Skip to main content
NCBI home page
Cell Communication and Signaling : CCS logoLink to Cell Communication and Signaling : CCS
. 2026 May 27;24:417. doi: 10.1186/s12964-026-02966-1

Neuronal tetraspanin TSP-6 suppresses intestinal innate immunity by modulating dense-core vesicle release in Caenorhabditis elegans

Yixin Li 1,#, Chidi Zhong 1,#, Wenhui Zhou 1, Yi Dou 1, Xiaowei Huang 1,✉
PMCID: PMC13397702  PMID: 42204575

Abstract

Immunomodulation plays a pivotal role in maintaining immune homeostasis, defending against pathogens, and regulating various biological processes. Tetraspanins (TSPs), a highly conserved transmembrane protein superfamily, are predominantly expressed on the surface of more than 50% of mammalian immune cells, where they critically control the immune responses. However, the underlying mechanisms by which TSPs modulate immunity remain poorly elucidated. Through a systematic screening of TSPs in Caenorhabditis elegans, it was found that knockdown or knockout of tsp-6 significantly enhanced innate immunity against Pseudomonas aeruginosa PA14 in the intestine. Moreover, tissue-specific rescue of tsp-6 in AWA neurons eliminated resistance to this pathogenic bacterium, a process dependent on UNC-31-mediated synaptic vesicle release. Our findings further supported that TSP-6 controlled innate immunity through the DAF-16/FOXO and p38 mitogen-activated protein kinase (MAPK) pathways. Collectively, our results have indicated that the tetraspanin TSP-6 in C. elegans regulates intestinal innate immune responses against P. aeruginosa PA14 through neuronal modulation, suggesting a novel mechanism by which tetraspanins contribute to neuro-immune crosstalk.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12964-026-02966-1.

Keywords: Tetraspanin, Innate immunity, Neuroimmune regulation, p38/PMK-1 pathway, DAF-16/FOXO pathway

Introduction

Innate immunity, an evolutionarily ancient and essential form of immune response, serves as the primary defense mechanism against pathogens in organisms [1]. Across animal taxa, maintenance of immune homeostasis is critical under normal physiological conditions owing to its dualistic nature: excessive immunosuppression increases host susceptibility to a broad spectrum of pathogens, whereas hyperactivation of the immune response may elicit chronic inflammatory states or sustained stress reactions [2–4]. Consequently, the development of intricate molecular regulatory networks is necessary to dynamically coordinate immune activation and suppression.

Tetraspanin proteins, a highly conserved family of transmembrane molecules ubiquitously present across most organisms, are widely recognized as “master organizers” of the plasma membrane and molecular facilitators [5, 6]. These proteins assemble into specialized tetraspanin-enriched microdomains (TEMs) [7, 8], which functionally diversify through their four-transmembrane domain structure to organize immunoreceptors, enzymes, and signaling molecules within a network of tetraspanin interactions [9–11]. These proteins have been implicated in key cellular processes, including cellular adhesion and migration [12], ligand binding [13], and intracellular trafficking [14], thereby regulating cellular signal transduction, development, and immune responses [15]. Among the 33 known tetraspanins in mammals, over half are expressed on the surface of immune cells and play essential roles in host defense against viral, bacterial, and protozoan infections [9, 16]. Moreover, tetraspanin proteins possess a structural framework that enables the transmission of immune signals. For example, CD81 deficiency results in defective B-cell function [17]. In contrast, deficiency in certain tetraspanins, such as CD53, has been shown to impair immune defense and lead to recurrent pathogen infections [18]. Nevertheless, the precise mechanisms by which most tetraspanins regulate the immune system remain to be fully elucidated.

The complexity of anatomical structures and signaling networks in mammals has posed significant challenges to the investigation of molecular mechanisms underlying systemic immune regulation. In contrast, Caenorhabditis elegans, a well-established model organism with a highly conserved genome relative to mammals and a fully mapped cell lineage atlas, thrives in natural environments rich in organic matter, such as decaying plant material [19, 20]. The high microbial abundance in this habitat provides a food source but also exposes the nematode to potential pathogens, thereby driving the evolution of effective defense mechanisms against bacterial infection [21, 22]. Like most animals, C. elegans exhibits immune suppression under certain conditions, and substantial experimental evidence demonstrates that such suppression can facilitate pathogen invasion [23, 24]. Conversely, an overactive immune response may compromise feeding and digestive functions [25, 26]. Therefore, the ability of C. elegans to maintain immune homeostasis makes it an ideal model organism for studying the regulatory mechanism of innate immunity balance.

In the present study, we identified a novel function of TSP-6, a tetraspanin protein, in regulating innate immunity of C. elegans. Knockdown or mutation of tsp-6 activated both the DAF-16 and p38 mitogen-activated protein kinase (MAPK) pathways, leading to accelerated clearance of intestinal pathogens and enhanced resistance to bacterial infections. Fluorescence labeling and reporter gene assays further demonstrated that neuronal localization of TSP-6 was indispensable for the regulation of intestinal immunity. To elucidate the mechanism of signal transmission from the nervous system to the gut, we found that this process relied on the release of unc-31-mediated dense-core vesicles (DCVs).

Results

Tetraspanin proteins in C. elegans play a role in innate immunity.

To investigate the involvement of the tetraspanin protein family in innate immune responses upon pathogen infection, a phylogenetic tree comprising 21 tetraspanin proteins of C. elegans was first constructed (Fig. 1A), and one representative member from each clade was selected for functional analysis. RNA interference was employed to knock down the expression of these selected genes [27], followed by assessment of nematode survival upon infection with the human opportunistic pathogen Pseudomonas aeruginosa PA14 (Fig. 1B). Systematic RNAi screening revealed variable effects on survival when worms were exposed to a full lawn of P. aeruginosa PA14 (Fig. S1). Specifically, knockdown of tsp-3, tsp-11, tsp-17, and tsp-18 had minimal impact on the nematode’s resistance to this pathogen (Fig. S1A, E, F and H), whereas silencing of tsp-7, tsp-8, tsp-9, and tsp-15 resulted in increased susceptibility (Fig. S1B, C, D and G). Notably, knockdown of tsp-6 significantly enhanced survival, indicating that the tetraspanin protein encoded by tsp-6 acts as a negative regulator of innate immunity in C. elegans (Fig. 1C). To further validate these findings, we generated a tsp-6 null mutant using CRISPR-Cas9-mediated gene knockout (Fig. S2), and the phenotype of the tsp-6(ko) mutant was consistent with the RNAi results (Fig. 1D).

