USP30 inhibits wound healing in diabetic foot ulcers by promoting TRAF6‐induced ferroptosis and angiogenesis inhibition

ABSTRACT

Background

Diabetic foot ulcers (DFUs) frequently complicate diabetes. Ubiquitin‐specific protease 30 (USP30), a key deubiquitinating enzyme, is implicated in diverse diseases. This study explores USP30's effects and mechanisms on DFUs.

Methods

Tumor necrosis factor receptor‐associated factor 6 (TRAF6), USP30, GPX4, and SLC7A11 protein levels were determined using western blot. TRAF6 mRNA level was assessed using real‐time RT‐qPCR. Cell proliferation and mortality were evaluated via the 5‐Ethynyl‐2′‐deoxyuridine assay and TdT‐mediated dUTP nick end labeling, respectively. Intracellular ferrous ion levels, malondialdehyde concentrations, and superoxide dismutase activity were measured with specialized cell metabolism kits, while intracellular reactive oxygen species levels were detected by flow cytometry. Cell migration was evaluated through wound healing assays, and tube formation was quantified using the tube formation method. Co‐immunoprecipitation was conducted to validate USP30's regulatory effect on TRAF6 ubiquitination. Mouse models of DFU were established for in vivo validation.

Results

TRAF6 was highly expressed in human umbilical vein endothelial cells (HUVECs) induced by high glucose (HG). TRAF6 knockdown enhanced cell proliferation, inhibited apoptosis and ferroptosis, and promoted cell migration and tubule formation in these cells. In HG‐induced HUVECs, USP30 was also overexpressed and stabilized TRAF6 expression through deubiquitination. USP30 knockdown alleviated HG‐induced injury in HUVECs by targeting TRAF6. Moreover, USP30 knockdown accelerated DFU wound healing and inhibited ferroptosis in vivo.

Conclusions

USP30 stabilizes TRAF6 via deubiquitination, triggering ferroptosis and suppressing angiogenesis, which ultimately impedes wound healing in DFU. This offers direct evidence for the modulatory role of USP30 in DFU.

High glucose upregulates USP30 in HUVECs, which deubiquitinates and stabilizes TRAF6. Stabilized TRAF6 suppresses GPX4 and SLC7A11, increases ROS/MDA/lipid peroxidation, and activates ferroptosis and apoptosis, leading to impaired angiogenesis and delayed wound healing. In STZ‐induced diabetic mice, USP30 knockdown reduces TRAF6, restores GPX4, inhibits ferroptosis, and promotes foot ulcer healing. Thus, USP30 exacerbates diabetic foot ulcer via TRAF6‐mediated ferroptosis, and targeting USP30 represents a potential therapeutic strategy.

INTRODUCTION

Diabetic foot ulcer (DFU) is a severe complication that occurs in diabetics due to nerve and blood vessel damage caused by persistently high blood sugar levels ¹ . Globally, DFU affects approximately 6.3% of individuals with diabetes, with an annual incidence rate of 2–6% ² . The condition is particularly prevalent in low‐ and middle‐income countries, where limited access to healthcare exacerbates its burden ³ . Initially, DFU presents as skin breaks, redness, swelling, and pain in the feet ⁴ . As the condition progresses, these ulcers may gradually enlarge and deepen, leading to infections accompanied by pus and odor ⁵ . Notably, DFU‐related amputations account for over 80% of nontraumatic lower‐limb amputations worldwide, with a 5 year mortality rate exceeding 50%—comparable to many cancers ² . The underlying causes of DFU include neuropathy, a consequence of diabetes that reduces sensation in the feet, making patients prone to unnoticed injuries ⁶ , ⁷ . Additionally, vascular pathology affects blood circulation, causing ischemia and hypoxia in foot tissues and impairing their repair capabilities ⁸ . Genetic factors also play a significant role in the progression of DFU, as evidenced by genetic predisposition, genomic influences, and familial aggregation ⁹ , ¹⁰ . Research indicates that specific genetic variations can increase an individual's susceptibility to diabetes and its associated complications ¹¹ , ¹² , ¹³ . Currently, targeted therapy for DFU mainly involves the administration of highly specialized medications, including agonists targeting the glucagon‐like peptide‐1 (GLP‐1) receptor, inhibitors of dipeptidyl peptidase‐4 (DPP‐4), and inhibitors of sodium‐glucose cotransporter 2 (SGLT‐2) ¹ , ¹⁴ . These drugs act on pancreatic β cells, pancreatic α cells, and the liver to enhance insulin sensitivity, reduce glucagon levels, and stimulate endogenous insulin secretion ¹⁵ , ¹⁶ , ¹⁷ . Despite the significant advancements in targeted therapy for DFU, the complex and variable pathogenesis and pathological processes of this condition mean that not all patients have clearly identifiable sensitive targets. Therefore, the exploration of new therapeutic targets remains highly necessary.

