect antigen‐antibody binding, then the sections were stained by hematoxylin.

Immunohistochemical evaluation

Protein expression level was assessed according to the following criteria: an intensity score from 0 to 3 (I0, I1–3), the proportion score of positive cells from 0 to 4 (P0, P1–4). Intensity score: negative = 0; weakly positive = 1; positive = 2; strongly positive = 3. Proportion score of positive cells: 0 (no staining); 1 (1–25%, including 25%); 2 (25–50%, including 50%); 3 (50–75%, including 75%); 4 (>75%). The final score (range 0–12) was calculated as final score = I × P.

Lentiviral vector transfection

Lentiviral transfection was used to knockdown IRGM according to the manufacturer's protocols. Lentiviral vectors of Lenti‐IRGM group (shRNA sequence: GAAAGCAGTGCTGTGTAACAGAAAT) and Lenti‐HK control with GFP and resistance to puromycin were purchased from Hanbio Biotechnology (Shanghai, China). A total of 8 × 104 cells seeded in a 12‐well plate were infected by 2.4 × 105 infectious units of lentiviruses (multiplicity of infection [MOI] = 3). Infected cells were selected using puromycin (Gibco Life Technologies, Carlsbad, CA, USA). Seventy‐two hours later, cells were centrifuged to remove cell debris.

Immunofluorescence

Nonspecific binding was blocked by incubating the cell crawling slices or frozen sections of mice glioma in 5% BSA and 0.1% Triton PBS for 1 h. Next, cell crawling slices or frozen sections were incubated overnight with rabbit anti‐human IRGM, anti‐human/mouse CD206 rabbit antibody, mouse anti‐IL‐8 antibody, and rabbit anti‐human NF‐κB (1:100, Abcam), followed by incubation with Cy3 goat anti‐rabbit antibody and Cy3 goat anti‐mouse antibody (1:500, Abcam) for 1 h. Samples were then incubated in DAPI (Sigma–Aldrich, 0.5 µg/mL in PBS) for 5 min, photographed using scanning confocal laser microscopy (Zeiss, German).

Coculture of THP‐1‐derived macrophages and A172 cells

THP‐1 cells were stimulated with PMA (100 ng/mL, Sigma) to induce macrophages. At the same time, A172 cells with IRGM knockdown were prepared. Afterwards, A172 cells were added to the top of layered coculture transwells (Corning Incorporated), and cocultured with macrophage (ratio 2:1) in 2 mL 10% DMEM for 72 h. The transwell is a 12 wells plate having a permeable insert on top. The macrophages on the bottom could not contact the A172 cells on the top.

Flow cytometry

Single cell suspension was prepared in wash buffer containing PBS with 0.1% sodium azide. CD11b‐FITC and CD206‐PE (M2 macrophage markers) antibodies (5 μg/mL, Biolegend) were diluted in the FACS buffer containing 1% BSA and incubated with cells for 30 min at 4 °C. After cells were washed twice with FACS buffer, flow cytometric data were acquired using a FACS Calibur flow cytometer (BD) and analyzed by FLOWJO software (Treestar, London, MN).

Measurement of cytokine secretion

Culture supernatants were collected for analysis of cytokines. Cytokine secretion was quantified with MILLIPLEX® MAP, a Human High Sensitivity T Cell Magnetic Bead Panel (Merck KGaA, Darmstadt, Germany) to examine MIP‐3α, IL‐6, and IL‐8.

Western blotting

The primary antibodies used here included the following: anti‐human IRGM antibodies (1:1,000, Abcam), anti‐human p62 and TRAF6 (1:1,000, Cell Signaling Technology, Danvers, MA, USA). Anti‐rabbit HRP‐linked antibody and anti‐mouse HRP‐linked antibody (1:5,000, CST, IL, USA) were used the next day. Results were observed by chemiluminescence (Thermo Fisher Scientific, Grand Island, NY, USA) and quantified using Quantity One (Bio‐Rad, Hercules, CA, USA).