Fig. 1.

Fig. 1

Open in a new tab

Deficiency in TSP-6 enhances the resistance of C. elegans to P. aeruginosa PA14 infection. A A phylogenetic tree was constructed based on the protein sequences of tetraspanins from C. elegans and Homo sapiens. Multiple sequence alignment was performed using MAFFT, and the maximum-likelihood tree was inferred with RAxML under the LG + G model. B Schematic representation of the C. elegans survival assay following infection with P. aeruginosa PA14. C Survival curves of animals fed RNAi bacteria targeting tsp-6 following exposure to P. aeruginosa PA14. D Survival of Cas9-mediated tetraspanin-knockout animals after exposure to P. aeruginosa PA14. The data represent the results of three independent experiments, with n ≥ 200 worms used per replicate. **P < 0.01; n.s., not significant

TSP-6 suppresses intestinal innate immunity against the pathogen P. aeruginosa PA14

To further elucidate the molecular mechanisms underlying tetraspanin involvement in innate immunity, we selected tsp-6, the most prominent tetraspanin gene identified as a negative regulator of immune responses, for detailed characterization. We first observed that the resistance phenotype conferred by tsp-6 mutation during pathogen infection was reversed when tsp-6 expression was restored (Fig. 2A). Moreover, no difference in survival was obtained between wild-type and tsp-6 mutant animals fed heat-killed P. aeruginosa PA14, indicating that loss of tsp-6 specifically modulates the immune response to live pathogenic bacteria without affecting the baseline lifespan of C. elegans (Fig. 2B). To investigate whether tsp-6 mutations affect the accumulation of pathogenic bacteria in the intestine, we labeled P. aeruginosa PA14 with red fluorescent protein mCherry and repeated the infection assay. Our results showed that the tsp-6 mutant exhibited significantly reduced intestinal accumulation of mCherry-labeled P. aeruginosa PA14 compared to wild-type animals (Fig. 2C upper panel and 2D). Furthermore, the bacterial load of P. aeruginosa PA14 within the nematodes, as quantified by CFU assay, was markedly lower in the tsp-6 mutant relative to wild-type controls (Fig. 2E). As a non-pathogenic control, we performed parallel assays using mCherry-labeled E. coli OP50. In contrast to the results observed with P. aeruginosa PA14, neither fluorescence-based intestinal quantification (Fig. 2C lower panel and 2D) nor CFU enumeration (Fig. 2E) revealed any significant differences in E. coli OP50 colonization between tsp-6 mutants and wild-type animals. Importantly, the tsp-6 mutant displayed no defects in pathogen avoidance behavior (Fig. 2F), pharyngeal pumping rate (Fig. 2G), or defecation cycle at the posterior region (Fig. 2H).

Fig. 2.

Fig. 2

Open in a new tab

The enhanced innate immunity caused by tsp-6 deficiency contributes to the increased survival rate of nematodes against pathogenic bacteria. A Survival curves of wild-type, tsp-6(ko), and tsp-6(ko) mutant worms with tsp-6 rescue following exposure to Gram-negative P. aeruginosa PA14. The data represent the results of three independent experiments, with n ≥ 200 worms used per replicate. B Survival of wild-type and tsp-6(ko) worms fed with heat-killed P. aeruginosa PA14. The data represent the results of three independent experiments, with n ≥ 200 worms used per replicate. C and D Representative fluorescence images and quantitative analysis of intestinal fluorescence intensity in wild-type and tsp-6(ko) nematodes after 24-hour exposure to mCherry-labeled P. aeruginosa PA14 or the control strain, mCherry-labeled E. coli OP50. Intestinal fluorescence intensity was quantified from ≥ 30 worms per condition across three independent biological replicates. Scale bar: 100 μm. E Quantitative analysis of colony-forming units (CFU) in wild-type and tsp-6(ko) worms infected with P. aeruginosa PA14 and E. coli OP50. Data are from three independent experiments. F Avoidance behavior of wild-type and tsp-6(ko) worms in response to P. aeruginosa PA14. The data represent the results of three independent experiments, with n ≥ 200 worms used per replicate. G Pharyngeal pumping rate of wild-type and tsp-6(ko) animals. Data were analyzed from n = 30 worms. H Defecation cycle interval, measured as the time between consecutive enteric muscle contractions, in wild-type and tsp-6(ko) worms. Data were analyzed from n = 30 worms. ***P < 0.001, ****P < 0.0001; n.s., not significant

To determine whether the immune defense defect resulting from tsp-6 mutation is specific to Gram-negative P. aeruginosa infection, we exposed worms to the Gram-positive pathogen Staphylococcus aureus, a well-established bacterial pathogen capable of killing C. elegans. It was shown that tsp-6 mutant animals also exhibited enhanced resistance to S. aureus (Fig. S3), suggesting that tsp-6 functions as a suppressor of broad-spectrum innate immunity in C. elegans.

TSP-6 located in AWA neurons participates in immune modulation in a non-cell-autonomous manner

To investigate the role of TSP-6 in the immune response of C. elegans, a Ptsp-6::tsp-6::gfp reporter was employed to analyze its expression pattern. TSP-6 was predominantly expressed in the nervous system (Fig. 3A), suggesting a potential neuro-immune regulatory function. To test this hypothesis, neuron-specific rescue of tsp-6 was achieved in tsp-6 mutant using a Punc-119::tsp-6::gfp construct driven by the unc-119 promoter (Fig. 3B). Notably, the enhanced resistance to P. aeruginosa PA14 infection observed in the tsp-6 mutant was nearly abolished upon neuronal re-expression of tsp-6 (Fig. 3C).

Fig. 3.