Tumor necrosis factor receptor‐associated factor 6 (TRAF6) functions as a ubiquitin‐conjugating enzyme with a wide range of roles, frequently acting as a pivotal signaling molecule that regulates intracellular signal transduction ¹⁸ . TRAF6, with its unique receptor‐binding specificity, can mediate signal transduction responses, such as those involving Toll‐like receptors and interleukin‐1 receptors (IL‐1R) ¹⁹ . TRAF6 demonstrates a wide array of functions, acting as a vital modulator of both innate and adaptive immune equilibrium, engaging in bone metabolism to uphold skeletal integrity, and exercising a substantial influence in the formation of tissues, notably the nervous system ²⁰ , ²¹ . Research revealed that the overactivation of TRAF6 following subarachnoid hemorrhage (SAH) contributed to the occurrence of early brain injury (EBI) by inhibiting autophagy and promoting oxidative stress, and that regulating the protein levels of TRAF6 may potentially aid in mitigating brain injury after SAH ²² . In liver diseases, TRAF6 might exacerbate ferroptosis in hepatocytes by modulating relevant signaling pathways, specifically manifesting as the promotion of lipid peroxide production and iron release, thereby further deteriorating liver function ²³ . A study found that in diabetic mouse models and human umbilical vein endothelial cells (HUVECs) subjected to high glucose (HG), TRAF6 expression was upregulated, and that knocking down TRAF6 could reverse the effects of HG on endothelial cell viability and migration ²⁴ . In diabetic kidney disease, USP25 interacted with TRAF6, effectively inhibiting TRAF6‐mediated inflammatory response and thereby suppressing the progressive deterioration of diabetic kidney disease ²⁵ . However, it remains currently uncertain whether TRAF6 is involved in the development of DFU.

Ubiquitin‐specific protease 30 (USP30), a deubiquitinating enzyme localized at the mitochondrial outer membrane, plays a pivotal role in regulating mitochondrial morphology and facilitating mitochondrial autophagy within cellular environments ²⁶ , ²⁷ . The study revealed that USP30 was upregulated in DFU. It activates the NLRP3 inflammasome by deubiquitinating NLRP3, thereby inhibiting wound healing in DFU patients ²⁸ . Ubiquitination modification at the K63 site of TRAF6 is crucial for its activation and the activation of downstream signaling pathways. Meanwhile, USP family members such as USP4 and USP2a can inhibit TRAF6 activation by binding to TRAF6 and exerting deubiquitinating effects ²⁹ . Previously, it remained unclear whether USP30 was involved in the ubiquitination process of TRAF6.

Therefore, this study aims to investigate the specific effects of USP30 and TRAF6 on DFU and their interactions. This research has the potential to uncover new therapeutic targets for DFU, offering a solid scientific foundation for the development of innovative treatment strategies.

MATERIALS AND METHODS

Cell culture and treatment

HUVECs were sourced from Jin Shaoyuan Biotechnology Co., Ltd. (Shanghai, China) Biotechnology Co., Ltd. These cells were cultured in Dulbecco's Modified Eagle's Medium glucose‐free (DMEM) (Gibco, Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS) (Gibco), as well as 1% penicillin–streptomycin antimicrobial agents (MedChemExpress, Shanghai, China). They were preserved in an incubator set at 37°C, with a 5% concentration of CO₂. After achieving a stable condition, the cells were categorized into two distinct groups: the control group (NG), which received a medium supplemented with 5.5 mM of glucose, and the HG group, which was supplemented with 25 mm of glucose in the medium ³⁰ . As an osmotic control for the HG group, HUVECs were incubated for 48 h in the NG medium supplemented with mannitol (5.5 mm glucose + 19.5 mm mannitol), namely the Mannitol group. In addition, HUVECs were treated with Z‐VAD‐FMK (apoptotic inhibitor, #161401‐82‐7, 40 μm, 48 h, MedChemExpress, Monmouth Junction, NJ, USA), Ferrostatin‐1 (Fer‐1, ferroptosis inhibitor, #HY‐100579, 5 μm, 24 h, MedChemExpress), or MF‐094 (a potent and selective inhibitor of USP30, #HY‐112438, 10 μm, 24 h, MedChemExpress). No written consent has been obtained from the patients as there is no patient‐identifiable data included.