Realtime PCR

Total RNA was extracted from Lenti‐HK and Lenti‐IRGM A172 cells with a Trizol extraction method recommended by Invitrogen and reverse‐transcribed with an RT‐PCR kit from TaKaRa (Kusatsu, Japan). Gene expression was measured by the change‐in‐threshold (ΔΔCT) method based on qPCR. Human IRGM, p62, IL‐8, MIP‐3α and IL‐6 were detected with primer sets: IRGM1 (5′‐TGGCAATGGCATGTCATCTT‐3′, 5′‐AGTACTCAGTCCGCGTCTTCGT‐3′); p62 (5′‐CTGGGACTGAGAAGGCTCAC‐3′, 5′‐GCAGCTGATGGTTTGGAAAT‐3′); IL‐8 (5′‐CACAAGAGCCAGGAAGAAAC‐3′, 5′‐CTACAACAGACCCACACAATAC‐3′); MIP‐3α (5′‐GCAAGCAACTTTGACTGCTG‐3′, 5′‐CAAGTCCAGTGAGGCACAAA‐3′); IL‐6 (5′‐GCTTACCAGGCAACAT‐3′, 5′‐CTGGCACCAGAAACGA‐3′). qPCR was performed using CFX96 real‐time system (Bio‐Rad).

Statistical analysis

Statistical data are displayed as means ± SEM. Statistical difference between two groups was analyzed by two‐tailed Student's t‐test, and the correlations between IRGM expression and different immunocytes were analyzed by Pearson test using GraphPad Prism 5 software. The level of significance was set at P < 0.05.

Results

High IRGM expression is positively correlated to M2 macrophage in human glioma

In this study, the protein level of IRGM in human glioma and non‐cancerous control was examined. We found that IRGM was highly expressed in glioma of grade II, III, and IV than non‐cancerous control brain tissues (Figure 1A). Analysis of immunohistochemical results showed that glioma tissues of 35 cases had higher total scores of IRGM compared with non‐cancerous brain tissues (Figure 1B). Previous study reports, IRGM/Irgm1 is closely related to chronic infectious diseases or inflammatory bowel diseases (Song et al., 2014; Iida et al., 2017). In addition, Irgm1 regulates macrophage subset polarization and cytokines production under autoimmune disease environment (Xu et al., 2017). Therefore, we supposed that whether IRGM highly expressed in glioma is closely related to immunocytes of glioma patients. To probe the role of IRGM in macrophages accumulation in glioma tissue, we tested M2 macrophage marker CD206 expression with immunohistochemistry among 35 patients (Figure 1C). Interestingly, CD206 expression scores were positively related to IRGM scores (Figure 1D). In addition, the relevance between IRGM level and the proportion of monocyte in the blood of 35 patients was analyzed. Results showed that IRGM positive cell proportion was not related to monocyte proportion (Figure 1E). However, IRGM total scores were positively associated with monocyte proportion (Figure 1F). These results suggested IRGM might have an influence on monocyte/macrophage activation and function of glioma patients.

Figure 1.

Figure 1

High IRGM expression is positively correlated to M2 macrophage in human glioma. (A) Eleven nontumorous brain tissues (Control), 16 diffuse astrocytoma (grade II), 10 anaplastic astrocytoma (grade III), and 9 glioblastoma (grade IV) specimens were stained with immunohistochemistry to detect IRGM expression. (B) Total staining score of IRGM in glioma tissues were counted and analyzed among control and three grades of glioma. (C) CD206 was also detected among specimens above with immunohistochemistry. (D) The relevance of IRGM score and CD206 score among specimens with glioma was shown. (E) The relevance of IRGM positive cell rate and monocyte proportion was analyzed. (F) The relevance of IRGM score and monocyte proportion was analyzed. Scale bars represent 50 µm. **P < 0.01.