Fig. 3

Open in a new tab

TSP-6 regulates immune response through the nervous system. A Representative images of GFP expression driven by the tsp-6 promoter (Ptsp-6::tsp-6::gfp), showing that tsp-6 is predominantly expressed in the nervous system. Scale bar: 100 μm, 40 μm in the inset. B Neuron-specific complementation of tsp-6 expression driven by the unc-119 promoter in the tsp-6(ko) mutant background. Scale bar: 100 μm, 40 μm in the inset. C Survival curves of wild-type, tsp-6(ko), and tsp-6(ko);[Punc-119::tsp-6::gfp] worms following exposure to P. aeruginosa PA14. D Intestine-specific rescue of tsp-6 in the tsp-6(ko) mutant background, driven by the vha-6 promoter. The myo-3 promoter drives expression predominantly in body wall muscle cells and serves as a morphological reference to delineate nematode anatomy. Scale bar: 50 μm. E Survival analysis of MGH171, a gut-restricted RNAi-sensitive strain, after treatment with tsp-6 RNAi and subsequent exposure to P. aeruginosa PA14. The data represent the results of three independent experiments, with n ≥ 200 worms used per replicate. ***P < 0.001, ****P < 0.0001; n.s., not significant

Given that the intestine serves as a central site for innate immunity in C. elegans and that occasional intestinal expression of Ptsp-6::tsp-6::gfp was detected in this study, we assessed the effect of intestine-specific restoration of tsp-6 on susceptibility to P. aeruginosa PA14 infection. However, intestine-specific rescue of tsp-6 under the control of vha-6 promoter led to developmental arrest at the L2 larval stage (Fig. 3D). To evaluate the cell-autonomous contribution of intestinal tsp-6 to immune regulation, we conducted tissue-restricted RNAi knockdown using the gut-sensitive RNAi strain MGH171. This approach yielded no significant alteration in survival upon P. aeruginosa PA14 infection relative to control RNAi-treated wild-type animals (Fig. 3E). Thus, although intestine-specific genetic rescue could not be assessed due to lethality, the absence of a susceptibility phenotype following intestinal-restricted RNAi indicates that intestinal tsp-6 is dispensable for modulation of anti-pathogen defense under these experimental conditions. Collectively, these findings confirm that neuronal TSP-6 functions as the primary regulator of innate immunity in C. elegans.

To investigate the neuronal expression pattern of tsp-6 and its potential role in immune regulation, we compared the localization of Ptsp-6::gfp with the neural atlas available on WormBase (www.wormbase.org) to infer expression in specific neuron types, including AWA, ADF, ASE, and AFD neurons. Subsequently, cell-specific promoters were used to drive red fluorescent protein expression for individual labeling of these neurons: AWA (Podr-10::mCherry), ADF (Ptph-1::mCherry), ASE (Pgcy-5::mCherry), and AFD (Pgcy-8::mCherry). These fluorescent markers were co-imaged with Ptsp-6::gfp to assess tsp-6 expression in each neuron type. Based on colocalization and fluorescence correlation analysis, tsp-6 showed predominant expression in two pairs of sensory neurons, including AWA and ADF, during infection with P. aeruginosa PA14 (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

TSP-6 is expressed in two pairs of neurons, AWA and ADF, during P. aeruginosa PA14 infection. Co-localization analysis of ptsp-6::gfp in AWA (A), ADF (B), ASE (C), and AFD (D), respectively. Scale bar: 50 μm. Orange arrowheads indicate neurons co-localized with TSP-6, specifically AWA and ADF neurons. The white line marks the region used for fluorescence correlation analysis

To dissect the relative contributions of AWA and ADF neurons to TSP-6-dependent immune regulation, we performed neuron-specific genetic rescue by expressing tsp-6 under the control of the AWA-selective odr-10 promoter in the tsp-6(ko) mutant background (Fig. 5A upper panel). This AWA-targeted reconstitution fully restored wild-type levels of susceptibility to P. aeruginosa PA14 infection, effectively rescuing the hyperresistant phenotype observed in tsp-6(ko) animals (Fig. 5B). In parallel, we conducted analogous rescue in ADF neurons using the ADF-specific tph-1 promoter (Fig. 5A lower panel). However, this intervention failed to suppress the enhanced pathogen resistance of tsp-6(ko) mutants (Fig. 5C), suggesting that tsp-6 function in AWA neurons should be necessary and sufficient to mediate its role in modulating innate immunity.

Fig. 5.

Fig. 5

Open in a new tab

AWA neurons play a predominant role in TSP-6–dependent immune regulation. A Representative fluorescence micrographs showing neuron-specific rescue of tsp-6 expression: upper panel, AWA-selective rescue driven by the odr-10 promoter; lower panel, ADF-selective rescue driven by the tph-1 promoter. Orange arrowheads indicate the targeted neuronal cell bodies of AWA or ADF, respectively. Scale bar: 100 μm. B Survival curves of wild-type, tsp-6(ko), and tsp-6(ko); [Podr-10::tsp-6::gfp] worms following exposure to P. aeruginosa PA14. C Survival curves of wild-type, tsp-6(ko), and tsp-6(ko); [Ptph-1::tsp-6::mCherry] worms following exposure to P. aeruginosa PA14. The data represent the results of three independent experiments, with n ≥ 200 worms used per replicate. *P < 0.05, **P < 0.01; n.s., not significant

TSP-6 modulates the intestinal innate immunity dependent on UNC-31-mediated dense-core vesicles (DCVs)

Neuronal secretion of signaling molecules occurs primarily via two distinct types of vesicles: dense-core vesicles (DCVs) and small clear vesicles (SCVs), whose release is mediated by unc-31 and unc-13, respectively [28]. To determine whether tsp-6 controls gut immunity through one of these pathways, immune phenotypes were examined in relevant genetic backgrounds. Notably, mutation of tsp-6 led to significant upregulation of unc-13 and unc-31 mRNA levels, suggesting a potential enhancement in the capacity for both DCV and SCV release (Fig. 6A). To investigate whether tsp-6–mediated immune regulation depends on DCV and/or SCV exocytosis, we disrupted genes essential for these pathways—specifically unc-31 (required for DCV release) and unc-13 (required for SCV release)—in the tsp-6 mutant background. Knockdown of unc-31 under normal conditions reduced susceptibility to the pathogenic bacterium P. aeruginosa PA14. Moreover, it reversed the enhanced pathogen resistance observed in tsp-6 mutants, indicating that the activation of innate immunity upon loss of tsp-6 is dependent on UNC-31-mediated DCV release (Fig. 6C). In contrast, knockdown of unc-13 increased nematode resistance to pathogens under normal conditions and had minimal effect on the heightened innate immunity caused by tsp-6 mutation, suggesting that unc-13–dependent SCV exocytosis normally acts to suppress immune activation (Fig. 6B).