Cell viability

Cell viability under the treatment of different concentrations of glucose was measured using MTT assay. HUVECs were treated with various concentrations of glucose (5.5, 12.5, 25, and 50 mm) for 48 h. Then, 20 μL of 5 mg/mL MTT solution (Sigma‐Aldrich, St. Louis, MO, USA) was added to each well for another 4 h, followed by the addition of 150 μL DMSO to dissolve the generated formazan crystals. Finally, cell absorbance was determined at the wavelength of 490 nm.

Cell transfection

The small interfering RNA (siRNA) targeting TRAF6 or USP30 (si‐TRAF6 or si‐USP30), the short hairpin RNA (shRNA) targeting USP30 (sh‐USP30), and the plasmid vectors (pcDNA) overexpressing TRAF6 or USP30 (pcDNA‐USP30 or pcDNA‐TRAF6), along with their corresponding blank controls (si‐NC, sh‐NC, or pcDNA‐NC), were all designed and provided by GenePharma (Shanghai, China). HUVECs in each group underwent transfection utilizing Lipofectamine™ 3,000 (Invitrogen, Waltham, MA, USA), following the provided instructions.

Western blot

Protein extraction was performed on cells and tissues using RIPA lysis buffer (MedChemExpress) that included protease inhibitors (MedChemExpress). After determining protein quantities with the bicinchoninic acid‐based protein assay kit (Invitrogen), the proteins underwent separation via sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE). The isolated proteins were subsequently transferred onto a polyvinylidene fluoride (PVDF) membrane and underwent a blocking procedure with 5% nonfat milk powder (Solarbio, Beijing, China). Subsequently, the membrane underwent overnight incubation at 4°C with anti‐TRAF6 (ab137452, 1:2000, Abcam), anti‐USP30 (ab314749, 1:1000, Abcam, Cambridge, MA, USA), anti‐Ubiquitin (UB) (ab179434, 1:1000, Abcam), anti‐glutathione peroxidase 4 (GPX4) (ab125066, 1:5000, Abcam), anti‐solute carrier family 7 member 11 (SLC7A11) (ab307601, 1:1000, Abcam), or anti‐GAPDH (ab181602, 1:10000, Abcam) antibodies. After the primary antibody incubation step was completed, the membrane was incubated with the corresponding specific secondary antibody (ab6721, 1:5000, Abcam) at 37°C for 1 h. After incubation was completed, the development process was carried out. An equal volume of enhanced chemiluminescence reagent solution A and solution B (Proteintech, Wuhan, China) was taken and thoroughly mixed. The membrane was then immersed in a dark box containing the luminescent solution and incubated for 5 min. Subsequently, it was placed in a chemiluminescence imaging system (A44115, Thermo Fisher Scientific, Waltham, MA, USA) for exposure detection.

Ethynyl‐2′‐deoxyuridine (EdU) assay

HUVECs were plated onto coverslips placed in 24‐well plates and maintained in a 37°C, 5% CO₂ incubator (51033564, Thermo Fisher Scientific) until they reached a stable state. Subsequently, EdU working solution (Invitrogen) was prepared according to the instructions, and then a volume of EdU working solution equal to that of the culture medium was added to the 24‐well plate to achieve a final concentration of 10 μm EdU per well. They were then incubated for an additional 2 h. After incubation, the medium containing EdU was removed, and the cells were then fixed with 1 mL of 4% paraformaldehyde solution (Solarbio) at room temperature for 15 min. Once fixation was complete, the cells were washed, and 1 mL of phosphate‐buffered saline (PBS) solution containing 0.3% Triton X‐100 (Solarbio) was added to permeabilize the cells at room temperature for 15 min. After permeabilization, the cells were washed again, and the click reaction mixture (Invitrogen) was meticulously prepared by following the provided instructions. Then, 0.5 mL of the click reaction mixture was dispensed into each well, followed by an incubation period in the dark, maintained at room temperature, for 30 min. Subsequently, the click reaction mixture was removed, and each well was then supplemented with 1 mL of 4′,6‐diamidino‐2‐phenylindole (DAPI) staining (Invitrogen). The cells were further incubated in the dark at room temperature for an additional 10 min. Finally, the staining solution was removed, and the coverslip was fixed so that observation could be carried out under a fluorescence microscope (with an excitation wavelength of 495 nm and an emission wavelength of 519 nm).