IRGM promoted glioma development in vivo mice model

To probe whether IRGM participates in glioma development, we established IRGM knock‐down A172 cell line using Lentiviral transfection. Western blot and Realtime PCR results showed IRGM was knocked down in Lenti‐IRGM than Lenti‐HK control (Figures 5A, 5B, and 5F). Then we established glioma xenograft mice model with these A172 cells for the first time by subcutaneously injecting into nude mice. As shown in our experiments, the size of glioma was smaller in Lenti‐IRGM group compared to Lenti‐HK control (Figures 2A and 2B). Moreover, animal in vivo imaging system results showed that the GFP fluorescence intensity of Lenti‐IRGM group was weaker than Lenti‐HK control (Figures 2C and 2D). Representative H&E stainings of xenograft tumors in nude mice showed that glioma xenograft mice model was successfully established as shown in Figure 2E. The tumor size and GFP fluorescence intensity of the xenografts confirmed that IRGM promoted tumor tumorigenesis and development in vivo.

Figure 5.

Figure 5

IRGM may regulate IL‐8 through p62/TRAF6/ NF‐κB pathway. (A–D) Western blot results indicated that the protein expression of p62 and TRAF6 in A172 cells decreased after IRGM knockdown. (E) Immunofluorescence results showed that there was also less NF‐κB p65 nucleic location in Lenti‐IRGM than Lent‐HK. p65 was stained with TRITC (red), and nucleus was stained with DAPI (blue). (F) Realtime PCR was used to analyze the mRNA expression level of IRGM, p62, IL‐8, MIP‐3α, and IL‐6 in Lenti‐IRGM cells compared with Lenti‐HK. The scale bar represents 50 µm. All data shown represent three independent experiments. *P <0.05, **P < 0.01, ***P < 0.001.

Figure 2.

Figure 2

IRGM promoted glioma development in vivo mice model. (A and B) A172 cells of Lenti‐IRGM group or Lenti‐HK control were subcutaneously injected into nude mice, and the size of glioma was measured and analyzed 2 months later. (C) Animal in vivo imaging system (IVIS spectrum) was used to examine the GFP fluorescence intensity of injected A172 cells, and the signal intensity of ROI reflected tumor growth. (D) Statistic results of ROI fluorescence intensity between Lenti‐IRGM group and Lenti‐HK control were shown. (E) Representative H&E stainings of xenograft gliomas in nude mice showed that glioma xenograft mice model was successfully established. Magnification: ×200 and ×400; scale bar: 50 μm. Experiments were performed in three independent experiments. Data were calculated as mean ± SEM; *P <0.05, **P < 0.01.

IRGM up‐regulated M2 macrophage proportion and IL‐8 expression in glioma mice model

To further confirm the impact of IRGM on M2 macrophage accumulation and IL‐8 expression in vivo, immunofluorescence assay was used to analyze the expression of IRGM, CD206 and IL‐8 between Lenti‐IRGM group and Lenti‐HK control, respectively. Results showed that A172 cells transfected with Lenti‐IRGM lentivirus had reduced IRGM expression compared to the control group. Importantly, IRGM knock‐down A172 cells led to decreased CD206 positive cells and IL‐8 expression (Figure 3A–C).

Figure 3.

Figure 3

IRGM up‐regulated M2 macrophage proportion and IL‐8 expression in glioma mice model. Glioma frozen sections from Lenti‐IRGM and Lenti‐HK control mice were used to perform immunofluorescence assay 1 month after injection. (A–C) The expression of IRGM, CD206 and IL‐8 was displayed between Lenti‐IRGM group and Lenti‐HK control, respectively. Results showed that A172 cells transfected with Lenti‐IRGM had reduced IRGM, CD206 positive cells and IL‐8 expression compared to Lenti‐HK control. Magnification: ×400; scale bar: 50 μm. Experiments were performed in three independent experiments.