Fig. 6.

Fig. 6

Open in a new tab

TSP-6 suppresses innate immunity through dense-core vesicles (DCVs) but not small clear vesicles (SCVs). A Quantitative RT-PCR analysis of unc-13 and unc-31 expression levels in wild-type and tsp-6(ko) worms fed on E. coli OP50. B Survival curves of wild-type and tsp-6(ko) worms treated with control or unc-13 RNAi (a gene essential for SCV exocytosis) following exposure to P. aeruginosa PA14. C Survival curves of wild-type and tsp-6(ko) worms treated with control or unc-31 RNAi (a gene essential for DCV exocytosis) following exposure to P. aeruginosa PA14. Data are representative of at least three independent experiments, with n ≥ 200 animals per condition. **P < 0.001, ***P < 0.0001; n.s., not significant

Involvement of DAF-16/FOXO and p38/PMK-1 pathways in TSP-6-mediated innate immunity

To investigate the molecular mechanisms by which tsp-6 regulates innate immunity, we assessed the involvement of three key signaling pathways—the p38/PMK-1 (mitogen-activated protein kinase) [29], DAF-16/FOXO [30], and DBL-1/TGF-β pathways [31]—in the intestinal innate immune response mediated by tsp-6 in C. elegans. We first examined mRNA levels of representative target genes associated with these pathways in tsp-6 mutants. Our results showed that transcript levels of DAF-16/FOXO target genes were consistently upregulated (Fig. 7A), while those of p38/PMK-1 targets were partially increased (Fig. 7B and Fig. S4). In contrast, no significant changes were observed in the expression of DBL-1/TGF-β pathway–related genes (Fig. S5). These findings suggest that tsp-6 modulates innate immunity in C. elegans primarily through the DAF-16/FOXO and p38/PMK-1 signaling pathways.

Fig. 7.

Fig. 7

Open in a new tab

TSP-6-mediated innate immunity is dependent on DAF-16 signaling. A Quantitative RT-PCR analysis of the expression levels of five DAF-16-dependent genes in wild-type and tsp-6(ko) worms fed on E. coli OP50. B Quantitative RT-PCR analysis of the expression levels of seven PMK-1–dependent genes in wild-type and tsp-6(ko) worms fed on E. coli OP50. C Survival curves of wild-type, tsp-6(ko), daf-16(mu86), and tsp-6(ko); daf-16(mu86) worms following exposure to P. aeruginosa PA14. Data are representative of at least three independent experiments, with n ≥ 200 animals per condition. D Representative fluorescence micrographs showing DAF-16aAM::GFP nuclear translocation following tsp-6 knockdown in C. elegans. Scale bar: 200 μm. E Quantification of DAF-16aAM::GFP nuclear accumulation in wild-type and tsp-6 RNAi worms. Data were analyzed from n ≥ 30 worms. *P < 0.05, ***P < 0.001, ****P < 0.0001; n.s., not significant

Next, we found that the enhanced resistance of tsp-6 mutant nematodes to P. aeruginosa PA14-mediated killing was strongly suppressed by a loss-of-function mutation in daf-16 (Fig. 7C), indicating that the immune enhancement conferred by tsp-6 mutation is mediated through the DAF-16/FOXO pathway. To validate this finding, and given that activated DAF-16 translocates to the nucleus in response to extracellular or cytoplasmic stimuli, we examined the subcellular localization of DAF-16 using DAF-16aAM::GFP, a genetically engineered variant of DAF-16 that is functional but cannot be sequestered in the cytosol, as a reporter [32]. Our data revealed three distinct status of DAF-16 localization: predominantly cytoplasmic, intermediate (partial nuclear), and predominantly nuclear accumulation were detectable in both wild-type and tsp-6 RNAi animals (Fig. S6). However, tsp-6 RNAi animals exhibited a significantly higher proportion of animals with nuclear-enriched DAF-16aAM::GFP (Fig. 7D-E), indicating that tsp-6 knockdown leads to persistent activation of DAF-16.

We further investigated the potential involvement of the p38/PMK-1 pathway in the enhancement of innate immunity conferred by tsp-6 mutation. We observed that the increased resistance of tsp-6 mutants to P. aeruginosa PA14–mediated killing was partially suppressed by RNAi targeting pmk-1 in the p38/PMK-1 pathway (Fig. 8A). Consistent with this, our results showed that phosphorylation of PMK-1 was elevated in tsp-6 mutants, whereas the total PMK-1 levels remained unchanged relative to wild-type worms (Fig. 8B-C). Additionally, we examined the expression of CLEC-85, a putative immune effector whose basal expression is known to be regulated by the p38/PMK-1 pathway, using a Pclec-85::gfp reporter [21]. A significant increase in green fluorescence was observed upon tsp-6 knockdown (Fig. 8D-E). Taken together, these findings indicate that tsp-6 negatively regulates innate immunity in C. elegans through both the DAF-16/FOXO and p38/PMK-1 signaling pathways.

Fig. 8.

Fig. 8

Open in a new tab

TSP-6-mediated innate immunity partially depends on the PMK-1 pathway. A Survival curves of wild-type and tsp-6(ko) worms, and of wild-type worms treated with control or pmk-1 RNAi vector, following exposure to P. aeruginosa PA14. Data are representative of at least three independent experiments, with n ≥ 200 animals per condition. B and C Representative image and quantification of PMK-1 phosphorylation levels in wild-type and tsp-6(ko) worms. D and E Representative images and relative fluorescence intensity of Pclec-85::gfp in wild-type and tsp-6 RNAi worms (Scale bar: 50 μm). Data were analyzed from n ≥ 30 worms. *P < 0.05, **P < 0.01, ***P < 0.001; n.s., not significant

Discussion

Although a diverse repertoire of tetraspanin proteins is expressed in C. elegans, the functional characterization of most remains incomplete. Among these, TSP-6 has been established as a specific marker of extracellular vesicles (EVs) secreted by ciliated neurons and has been implicated in the selective sorting of EV cargo [14]. Here, we uncover a previously uncharacterized immunoregulatory function of neuronal TSP-6: in AWA sensory neurons, TSP-6 acts as a negative regulator of innate immunity by suppressing UNC-31-dependent DCV exocytosis. This inhibition leads to attenuated activation of the DAF-16/FOXO and p38/MAPK (PMK-1) signaling pathways, thereby preventing excessive immune responses. As primary chemosensory neurons to detect pathogen-associated clues, AWA neurons mediate rapid pathogen avoidance behavior in C. elegans [33]. Importantly, their neuroendocrine output and behavioral responsiveness are dynamically modulated by prior pathogen exposure or experienceࣧprocesses that fine-tune individual survival fitness and shape population-level disease resistance strategies [34, 35]. Integrating our experimental findings with existing literature, we propose that TSP-6 in AWA neurons functions as a critical “signal gate”, coordinately regulating UNC-31-mediated neuropeptide secretion to couple sensory perception with immune regulation.