TdT‐mediated dUTP nick end labeling (TUNEL) assay

HUVECs were seeded onto coverslips in a 24‐well plate and cultured in a 37°C, 5% CO₂ incubator (51033564, Thermo Fisher Scientific) until they reached a stable state. Subsequently, the culture medium was removed by aspiration, and the cells were then rinsed with PBS. They were then immersed in a 4% paraformaldehyde solution (Solarbio) and allowed to fix at room temperature for 30 min. After fixation, the cells underwent another rinse with PBS and were then submerged in PBS that contained 0.1% Triton X‐100 (Solarbio) for a period of 2 min on ice to allow for permeabilization. Following permeabilization, the cells were washed with PBS once more. Next, the TUNEL reaction mixture was prepared based on the TUNEL detection kit (Invitrogen). Subsequently, 50 μL of this mixture was dispensed onto each sample to guarantee comprehensive cell coverage. The samples were then placed in a humidified chamber and incubated at 37°C for 60 min. After incubation, the TUNEL reaction mixture was aspirated, and the cells were washed. Subsequently, 100 μL of DAPI staining solution (Invitrogen) was added to each sample, and the samples were incubated in the dark at room temperature for 10 min. After removing the DAPI staining solution and rinsing the cells, the slides were then encapsulated with an anti‐fluorescence quenching mounting solution. Finally, these mounted slides were placed under a fluorescence microscope (with an excitation wavelength of 560 nm and an emission wavelength of 590 nm) for observation.

Ferroptosis detection assay

To assess ferroptosis in HUVECs, intracellular ferrous iron (Fe²⁺) levels, malondialdehyde (MDA) content, superoxide dismutase (SOD) activity, and reactive oxygen species (ROS) content were measured using Fe²⁺ fluorometric (Elabscience, Wuhan, China), MDA colorimetric (Elabscience), total SOD activity (Elabscience), and ROS fluorescence (Invitrogen) assay kits, respectively, following the manufacturer's instructions. These indicators collectively provided insights into the ferroptosis status of the cells. In the mouse model, western blot was employed to examine the expression levels of GPX4 and SLC7A11 in tissues. Additionally, following the instructions provided, a mouse MDA enzyme‐linked immunosorbent assay (ELISA) kit (Fine, Wuhan, China) and a mouse total SOD ELISA kit (Fine) were used to quantify the levels of MDA and SOD in mouse serum, respectively, thereby comprehensively evaluating the ferroptosis status of mouse tissue‐associated cells.

Wound healing assay

Parallel lines spaced 1 cm apart were evenly drawn at the bottom of a six‐well plate using a marker pen. Subsequently, HUVECs were digested using trypsin without EDTA, resuspended, and counted. Subsequently, HUVECs were evenly inoculated into a six‐well cell culture plate, with 5 × 10⁵ cells per well, and were placed in a cell incubator (51033564, Thermo Fisher Scientific) for cultivation. The cultivation conditions were set as follows: a temperature of 37°C, a CO₂ concentration of 5%, and saturated humidity. Complete medium was used for the cultivation until the cells completely covered the bottom of the six‐well plate. Afterward, a 200 μL sterile, enzyme‐free pipette tip was used to create scratches along the pre‐drawn lines. Following this, the original complete medium was replaced with serum‐free medium. Subsequently, the six‐well plate was returned to the incubator and cultured continuously under the same cultivation conditions. The healing process of the scratches was observed under a microscope, and the observations were documented by taking photographs.

Tube formation assay

Firstly, each well of a 24‐well plate received 40 μL of matrigel (Solarbio), after which the plate was allowed to sit in a 37°C incubator (51033564, Thermo Fisher Scientific) for 30 min to ensure complete solidification. Subsequently, HUVECs were digested using trypsin without EDTA (Invitrogen), resuspended in ECM medium (Invitrogen), and counted. Cells were then inoculated in 24‐well plates pre‐coated with matrigel at 1 × 10⁵ cells per well. Once seeding was completed, the plate was placed in a 37°C incubator (51033564, Thermo Fisher Scientific) with 5% CO₂ for continued culture for 6 h. Finally, an inverted microscope was used to observe the tube formation of the cells, and photographic records of the observations were taken.

Real‐time reverse transcription‐quantitative PCR (RT‐qPCR)

The cells were used to extract total RNA employing the TRIzol reagent (TaKaRa, Kusatsu, Japan). Following that, the RNA's concentration and purity were assessed using a nanodrop UV–visible spectrophotometer. After that, the RNA underwent reverse transcription to produce cDNA, utilizing the miScript RT Kit (TaKaRa). Finally, a qPCR assay was conducted using SYBR Premix Ex Taq II reagent (TaKaRa) with GAPDH chosen as the internal standard gene for normalization. The primer sequences that were used for the qPCR experiments are provided below: TRAF6, F 5′‐TTGGCCCAGGCTGTTCATAG‐3′ and R 5′‐CAAGGCGACCCTCTAACTGG‐3′; GAPDH, F 5′‐GTCAAGGCTGAGAACGGGAA‐3′ and R 5′‐AAATGAGCCCCAGCCTTCTC‐3′.