IRGM promotes IL‐8 release and cocultured M2 cells polarization in vitro

Whether IRGM has an effect on M2 macrophages polarization from primary macrophages was explored using coculture of THP‐1 cells and either Lenti‐IRGM or Lenti‐HK control glioma cells. Flow cytometry results indicated that knockdown of IRGM reduced macrophage polarization into M2 macrophage (CD11b+ CD206+) among cocultured macrophages (Figures 4A and 4B). These data suggested glioma cells‐derived IRGM could have an effect on M2 macrophages polarization in glioma microenvironment. To explain the cause of IRGM regulating M2 macrophage polarization, we speculated IRGM might promote M2 macrophage accumulation and polarization via regulating cytokines and chemokines production. MILLIPLEX® MAP results showed that IRGM knockdown reduced IL‐8 and MIP‐3α, but promoted IL‐6 production (Figure 4C–E). Further, we verified IL‐8 protein level change after IRGM knock down, and immunofluorescence assay displayed that Lenti‐IRGM had less IL‐8 protein than Lenti‐HK control (Figure 4F). Based on previous research and these results (Figure 3C), we speculated IRGM could promote M2 polarization through cytokine IL‐8 that influences the expression of M2 macrophage polarization‐associated genes, while MIP‐3α could recruit macrophage into glioma before polarization. IL‐6 is an interleukin that acts as a pro‐inflammatory cytokine or an anti‐inflammatory myokine (Sansone et al., 2007; Fisher et al., 2011). As shown in Figure 4E, IRGM inhibited IL‐6 excessive production, suggesting the suppression of IRGM on M1 macrophage.

Figure 4.

Figure 4

Glioma cells‐derived IRGM promotes cocultured M2 cells polarization in vitro. (A and B) M2 macrophage polarization was analyzed after coculture of THP‐1 and IRGM knockdown A172 cells using flow cytometry. (C–E) The supernatant from IRGM knockdown A172 cells was collected, and the concentration of IL‐8, MIP‐3α, and IL‐6 was probed with MILLIPLEX® MAP. Results demonstrated IRGM promoted IL‐8 and MIP‐3α release, and inhibited IL‐6 production. (F) IL‐8 protein level between Lenti‐IRGM and Lent‐HK groups was further verified with immunofluorescence. Experiments were performed in three independent experiments. Data were calculated as Mean ± SEM; **P < 0.01, ***P < 0.001.

IRGM could regulate IL‐8 and MIP‐3α through p62/TRAF6/ NF‐κB pathway

p62/SQSTM1 is identified as a autophagy receptor, and also plays a role in some tumors (Duran et al., 2008; Lamark et al., 2017). TRAF6 is required for inhibitor of IκB kinase (IKK) phosphorylation, subsequent polyubiquitination and proteasome‐mediated degradation of IκBα as an E3 ubiquitin ligase (Chen, 2005; Kawai and Akira, 2007). Moreover, TRAF6 could stimulate IL‐8 production from human proximal tubule cells (Li and Nord, 2002). Interestingly, p62 interacts with TRAF6, causing TRAF6 autoubiquitination and NF‐κB activation (Kim and Ozato, 2009). NF‐κB pathway mediates M2 macrophages polarization in non‐small cell lung cancer, as well as the expression and secretion of IL‐8 and MIP‐3α (Ignacio et al., 2016; Wei et al., 2017; Chishti et al., 2018).

To further investigate the mechanism of IRGM influencing cytokines production and M2 cell polarization, we examined the change of p62/TRAF6/NF‐κB pathway in IRGM knock‐down A172 cell line. As shown in Figure 5A–D, knockdown of IRGM significantly reduced both p62 and TRAF6 protein level. Based on previous studies, we supposed p62/TRAF6 of glioma cell could influence M2 macrophages polarization, cytokines and chemokines production through activating NF‐κB in glioma microenvironment. Lastly, we found nuclear localization of NF‐κB p65 decreased in Lenti‐IRGM compared with Lenti‐HK (Figure 5E). Moreover, knockdown of IRGM significantly inhibited mRNA expression of IRGM, p62, as well as NF‐κB downstream cytokines IL‐8 and MIP‐3α (Figure 5F), which suggesting the impact of IRGM on p62 and downstream NF‐κB. Therefore, the influence of IRGM on IL‐8 and further macrophages polarization could be mediated through regulating p62/TRAF6/NF‐κB pathway.