Previous studies have established the role of the nervous system in immune regulation [1, 21, 31, 36], but whether tetraspanins participate in neuro-immune regulation remained unclear. Tetraspanin family members are primarily known to function as “molecular platforms” in immune cells, where they regulate immune synapse formation [37], T cell activation (CD82) [38], antibody response (CD81) [17], immune cell migration (CD9/CD151) [39], and antigen presentation [40]. However, these roles have been largely restricted to intracellular signaling and intercellular interactions within the immune system itself. In contrast, the mechanism identified for TSP-6 suggests that tetraspanins can act as molecular bridges linking the nervous and immune systems, thereby revealing a novel role for this protein family in maintaining systemic and tissue-specific homeostasis.

In lower organisms such as nematodes, tetraspanins operate through the neuro-immune axis, potentially representing evolutionarily conserved mechanisms of immune regulation. In mammals, analogous pathways may remain underexplored. Our work indicates that certain tetraspanins—particularly those involved in neuronal signal transduction [41]—may similarly contribute to immune homeostasis in higher organisms. This discovery may offer new perspectives for the development of therapeutic targets for autoimmune diseases, chronic inflammation, and neuroimmune disorders, for example, by modulating tetraspanin-mediated neural circuits to achieve precise control over immune activity while minimizing the systemic side effects associated with conventional immunosuppressive therapies.

Overall, our findings has identified a novel neuroimmune regulator but, more importantly, reveal a new paradigm for regulating systemic immune homeostasis. This paradigm is based on the precision control of vesicle release by a neuronally expressed tetraspanin membrane protein, TSP-6. Our work thus offers mechanistic insight into how the nervous system quantitatively encodes and functionally transduces pathogen-derived sensory inputs into proportionate immune outputs during infection. Several limitations warrant acknowledgment. Although neuron-specific genetic rescue experiments demonstrate that AWA-localized TSP-6 is essential for inhibitory immune regulation, the specific neuropeptide or hormone packaged within DCVs that mediates this immunomodulatory effect remains to be identified. Nevertheless, these limitations do not diminish the conceptual advance represented by our study; rather, they underscore the broader relevance of tetraspanins as molecular interfaces coordinating neural activity with immune physiology.

Materials and methods

C. elegans and bacterial strains

The following C. elegans strains were obtained from the Caenorhabditis Genetics Center (CGC) and included the following: N2 was used as a reference wild type; the loss-of-function mutant daf-16(mu86); MGH171 used for gut-sensitive RNAi line; DAF-16aAM::GFP [daf-16p::daf-16a/b::gfp + rol-6(su1006)], a transgenic line expressing DAF-16 protein fused to GFP under its endogenous promoter; SAL146[clec-85p::gfp + pha-1(+)], a transgenic line expressing GFP under the control of clec-85 promoter as a reporter for p38/MAPK pathway activation.

The bacterial strains used in this study were E. coli OP50, E. coli HT115, and P. aeruginosa PA14. All the bacteria were grown in Luria-Bertani (LB) broth at 37 ℃and seeded on nematode growth medium (NGM) plates as the food source unless otherwise specified.

Plasmid construction

In brief, the recombinant plasmid was constructed using the In-Fusion cloning technique, with the target DNA segment amplified from the genomic DNA of wild-type N2. To analyze the function of a specific gene, expression or reporter vectors were generated using pPD95.75, and mutant vectors were developed using pPD162.

CRISPR-Cas9-mediated gene knockout

The single-guide RNA (sgRNA) sequence CAAGAATTCTCTGAATACGG, designed to target the second exon of the tsp-6 gene, was identified as a high-priority candidate for tsp-6 knockout using the CHOPCHOP online tool (https://chopchop.cbu.uib.no/results/7580aa7e-b6ff-4655-b868-9e135674f2dc/). This sgRNA sequence was cloned into the pPD162 plasmid vector, and the resulting recombinant construct was microinjected into the gonads of L4-stage C. elegans hermaphrodites at a concentration of 50 ng/µL. The PCFJ90 plasmid that expressed red fluorescent protein under a pharyngeal promote was co-injected as a visible marker for subsequent screening. F1 progeny displaying robust red fluorescence in the pharynx were isolated individually and allowed to self-fertilize. Genomic DNA was extracted from individual F2 worms, followed by locus-specific PCR amplification and sequencing to confirm targeted mutagenesis. Homozygous knockout lines exhibiting stable, germline-transmitted mutations were subsequently established and validated.

Survival assay of C. elegans

The slow-killing assay for P. aeruginosa PA14 infection in C. elegans was conducted according to established protocols [42]. Briefly, a single colony of P. aeruginosa PA14 was inoculated into 5 mL of LB broth and cultured at 37 °C for 12 h with shaking. One milliliter of the overnight culture was spread onto a 60-mm plate containing 4 mL of slow-killing agar (0.35% peptone, 0.3% NaCl, 2% agar, 5 µg/mL cholesterol, 25 mM potassium phosphate with pH 6.0, 1 mM MgSO₄, 1 mM CaCl₂, and 0.1 µg/mL 5-fluorodeoxyuridine to inhibit progeny hatching). The plates were incubated overnight at 37 °C to allow bacterial lawn formation, followed by equilibration at 25 °C for 24 h prior to nematode transfer. Synchronized L4-stage worms were then transferred to those plates covered with P. aeruginosa PA14 and maintained continuously at 25 °C. Worm survival was assessed every 24 h; worms were considered dead if they failed to respond to gentle prodding of the head or tail using a platinum wire.