Co‐immunoprecipitation (CoIP) assay

HUVECs were harvested while in optimal growth conditions and subsequently lysed through the application of a cell lysis buffer that included protease inhibitors. Protein A/G magnetic beads were preincubated with anti‐TRAF6 (ab137452, 1:200, Abcam), anti‐USP30 (ab314749, 1:50, Abcam), or anti‐IgG (ab172730, 1:50, Abcam) antibodies for 1 h at 37°C with gentle rotation to ensure uniform antibody‐bead binding. The antibody‐conjugated magnetic beads were then mixed with the cell lysate and incubated at 4°C for 4 h with continuous gentle rotation on a rocking platform. After incubation, the magnetic beads and their bound complexes were isolated using a magnetic rack. The supernatant was carefully removed, leaving the magnetic bead‐protein complexes. Following washing, elution buffer was used to separate the protein complexes from the magnetic beads. Ultimately, the eluted proteins were analyzed by western blot.

Cyclohexanimide (CHX) tracking assay

HUVECs were seeded into six‐well plates. When cell confluence reaches 70%–80%, 1 mL CHX solution at a concentration of 20 μg/mL was added to each well. Cells were harvested and proteins were extracted at 0, 6, 12, and 24 h after CHX addition. Finally, the proteins obtained at each time point were analyzed using western blot.

Animal model

A total of 30 ten‐week‐old male normal mice (Beijing SPF Biotechnology Co., Ltd.) were used in this study. Before the experiment, they were ensured to be in good health and fasted for 12 h with water ad libitum. Subsequently, the mice were randomly divided into three groups: the control group (n = 10), the STZ group (n = 10), and the STZ + Ad‐sh‐USP30 group (n = 10). After weighing, the mice in the STZ group were intraperitoneally injected with streptozotocin (STZ) solution (MedChemExpress, dissolved in 0.01 m sodium citrate buffer) at a dose of 130 mg/kg. Seven days post‐STZ injection, the mice's fasting blood glucose levels were assessed using a glucometer. Mice with glucose levels higher than 16.70 mmol/L were considered diabetic mice. For skin wounds, a scissor was used to make skin wounds (1.3 × 1.3 cm) on the mid‐back of mice at 7 days after STZ administration (day 0). For the STZ + Ad‐sh‐USP30 group, a total of 200 μL USP30 knockdown‐expressing adenovirus vector (Ad‐sh‐USP30) was injected at the sites of skin wound at 9 days after STZ administration (day 2). The control group was injected with sodium‐citrate buffer solution (Solarbio) as a control. Wounds were tested at days 0, 7, and 14, respectively. All animal experiments were conducted in compliance with the ARRIVE guidelines and approved by the Ethics Committee of the 970th Hospital of the Joint Service Support Force of the Chinese People's Liberation Army.

Hematoxylin–eosin (HE) staining and Masson staining

Mouse foot wound tissue was fixed, dehydrated, cleared, wax‐immersed, and embedded. It was then sliced into 4–6 μm sections, mounted on slides, baked, and dewaxed in xylene (Solarbio). Hydration was performed in ethanol gradients (Solarbio). For HE staining, sections were stained with Harris's hematoxylin (Solarbio) for 15 min, differentiated in 0.5% hydrochloric acid in ethanol (Solarbio) for 10 min, rinsed, and stained with eosin (Solarbio) for 5 min. After dehydration and clearing, sections were mounted with neutral balsam (Solarbio). For Masson's trichrome staining, the sections were treated with Weigert's iron hematoxylin solution (Solarbio) for 10 min, followed by differentiation with 0.5% hydrochloric acid in ethanol (Solarbio) for 10 s. The sections were then stained with ponceau acid fuchsin solution (Solarbio) for 10 min. After that, they were treated with a 1% phosphomolybdic acid aqueous solution (Solarbio) for 5 min. Subsequently, the sections were counterstained with a 2% aniline blue solution (Solarbio) for 10 min. After staining, they were washed with a 1% acetic acid aqueous solution (Solarbio). Finally, the stained sections underwent dehydration and clearing processes and were mounted with neutral balsam (Solarbio).

Statistical analysis

Statistical analyses were conducted using GraphPad Prism 8 software (GraphPad Software, Boston, MA, USA). All the results reported in this study were derived from experiments that were repeated at least three times to ensure reliability and reproducibility. All measured data were presented as the mean ± standard deviation. For comparisons between two groups, the Student's t‐test was employed. For multiple comparisons, one‐way analysis of variance (anova) was initially conducted, followed by Tukey's post hoc test to correct for multiple comparisons and identify specific intergroup differences. A P‐value of <0.05 was considered statistically significant.