Discussion

Although CAR‐T treatment brings us a great hope, application in solid tumors has a long way and some limits (O'Rourke et al., 2017). Immunosuppressive microenvironment is the key factor influencing treatment effects. However, the formation mechanism of immunosuppressive microenvironment is unclear. Previous study has found that M2 macrophages and Treg cells are main immunosuppressive cells, in particular macrophages accounting for about 1/3 of total tumor cells (Watters et al., 2005; Kettenmann et al., 2011). On another hand, cytokines and chemokines are important mediators to transmit information between tumor cells and immunocytes during tumor pathogenesis and development. Some tumor cells‐derived cytokines and chemokines can promote M2 macrophages polarization, and M2 macrophages enhance tumor growth, angiogenesis and immunosuppressive microenvironment formation in return (Hussain et al., 2006; Hambardzumyan et al., 2016).

Attractively, IRGM maybe a cross point between immunity and tumor because IRGM participates in chronic infectious diseases and inflammatory bowel diseases besides melanoma (Song et al., 2014; Dong et al., 2015; Iida et al., 2017; Wang et al., 2017). Based on the high expression of IRGM in glioma (Figures 1A and 1B), we supposed that IRGM regulated the formation of glioma immune microenvironment by influencing M2 GAM polarization. Although other experimental system found the role of IRGM in M1 macrophage polarization during autoimmune disease (Xu et al., 2017), high IRGM expression is less likely related to M1 macrophage polarization because M2 macrophage phenotype are predominant among tumor immune microenvironment. On another hand, differences of signal pathway activation between tumor cells and macrophage may lead to different function of IRGM, which will be studied in our future work. We firstly displayed the expression relevance of IRGM and M2 macrophage marker CD206 in patients’ specimen (Figures 1C and 1D). Results above encouraged us to explore the role of IRGM in glioma development and M2 macrophages polarization in vivo by establishing glioma xenograft mice model using A172 cells, which revealed that IRGM could up‐regulate CD206 positive M2 macrophage and IL‐8 production in vivo (Figure 3). This point was also confirmed in vitro by analyzing the changes of IL‐8 concentration and M2 macrophages proportion after coculture with IRGM knock‐down glioma cells (Figure 4).

Interestingly, IRGM also promotes MIP‐3α release and inhibited IL‐6 release (Figure 4D and 4E). The chemokine MIP‐3α has not reported a role in M2 macrophage polarization, while MIP‐3α could influence tumor growth by inducing macrophage recruitment as a chemokine (Jayaraman et al., 2018), which suggested IRGM could recruit macrophage into glioma by releasing MIP‐3α. We speculate both IL‐8 and MIP‐3α play key roles in glioma immune suppressive microenvironment formation. During this process MIP‐3α might recruit macrophages into glioma from normal brain tissue or blood, followed by IL‐8 inducing polarization. It is worth discussing that IRGM inhibited the release of IL‐6 (Figure 4E). IL‐6 sustains a pro‐tumor milieu by supporting angiogenesis and tumor escape from immune surveillance within the complex tumor microenvironment (Sansone et al., 2007). However, a lesser known role for IL‐6 signaling is opposing tumor growth by mobilizing anti‐tumor T cell immune responses to attain tumor control (Chishti et al., 2018). Thus IRGM may also suppress influence adaptive immune response through reducing IL‐6 production. Our results indicated IRGM could be a reliable target to suppress glioma growth by remolding microenvironment.

Although IRGM has been reported to involve in immune response and tumor pathogenesis, deep signal pathway of IRGM about immunity and inflammation in tumor cells is unclear. Based on previous study, IRGM as autophagy protein strongly regulates autophagy (Cadwell, 2016). Consistently, Western blot and realtime PCR results of IRGM knockdown cell line showed that IRGM promoted autophagy receptor p62 expression (Figures 5A, 5C, and 5F). Whereas p62 interacts with TRAF6, causing TRAF6 autoubiquitination and NF‐κB activation (Kim and Ozato, 2009). Further studies showed that IRGM not only up‐regulated TRAF6 expression, but also promoted NF‐κB transfer to nuclei (Figure 5E). Combining the contribution of IRGM in expression and release of IL‐8 and MIP‐3α (Figures 4C–F and 5F) and the reports that IL‐8 and MIP‐3α are regulated by NF‐κB (Ignacio et al., 2016; Wei et al., 2017; Chishti et al., 2018), our data suggested the potential role of IRGM in IL‐8 and MIP‐3α production and further M2 macrophage polarization could be mediated by p62/TRAF6/NF‐κB pathway.