Colony forming unit (CFU) assay of P. aeruginosa PA14

P. aeruginosa PA14 labeled with mCherry was cultured in LB medium overnight, and the bacterial culture was seeded onto NGM agar plates and incubated at 37 °C for 24 h. For CFU determination, L4-stage larvae were transferred to the bacteria-seeded plates following a defined period of bacterial exposure. Subsequently, 50 larvae were transferred into M9 buffer and washed three times with antibiotic-containing M9 solution supplemented with 1 mg/ml ampicillin (Sangon Biotech, Dalian, China) and 1 mg/mL gentamicin (Solarbio, Beijing, China) to remove surface-associated bacteria. To further eliminate residual mCherry-labeled PA14 from the nematode surface, the larvae were transferred to fresh NGM plates containing the same antibiotics and incubated for an additional 30 min. After incubation, the larvae were lysed using an electric homogenizer. The resulting lysates were serially diluted in M9 buffer and plated onto LB agar plates supplemented with 100 µg/mL ampicillin.

Avoidance assay from P. aeruginosa PA14

A 20 µL aliquot of P. aeruginosa PA14 was inoculated onto a 60-mm modified NGM plate and incubated at 37 °C for 24 h. Subsequently, 30 L4-stage worms were transferred to the center of each bacterial lawn. After exposure to the pathogen, the percentage of worms that remained outside the bacterial lawn were recorded at 4, 8, 12, and 24 h post-exposure under room temperature conditions. The experiment was independently repeated at least three times.

RNA extraction and qPCR

Total RNA was isolated from age-synchronized L4-stage C. elegans hermaphrodites using the TransZol Up Plus RNA Kit (TransGen Biotech, Beijing, China; cat#ER501-01). The worms were washed off with M9 buffer, allowed to settle naturally, and approximately 50 µL of the sample was transferred into a reagent. Lysis was achieved by three cycles of flash-freezing in liquid nitrogen followed by rapid thawing at 37 °C. Chloroform (0.2 mL per 0.5 mL of lysate) was added, and samples were vortexed vigorously and centrifuged at 12,000 × g for 15 min at 4 °C. Then, the upper aqueous phase containing RNA was transferred to a fresh tube. RNA was precipitated by adding 0.5 volumes of isopropanol, incubated at -20 °C for 30 min, and pelleted by centrifugation again. The pellet was washed once with 75% (v/v) ethanol pre-chilled to -20 °C, air-dried briefly, and dissolved in 20–30 µL of RNase-free DEPC-treated water. First-strand cDNA synthesis was performed using 1 µg of total RNA, random hexamer primers, and the Hifair® III First Strand cDNA Synthesis Kit (gDNA digester plus) (Yeasen Biotech, Shanghai, China. cat#11139ES10). Real-time PCR was carried out using SYBR Green qPCR Master Mix (Omega Bio-tek, Norwood, MA. cat#TQ2300-02). The PCR amplification protocol included 40 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 40 s. PCRs were performed on an ABI PRISM 7000 Real-Time PCR (Applied Biosystems, Foster City, CA). Gene expression data were analyzed using the 2–△△Ct method and normalized to act-1.

RNA interference

RNAi was administered by feeding C. elegans with bacteria containing RNAi clones from the RNAi library (Source BioScience, Nottingham, UK). Briefly, target genes were knocked down by feeding C. elegans with E. coli HT115 (DE3) expressing dsRNA targeting the gene of interest, starting from the L1 larval stage through adulthood. Worms fed with HT115 bacteria carrying an empty L4440 vector served as negative controls.

Immunoblot analyses

C. elegans at the young L4 stage were harvested and protein lysates were prepared as described previously [43]. In brief, worms were washed twice with M9 buffer pelleted by centrifugation, and immediately snap-frozen in liquid nitrogen. Lysis was performed in RIPA buffer (Solarbio, Beijing, China. cat#R0020) supplemented with protease and phosphatase inhibitors. Samples were homogenized using an electric tissue grinder, followed by centrifugation at 12,000 × g for 15 min at 4 °C. The supernatants were collected, and protein concentration were determined using a BCA assay. Equal amounts of total protein (20 µg per lane) were electrophoretically separated by 10% SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membrane (Merck Millipore, Billerica, MA. cat# ISEQ00010). The membrane was blocked for 1 h at room temperature with 5% bovine serum albumin (BSA) in TBST and then probed with the following primary antibodies phospho-PMK-1 (Cell Signaling Technology, Danvers, MA. cat#9211S), total PMK-1 (Cell Signaling Technology, Danvers, MA. cat#8690S), or anti-α-tubulin monoclonal antibody (Servicebio, Wuhan, China. cat#GB15200). Antibody dilutions were 1:1000 for phospho-PMK-1 and total PMK-1, and 1:2000 for anti-α-tubulin. Horseradish peroxidase (HRP)-conjugated anti-rabbit (Zen BioScience, Chengdu, China. cat#511203) and anti-mouse (Zen BioScience, Chengdu, China. cat#511103) secondary antibodies were used at a 1:10,000 dilution for detection. Signals were developed using ECL reagent (Abbkine, Wuhan, China. cat#BMU102-CN) and visualized with an ImageQuant 800 imaging system (GE Healthcare, Chicago, IL). Band intensities were quantified using Image Lab software (version 6.0.1). The ratio of active phospho-PMK-1 to total α-tubulin was calculated and normalized to the wild-type control group.

Statistical analysis

All data and corresponding graphical representations are presented as mean ± SEM and were analyzed using GraphPad Prism 8.0. Survival curves were generated using the same software. Survival data were analyzed using the log-rank test (Kaplan-Meier method).

Supplementary Information

Supplementary Material 1. (108.8KB, pdf)
Supplementary Material 2. (4.2MB, docx)
Supplementary Material 3. (4.2MB, docx)

Acknowledgements

The authors thank all the participants of the present study.

Authors' contributions

All authors contributed to the study conception and design. X.H designed and supervised the entire process of the experiment. Y.L and C.Z contributed equally as co-first authors by performing the major body of the experimental work. W.Z and Y.D participated in part of the experiments and analyzed the experimental data. Y.L, C.Z, and X.H provided technical assistance and reviewed and edited the manuscript. All authors reviewed the manuscript.