RESULTS

TRAF6 knockdown inhibits HG‐induced ferroptosis in HUVECs and promotes angiogenesis

First of all, as an osmotic control for HG, the cells were cultured with NG conditions supplemented with 19.5 mM Mannitol. As shown in Figure 1a, Mannitol treatment had no significant impact on TRAF6 mRNA expression compared with the NG group, suggesting that the upregulation of TRAF6 by HG was not caused by osmotic pressure changes. Then, to investigate the effects of different glucose concentrations (12.5, 25, and 50 mm) on HUVEC viability in vitro, MTT assay was performed. As shown in, cell viability was gradually reduced in a dose‐dependent manner (Figure S1A). Considering that 25 mM and 48 h resulted in approximately 50% inhibition of cell growth, 25 mm was selected for subsequent studies. Meanwhile, western blot results verified that the TRAF6 protein level was significantly increased at concentrations equal to or higher than 25 mM compared with the 12.5 mm and NG groups (Figure S1B). To explore the role of TRAF6 in HG‐induced HUVECs, TRAF6 expression was knocked down in these cells using siRNA technology in this study. Subsequently, western blot analysis displayed that the TRAF6 protein level was apparently reduced in si‐TRAF6‐transfected HUVECs relative to the si‐NC group under HG treatment (Figure 1b), suggesting that the knockdown efficiency of TRAF6 in HG‐treated HUVECs is available. Subsequently, we found that knocking down TRAF6 effectively alleviated the inhibitory effect of HG on HUVEC proliferation and attenuated its promoting effect on apoptosis (Figure 1c,d). Additionally, HG treatment significantly increased the concentrations of Fe²⁺, MDA, and ROS in HUVECs while concurrently significantly decreasing SOD activity. However, this abnormal state was effectively reversed upon TRAF6 knockdown (Figure 2a–d). Beyond that, western blot results showed that HG exposure could obviously decrease the protein levels of anti‐ferroptosis markers (GPX4 and SLC7A11) in HUVECs, whereas these effects were partly relieved by TRAF6 silencing (Figure 2e), indicating that TRAF6 could promote ferroptosis by down‐regulating the SLC7A11/GPX4 axis. Furthermore, wound healing results showed that knockdown of TRAF6 reversed the inhibitory effect of HG on the migration of HUVECs (Figure 2f). The tube formation assay revealed that when TRAF6 was knocked down, it impeded the suppressive influence that HG had on tube formation in HUVECs (Figure 2g). In addition, the current work demonstrated no significant differences in cell phenotype between the NG and Mannitol groups (Figure S2), further indicating that the significant increases in TRAF6 expression and cellular damage observed in the HG group were due to the HG itself, rather than osmotic pressure. Besides, the present data displayed that TUNEL‐positive cells significantly decreased and ferroptosis indicators remained virtually unchanged following the addition of Z‐VAD‐FMK (apoptotic inhibitor) or Fer‐1 (ferroptosis inhibitor), whereas both TUNEL‐positive cells and ferroptosis indicators significantly changed in the dual‐inhibition group (Figure S3), indicating that these two mechanisms jointly mediate cellular damage and independently contribute to the cell death phenotype. This effect in the dual‐inhibition group is similar to that of si‐TRAF6, suggesting that TRAF6 may mediate cell death through two distinct pathways. Overall, the above results indicate that HG‐induced HUVECs exhibit elevated TRAF6 expression, and TRAF6 knockdown enhances cell proliferation, inhibits apoptosis and ferroptosis, and promotes cell migration and tube formation.

Figure 1.

Effects of knocking down TRAF6 on HG‐mediated HUVECs proliferation and apoptosis. (a) TRIM6 protein level was determined using western blot in HUVECs treated with NG (5.5 mm glucose), Mannitol (5.5 mm glucose + 19.5 mM Mannitol), and HG (25 mm glucose) for 48 h. (b) TRIM6 protein level was assessed using western blot in HUVECs treated with HG (25 mm glucose) + si‐NC or HG (25 mm glucose) + si‐TRIM6. (c, d) HUVECs were treated with NG (5.5 mm glucose), HG (25 mm glucose), HG (25 mm glucose) + si‐NC, or HG (25 mm glucose) + si‐TRIM6. (c) The EdU assay was utilized to assess the proliferation of HUVECs. (d) The TUNEL assay was used to assess the apoptotic status of HUVECs. ***P < 0.001, ns, no significant, n = 3. EdU, ethynyl‐2′‐deoxyuridine; HG, high glucose; HUVECs, human umbilical vein endothelial cells; TRAF6, tumor necrosis factor receptor‐associated factor 6.

Figure 2.