Conclusions

In the present study, we showed the ability of IRGM protein to regulate M2 macrophage polarization in human glioma tissue, in vivo mice model, and in vitro glioma cell lines. Moreover, IRGM significantly influenced IL‐8, MIP‐3α, and IL‐6 production, which is closely related to M2 macrophage polarization and recruitment. We further found the obvious impact of IRGM on p62/TRAF6/NF‐κB pathway, by which IRGM to regulate IL‐8 production and further M2 polarization. Our data suggested glioma cells‐derived IRGM could regulate IL‐8 production and further M2 cells polarization through p62/TRAF6/NF‐κB pathway. We believe our study on IRGM will foster better understanding of glioma pathogenesis and provide a new strategy for eliminating glioma by combining IRGM targeting and immunological cytotherapy.

Conflict of interest

The authors declare no conflict of interest.

Acknowledgments and funding

This project was supported by national natural science foundation of China (81801612, 81772685), scientific research project of Shenzhen Health Planning System (SZBC2018014), china postdoctoral science foundation (2018M633242, 2017M622881), Research Fund from Shenzhen Key Laboratory of Neurosurgery (ZDSYS20140509173142601), the international cooperation research projects of Shenzhen Science and Technology Program (GJHZ20160301163419476, GJHZ20160301163900284), basic research projects of Shenzhen Science and Technology Program (JCYJ20170413173149177, JCYJ20170817171930009, and JCYJ20170306090714854), Health and Family Planning Commission of Guangdong Province (A2018116) and Shenzhen Development and Reform Commission's Stroke Screening and Prevention Public Service Platform improving program.

Yanwen Xu, Chuanpeng Liao, and Renli Liu contributed equally to this work.

Contributor Information

Wenlan Liu, Email: wlliu@szu.edu.cn.

Weiping Li, Email: wpli@szu.edu.cn.