Funding

This work was supported by the Natural Science Foundation Program of China (Grant No. 32560181 and 32170184) and Scientific Research Fund of Yunnan Provincial Department of Education, Yunnan University Graduate Research Innovation Fund (No.KC-24248767). The Yunnan University Graduate Research Innovation Fund (No. KC-252512222).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Consent for publication

All authors read and approved the final manuscript.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yixin Li and Chidi Zhong contributed equally to this paper.

References

  • 1.Zheng Z, Zhang X, Liu J, He P, Zhang S, Zhang Y, Gao J, Yang S, Kang N, Afridi MI et al. GABAergic synapses suppress intestinal innate immunity via insulin signaling in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2021;118(20):e2021063118. 10.1073/pnas.2021063118. [DOI] [PMC free article] [PubMed]
  • 2.Zeng J, Xie X, Feng XL, Xu L, Han JB, Yu D, Zou QC, Liu Q, Li X, Ma G, et al. Specific inhibition of the NLRP3 inflammasome suppresses immune overactivation and alleviates COVID-19 like pathology in mice. EBioMedicine. 2022;75:103803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ameer MA, Chaudhry H, Mushtaq J, Khan OS, Babar M, Hashim T, Zeb S, Tariq MA, Patlolla SR, Ali J, et al. An Overview of Systemic Lupus Erythematosus (SLE) Pathogenesis, Classification, and Management. Cureus. 2022;14(10):e30330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Giannella M, Lanternier F, Dellière S, Groll AH, Mueller NJ, Alastruey-Izquierdo A, Slavin MA. Invasive fungal disease in the immunocompromised host: changing epidemiology, new antifungal therapies, and management challenges. Clin Microbiol Infect. 2025;31(1):29–36. [DOI] [PubMed] [Google Scholar]
  • 5.Hemler ME. Tetraspanin proteins mediate cellular penetration, invasion, and fusion events and define a novel type of membrane microdomain. Annu Rev Cell Dev Bi. 2003;19:397–422. [DOI] [PubMed] [Google Scholar]
  • 6.Yáñez-Mó M, Barreiro O, Gordon-Alonso M, Sala-Valdés M, Sánchez-Madrid F. Tetraspanin-enriched microdomains: a functional unit in cell plasma membranes. Trends Cell Biol. 2009;19(9):434–46. [DOI] [PubMed] [Google Scholar]
  • 7.Karamatic Crew V, Burton N, Kagan A, Green CA, Levene C, Flinter F, Brady RL, Daniels G, Anstee DJ. CD151, the first member of the tetraspanin (TM4) superfamily detected on erythrocytes, is essential for the correct assembly of human basement membranes in kidney and skin. Blood. 2004;104(8):2217–23. [DOI] [PubMed] [Google Scholar]
  • 8.Larios J, Mercier V, Roux A, Gruenberg J. ALIX- and ESCRT-III-dependent sorting of tetraspanins to exosomes. J Cell Biol. 2020;219(3):e201904113. 10.1083/jcb.201904113. [DOI] [PMC free article] [PubMed]
  • 9.Liu Z, Shi H, Nzessi AK, Norris A, Grant BD, Liu J. Tetraspanins TSP-12 and TSP-14 function redundantly to regulate the trafficking of the type II BMP receptor in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2020;117(6):2968–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang Y, Yang Q, Meng X, Wijaya CS, Ren X, Xu S. Recruitment of tetraspanin TSP-15 to epidermal wounds promotes plasma membrane repair in C. elegans. Dev Cell. 2022;57(13):1630–e16421634. [DOI] [PubMed] [Google Scholar]
  • 11.Jiang WI, De Belly H, Wang B, Wong A, Kim M, Oh F, DeGeorge J, Huang X, Guang S, Weiner OD et al. Early-life stress triggers long-lasting organismal resilience and longevity via tetraspanin. Sci Adv. 2024;10(4):eadj3880. 10.1126/sciadv.adj3880. [DOI] [PMC free article] [PubMed]
  • 12.Feigelson SW, Grabovsky V, Shamri R, Levy S, Alon R. The CD81 tetraspanin facilitates instantaneous leukocyte VLA-4 adhesion strengthening to vascular cell adhesion molecule 1 (VCAM-1) under shear flow. J Biol Chem. 2003;278(51):51203–12. [DOI] [PubMed] [Google Scholar]
  • 13.Jin Y, Takeda Y, Kondo Y, Tripathi LP, Kang S, Takeshita H, Kuhara H, Maeda Y, Higashiguchi M, Miyake K, et al. Double deletion of tetraspanins CD9 and CD81 in mice leads to a syndrome resembling accelerated aging. Sci Rep. 2018;8(1):5145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Razzauti A, Laurent P. Ectocytosis prevents accumulation of ciliary cargo in C. elegans sensory neurons. eLife. 2021;10:e67670. 10.7554/eLife.67670. [DOI] [PMC free article] [PubMed]
  • 15.van Deventer SJ, Dunlock VME, van Spriel AB. Molecular interactions shaping the tetraspanin web. Biochem Soc T. 2017;45:741–50. [DOI] [PubMed] [Google Scholar]
  • 16.Karam J, Méresse S, Kremer L, Daher W. The roles of tetraspanins in bacterial infections. Cell Microbiol. 2020;22(12):e13260. [DOI] [PubMed] [Google Scholar]
  • 17.Tsitsikov EN, Gutierrez-Ramos JC, Geha RS. Impaired CD19 expression and signaling, enhanced antibody response to type II T independent antigen and reduction of B-1 cells in CD81-deficient mice. Proceedings of the National Academy of Sciences. 1997;94(20):10844–10849. [DOI] [PMC free article] [PubMed]
  • 18.Dunlock VE. Tetraspanin CD53: an overlooked regulator of immune cell function. Med Microbiol Immun. 2020;209(4):545–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yan J, Zhao N, Yang Z, Li Y, Bai H, Zou W, Zhang K, Huang X. A trade-off switch of two immunological memories in Caenorhabditis elegans reinfected by bacterial pathogens. J Biol Chem. 2020;295(50):17323–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Schulenburg H, Félix MA. The Natural Biotic Environment of Caenorhabditis elegans. Genetics. 2017;206(1):55–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Liu J, Zhang P, Zheng Z, Afridi MI, Zhang S, Wan Z, Zhang X, Stingelin L, Wang Y, Tu H. GABAergic signaling between enteric neurons and intestinal smooth muscle promotes innate immunity and gut defense in Caenorhabditis elegans. Immunity. 2023;56(7):1515–32. e1519. [DOI] [PubMed] [Google Scholar]