TRAF6 silencing suppresses HG‐induced ferroptosis in HUVECs and promotes angiogenesis. (a–c) Specific cellular metabolism kits were used to detect the levels of Fe²⁺, MDA, and SOD within HUVECs. (d) Flow cytometry was employed to detect the levels of reactive oxygen species within HUVECs. (e) GPX4 and SLC7A11 protein levels were determined using western blot assay. (f) The wound healing assay was utilized to assess the migratory capacity of HUVECs. (g) The Tube formation assay was utilized to evaluate the angiogenic capacity of HUVECs. **P < 0.01, ***P < 0.001, n = 3. HG, high glucose; HUVECs, human umbilical vein endothelial cells; MDA, malondialdehyde; SOD, superoxide dismutase; TRAF6, tumor necrosis factor receptor‐associated factor 6.

USP30 targets TRAF6 and stabilizes it through deubiquitination

Subsequently, we examined the expression level of USP30 in HG‐induced HUVECs and investigated the interaction between USP30 and TRAF6. Western blot results showed that USP30 expression was increased in HG‐induced HUVECs compared with the control group (Figure 3a). CoIP results showed that USP30‐specific antibody significantly increased the enrichment level of TRAF6 compared to IgG control (Figure 3b). In addition, western blot results showed that USP30 was effectively knocked down or overexpressed after transfection with si‐USP30 or pcDNA‐USP30 (Figure 3c). Notably, after knocking down or overexpressing USP30, there was no change in TRAF6 mRNA levels, whereas the TRAF6 protein levels exhibited significant decreases or increases, indicating that the regulatory effect of USP30 on TRAF6 occurred at the posttranslational modification level (Figure 3d,e). Furthermore, CoIP experiments further confirmed that USP30 could promote the deubiquitination of TRAF6 (Figure 3f). It is noteworthy that, following the knockdown of USP30, the degradation rate of TRAF6 protein significantly accelerated compared to the control group; conversely, overexpressing USP30 effectively slowed down the degradation process of TRAF6 protein (Figure 3g,h). To sum up, USP30 is highly expressed in HG‐induced HUVECs and stabilizes TRAF6 expression by deubiquitination.

Figure 3.

USP30 targets TRAF6 and stabilizes its expression through deubiquitination. (a) Western blot was used to detect the effect of HG treatment on USP30 expression. (b) CoIP was utilized to detect the interaction between USP30 and TRAF6. (c–f) The HUVECs were divided into four groups: si‐NC group, si‐USP30 group, pcDNA‐NC group, and pcDNA‐USP30 group. Subsequently, cells in each group were transfected with si‐NC, si‐USP30, pcDNA‐NC, or pcDNA‐USP30. (c) Western blot was conducted to detect the expression of USP30 in various groups of HUVECs. (d) RT‐qPCR was used to detect TRAF6 mRNA expression in each group of HUVECs. (e) Western blot was employed to detect the expression of USP30 protein in various groups of HUVECs. (f) The effect of USP30 on TRAF6 protein ubiquitination levels was detected using CoIP. (g, h) The effect of USP30 on the half‐life of TRAF6 protein was examined using the CHX assay. **P < 0.01, ***P < 0.001; n = 3. CoIP, co‐immunoprecipitation; HG, high glucose; HUVECs, human umbilical vein endothelial cells; ns, no significant; RT‐qPCR, reverse transcription‐quantitative polymerase chain reaction; TRAF6, tumor necrosis factor receptor‐associated factor 6; USP30, Ubiquitin‐specific protease 30.

USP30 knockdown blocks HG‐induced ferroptosis in HUVECs and promotes angiogenesis

Further functional experimental results indicated that knocking down USP30 successfully reversed the inhibitory effect of HG treatment on the proliferative vitality of HUVECs and mitigated its stimulatory effect on apoptosis (Figure 4a,b). Furthermore, in HUVECs, the HG‐triggered rises in Fe²⁺, MDA, and ROS levels, together with the decline in SOD activity, were all efficiently alleviated after USP30 was knocked down (Figure 5a,d). Moreover, the data of western blot assay exhibited that HG‐mediated GPX4 and SLC7A11 reduction in HUVECs were partly relieved by USP30 deficiency (Figure 5e). Beyond that, the results of the wound healing assay demonstrated that knocking down USP30 was able to reverse the inhibitory effect of HG on the migration of HUVECs (Figure 5f). Additionally, the inhibitory effect of HG on angiogenesis in HUVECs was also effectively reversed after USP30 knockdown (Figure 5g). The aforementioned results demonstrate that knockdown of USP30 alleviates the inhibitory effects of HG on HUVEC proliferation, migration, and tubule formation, while mitigating its stimulatory effects on HUVEC apoptosis and ferroptosis.