References

  1. Cadwell K (2016) Crosstalk between autophagy and inflammatory signalling pathways: balancing defence and homeostasis. Nat Rev Immunol 16: 661–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Chen ZJ (2005) Ubiquitin signalling in the NF‐kappaB pathway. Nat Cell Biol 7: 758–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chishti AA, Baumstark‐Khan C, Koch K, Kolanus W, Feles S, Konda B, Azhar A, Spitta LF, Henschenmacher B, Diegeler S, Schmitz C, Hellweg CE (2018) Linear energy transfer modulates radiation‐induced and expression of its downstream target genes. Radiat Res 189: 354–70. [DOI] [PubMed] [Google Scholar]
  4. Dong H, Tian L, Li R, Pei C, Fu Y, Dong X, Xia F, Wang C, Li W, Guo X, Gu C, Li B, Liu A, Ren H, Wang C, Xu H (2015) IFNg‐induced Irgm1 promotes tumorigenesis of melanoma via dual regulation of apoptosis and Bif‐1‐dependent autophagy. Oncogene 34: 5363–71. [DOI] [PubMed] [Google Scholar]
  5. Duran A, Linares JF, Galvez AS, Wikenheiser K, Flores JM, Diaz‐Meco MT, Moscat J (2008) The signaling adaptor p62 is an important NF‐kappaB mediator in tumorigenesis. Cancer Cell 13: 343–54. [DOI] [PubMed] [Google Scholar]
  6. Fisher DT, Chen Q, Skitzki JJ, Muhitch JB, Zhou L, Appenheimer MM, Vardam TD, Weis EL, Passanese J, Wang WC, Gollnick SO, Dewhirst MW, Rose‐John S, Repasky EA, Baumann H, Evans SS (2011) IL‐6 trans‐signaling licenses mouse and human tumor microvascular gateways for trafficking of cytotoxic T cells. J Clin Invest 121: 3846–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gabrusiewicz K, Ellert‐Miklaszewska A, Lipko M, Sielska M, Frankowska M, Kaminska B (2011) Characteristics of the alternative phenotype of microglia/macrophages and its modulation in experimental gliomas. PLoS ONE 6: e23902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hambardzumyan D, Gutmann DH, Kettenmann H (2016) The role of microglia and macrophages in glioma maintenance and progression. Nat Neurosci 19: 20–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hussain SF, Yang D, Suki D, Aldape K, Grimm E, Heimberger AB (2006) The role of human glioma‐infiltrating microglia/macrophages in mediating antitumor immune responses. Neuro Oncol 8: 261–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ignacio RM, Kabir SM, Lee ES, Adunyah SE, Son DS (2016) NF‐κB‐Mediated CCL20 Reigns Dominantly in CXCR2‐Driven Ovarian Cancer Progression. PLoS ONE 11(10): e0164189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Iida T, Onodera K, Nakase H (2017) Role of autophagy in the pathogenesis of inflammatory bowel disease. World J Gastroenterol 23: 1944–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jayaraman S, Doucet M, Kominsky SL (2018) CITED2 attenuates macrophage recruitment concordant with the downregulation of CCL20 in breast cancer cells. Oncol Lett 15(1): 871–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kawai T, Akira S (2007) Signaling to NF‐kappaB by toll‐like receptors. Trends Mol Med 13: 460–69. [DOI] [PubMed] [Google Scholar]
  14. Kettenmann H, Hanisch UK, Noda M, Verkhratsky A (2011) Physiology of microglia. Physiol Rev 91: 461–553. [DOI] [PubMed] [Google Scholar]
  15. Kim JY, Ozato K (2009) The Sequestosome 1/p62 attenuates cytokine gene expression in activated macrophages by inhibiting IFN regulatory factor 8 and TNF receptor‐associated factor 6/NF‐κB activity. J Immunol 182: 2131–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kim BH, Shenoy AR, Kumar P, Bradfield CJ, MacMicking JD (2012) IFN‐inducible GTPases in host cell defense. Cell Host Microbe 12: 432–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lamark R, Svenning S, Johansen T (2017) Regulation of selective autophagy: the p62/SQSTM1 paradigm. Essays Biochem 61: 609–24. [DOI] [PubMed] [Google Scholar]
  18. Li H, Nord EP (2002) CD40 ligation stimulates MCP‐1 and IL‐8 production. TRAF6 recruitment, and MAPK activation in proximal tubule cells. Am J Physiol Renal Physiol 282: 1020–33. [DOI] [PubMed] [Google Scholar]