  • 22.Khan F, Jain S, Oloketuyi SF. Bacteria and bacterial products: Foe and friends to Caenorhabditis elegans. Microbiol Res. 2018;215:102–13. [DOI] [PubMed] [Google Scholar]
  • 23.Sun J, Singh V, Kajino-Sakamoto R, Aballay A. Neuronal GPCR controls innate immunity by regulating noncanonical unfolded protein response genes. Science. 2011;332(6030):729–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Martineau CN, Kirienko NV, Pujol N.Innate immunity in. C. elegans. Curr Top Dev Biol. 2021; 144:309–351. 10.1016/bs.ctdb.2020.12.007. [DOI] [PMC free article] [PubMed]
  • 25.Ewbank JJ, Pujol N. Cellular homeostasis: coping with ER overload during an immune response. Curr Biol. 2010;20(10):R452–455. [DOI] [PubMed] [Google Scholar]
  • 26.He Y, Zhang Y, Xie H, Shan Z, Hou Z, Qi B. The shutdown of food digestion due to endoplasmic reticulum homeostasis disruption acts as a protective mechanism in C. elegans. Nat Commun. 2025;16(1):8417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Grishok A. RNAi mechanisms in Caenorhabditis elegans. FEBS Lett. 2005;579(26):5932–9. [DOI] [PubMed] [Google Scholar]
  • 28.Bar-Ziv R, Dutta N, Hruby A, Sukarto E, Averbukh M, Alcala A, Henderson HR, Durieux J, Tronnes SU, Ahmad Q et al. Glial-derived mitochondrial signals affect neuronal proteostasis and aging. Sci Adv. 2023;9(41):eadi1411. 10.1126/sciadv.adi1411. [DOI] [PMC free article] [PubMed]
  • 29.Kim DH, Feinbaum R, Alloing G, Emerson FE, Garsin DA, Inoue H, Tanaka-Hino M, Hisamoto N, Matsumoto K, Tan MW, et al. A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science. 2002;297(5581):623–6. [DOI] [PubMed] [Google Scholar]
  • 30.Garsin DA, Villanueva JM, Begun J, Kim DH, Sifri CD, Calderwood SB, Ruvkun G, Ausubel FM. Long-lived C. elegans daf-2 mutants are resistant to bacterial pathogens. Science. 2003;300(5627):1921. [DOI] [PubMed] [Google Scholar]
  • 31.Veiga-Fernandes H, Pachnis V. Neuroimmune regulation during intestinal development and homeostasis. Nat Immunol. 2017;18(2):116–22. [DOI] [PubMed] [Google Scholar]
  • 32.Mouchiroud L, Houtkooper RH, Moullan N, Katsyuba E, Ryu D, Cantó C, Mottis A, Jo YS, Viswanathan M, Schoonjans K, et al. The NAD(+)/Sirtuin Pathway Modulates Longevity through Activation of Mitochondrial UPR and FOXO Signaling. Cell. 2013;154(2):430–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wu N, Chen YA, Zhu Q, Son CH, Gu KZ, Zou CG, Wu QY, Ma YC. The EGL-30 pathway regulates experience-dependent aversive behavior of Caenorhabditis elegans to the pathogenic bacterium Pseudomonas aeruginosa. Biochem Biophys Res Commun. 2023;642:107–12. [DOI] [PubMed] [Google Scholar]
  • 34.Wu T, Ge M, Wu M, Duan F, Liang J, Chen M, Gracida X, Liu H, Yang W, Dar AR, et al. Pathogenic bacteria modulate pheromone response to promote mating. Nature. 2023;613(7943):324–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch’ng Q, Butcher RA, et al. Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides. Neuron. 2019;104(6):1095–e11091095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kawli T, Tan M-W. Neuroendocrine signals modulate the innate immunity of Caenorhabditis elegans through insulin signaling. Nat Immunol. 2008;9(12):1415–24. [DOI] [PubMed] [Google Scholar]
  • 37.Homsi Y, Schloetel JG, Scheffer KD, Schmidt TH, Destainville N, Florin L, Lang T. The Extracellular δ-Domain is Essential for the Formation of CD81 Tetraspanin Webs. Biophys J. 2014;107(1):100–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lebel-Binay S, Lagaudrière C, Fradelizi D, Conjeaud H. CD82, member of the tetra-span-transmembrane protein family, is a costimulatory protein for T cell activation. J Immunol. 1995;155(1):101–10. [PubMed] [Google Scholar]
  • 39.Seu L, Tidwell C, Timares L, Duverger A, Wagner FH, Goepfert PA, Westfall AO, Sabbaj S, Kutsch O. CD151 Expression Is Associated with a Hyperproliferative T Cell Phenotype. J Immunol. 2017;199(9):3336–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Petersen SH, Odintsova E, Haigh TA, Rickinson AB, Taylor GS, Berditchevski F. The role of tetraspanin CD63 in antigen presentation via MHC class II. Eur J Immunol. 2011;41(9):2556–61. [DOI] [PubMed] [Google Scholar]
  • 41.Murru L, Moretto E, Martano G, Passafaro M. Tetraspanins shape the synapse. Mol Cell Neurosci. 2018;91:76–81. [DOI] [PubMed] [Google Scholar]
  • 42.Foster KJ, McEwan DL, Pukkila-Worley R. Measurements of Innate Immune Function in C. elegans. Methods Mol Biol. 2020;2144:145–60. [DOI] [PubMed] [Google Scholar]
  • 43.Peterson ND, Cheesman HK, Liu P, Anderson SM, Foster KJ, Chhaya R, Perrat P, Thekkiniath J, Yang Q, Haynes CM, et al. The nuclear hormone receptor NHR-86 controls anti-pathogen responses in C. elegans. PLoS Genet. 2019;15(1):e1007935. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (108.8KB, pdf)
Supplementary Material 2. (4.2MB, docx)
Supplementary Material 3. (4.2MB, docx)

Data Availability Statement

No datasets were generated or analysed during the current study.

Articles from Cell Communication and Signaling : CCS are provided here courtesy of BMC

RESOURCES