  19. Li K, Wei L, Huang Y, Wu Y, Su M, Pang X, Wang N, Ji F, Zhong C, Chen T (2016) Leptin promotes breast cancer cell migration and invasion via IL‐18 expression and secretion. Int J Oncol 48(6): 2479–87. [DOI] [PubMed] [Google Scholar]
  20. O'Rourke DM, Nasrallah MP, Desai A, Melenhorst JJ, Mansfield K, Morrissette JJD, Martinez‐Lage M, Brem S, Maloney E, Shen A, Isaacs R, Mohan S, Plesa G, Lacey SF, Navenot JM, Zheng Z, Levine BL, Okada H, June CH, Brogdon JL, Maus MV (2017) A single dose of peripherally infused EGFRvIII‐directed CAR T cells mediates antigen loss and induces adaptive resistance in patients with recurrent glioblastoma. Sci Transl Med 9: 399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Reardon DA, Mitchell DA (2017) The development of dendritic cell vaccine‐based immunotherapies for glioblastoma. Semin Immunopathol 39: 225–39. [DOI] [PubMed] [Google Scholar]
  22. Sansone P, Storci G, Tavolari S, Guarnieri T, Giovannini C, Taffurelli M, Ceccarelli C, Santini D, Paterini P, Marcu KB, Chieco P, Bonafè M (2007) IL‐6 triggers malignant features in mammospheres from human ductal breast carcinoma and normal mammary gland. J Clin Invest 117: 3988–4002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Song JH, Kim SY, Chung KS, Moon CM, Kim SW, Kim EY, Jung JY, Park MS, Kim YS, Kim SK, Chang J, Shin DJ, Kang YA (2014) Association between genetic variants in the IRGM gene and tuberculosis in a Korean population. Infection 42: 655–60. [DOI] [PubMed] [Google Scholar]
  24. Stupp R, Hegi ME, Mason WP, van den Bent MJ, Taphoorn MJ, Janzer RC, Ludwin SK, Allgeier A, Fisher B, Belanger K, Hau P, Brandes AA, Gijtenbeek J, Marosi C, Vecht CJ, Mokhtari K, Wesseling P, Villa S, Eisenhauer E, Gorlia T, Weller M, Lacombe D, Cairncross JG, Mirimanoff RO (2009) Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5‐year analysis of the EORTC‐NCIC trial. Lancet Oncol 10: 70025–27. [DOI] [PubMed] [Google Scholar]
  25. Szulzewsky F, Pelz A, Feng X, Synowitz M, Markovic D, Langmann T, Holtman IR, Wang X, Eggen BJ, Boddeke HW, Hambardzumyan D, Wolf SA, Kettenmann H (2015) Glioma‐associated microglia/macrophages display an expression profile different from M1 and M2 polarization and highly express Gpnmb and Spp1. PLoS ONE 10: e0116644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Wang LL, Jin XH, Cai MY, Li HG, Chen JW, Wang FW, Wang CY, Hu WW, Liu F, Xie D (2017) AGBL2 promotes cancer cell growth through IRGM‐regulated autophagy and enhanced Aurora A activity in hepatocellular carcinoma. Cancer Lett 414: 71–80. [DOI] [PubMed] [Google Scholar]
  27. Watters JJ, Schartner JM, Badie B (2005) Microglia function in brain tumors. J Neurosci Res 81: 447–55. [DOI] [PubMed] [Google Scholar]
  28. Wei X, Nie S, Liu H, Sun J, Liu J, Li J, Li S, Wang S, Han S, Wang J, Sun Y (2017) Angiopoietin‐like protein 2 facilitates non‐small cell lung cancer progression by promoting the polarization of M2 tumor‐associated macrophages. Am J Cancer Res 7: 2220–33. [PMC free article] [PubMed] [Google Scholar]
  29. Xiao P, Long X, Zhang L, Ye Y, Guo J, Liu P, Zhang R, Ning J, Yu W, Wei F, Yu J (2018) Neurotensin/IL‐8 pathway orchestrates local inflammatory response and tumor invasion by inducing M2 polarization of Tumor‐Associated macrophages and epithelial‐mesenchymal transition of hepatocellular carcinoma cells. Oncoimmunology 7(7): e1440166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Xu Y, He Z, Li Z, Fang S, Zhang Y, Wan C, Ma Y, Lin P, Liu C, Wang G, Li R, Zhu J, Li Y, Mu L, Zhang Y, Wang J, Kong Q, Li H, Sun B (2017) Irgm1 is required for the inflammatory function of M1 macrophage in early experimental autoimmune encephalomyelitis. J Leukoc Biol 101: 507–17. [DOI] [PubMed] [Google Scholar]
  31. Zhai H, Heppner FL, Tsirka SE (2011) Microglia/macrophages promote glioma progression. Glia 59: 472–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhang J, Zhang S, Song Y, He M, Ren Q, Chen C, Liu Z, Zeng Y, Xu J (2017) Prognostic role of neutrophil lymphocyte ratio in patients with glioma. Oncotarget 8: 59217–24. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cell Biology International are provided here courtesy of Wiley

RESOURCES