Figure 4.

Effects of USP30 deficiency on HG‐mediated proliferation and apoptosis in HUVECs. HUVECs were categorized into four groups: NG, HG, HG + si‐NC, and HG + si‐USP30. Afterward, according to the predefined protocols, the cells underwent either HG treatment or transfection with si‐NC or si‐USP30. (a) The EdU assay was employed to evaluate the proliferative capacity of HUVECs. (b) The apoptosis assessment of HUVECs was conducted using the TUNEL assay. ***P < 0.001, n = 3. EdU, ethynyl‐2′‐deoxyuridine; HG, high glucose; HUVECs, human umbilical vein endothelial cells; USP30, Ubiquitin‐specific protease 30.

Figure 5.

Knockdown of USP30 prevents HG‐induced ferroptosis in HUVECs and enhances angiogenesis. HUVECs were categorized into four groups: NG, HG, HG + si‐NC, and HG + si‐USP30. Afterward, according to the predefined protocols, the cells underwent either HG treatment or transfection with si‐NC or si‐USP30. (a–c) The levels of Fe²⁺, MDA, and SOD within HUVECs were detected by cellular metabolism kits. (d) The levels of ROS in HUVECs were detected using flow cytometry. (e) GPX4 and SLC7A11 protein levels were measured using western blot assay. (f) The migratory ability of HUVECs was evaluated using a wound healing assay. (g) The angiogenic potential of HUVECs was assessed using the tube formation assay. **P < 0.01, ***P < 0.001, n = 3. HG, high glucose; HUVECs, human umbilical vein endothelial cells; MDA, malondialdehyde; SOD, superoxide dismutase; USP30, Ubiquitin‐specific protease 30.

USP30 depletion alleviates HG damage to HUVECs by targeting TRAF6

To further investigate the mechanisms by which USP30 and TRAF6 protect HUVECs from HG‐induced damage, we conducted a series of rescue experiments. Western blot results showed that in HG‐induced HUVECs, the suppression of TRAF6 expression due to USP30 knockdown was mitigated following TRAF6 overexpression (Figure 6a). Overexpression of TRAF6 reversed both the promotional effect of USP30 knockdown on the proliferation of HG‐induced HUVECs and its inhibitory effect on apoptosis (Figure 6b,c). Additionally, in HG‐induced HUVECs, overexpressing TRAF6 reversed the inhibitory effects of USP30 knockdown on Fe²⁺, MDA, and ROS levels, while also attenuating its stimulatory effect on SOD activity (Figure 7a–d). Meanwhile, USP30 silencing could apparently improve GPX4 and SLC7A11 protein levels in HG‐treated HUVECs, which was partly overturned by TRAF6 upregulation (Figure 7e). Besides, the results of western blot assay exhibited that the addition of MF‐094 (USP30 inhibitor) could markedly decrease USP30 and TRAF6 protein levels and improve GPX4 and SLC7A11 expression in HG‐treated HUVECs (Figure S4), verifying that the USP30/TRAF6 axis could regulate ferroptosis in HG‐treated HUVECs. Wound healing results further demonstrated that overexpressing TRAF6 could counteract the promotional effect of USP30 knockdown on HG‐induced HUVECs migration (Figure 7f). Lastly, in HG‐induced HUVECs, the enhancement of tubule formation resulting from USP30 knockdown was also reversed by overexpressing TRAF6 (Figure 7g). These results suggest that USP30 knockdown alleviates HG damage to HUVECs by targeting TRAF6.

Figure 6.

USP30/TRAF6 regulated HG‐mediated HUVEC proliferation and apoptosis. The HUVECs treated with HG were categorized into four groups: HG + si‐NC, HG + si‐USP30, HG + si‐USP30 + pcDNA‐NC, and HG + si‐USP30 + pcDNA‐TRAF6. Subsequently, in accordance with the specified settings for each group, si‐NC, si‐USP30, pcDNA‐NC, or pcDNA‐TRAF6 were transfected into the corresponding cells. (a) The expression levels of TRAF6 in HUVECs were detected by western blot. (b) The proliferation of HUVECs was evaluated by EdU assay. (c) TUNEL assay was used to evaluate apoptosis of HUVECs. **P < 0.01, ***P < 0.001, n = 3. EdU, ethynyl‐2′‐deoxyuridine; HG, high glucose; HUVECs, human umbilical vein endothelial cells; TRAF6, tumor necrosis factor receptor‐associated factor 6; USP30, Ubiquitin‐specific protease 30.

Figure 7.

USP30 knockdown alleviates the damage caused by HG to HUVECs by targeting TRAF6. The HUVECs treated with HG were categorized into four groups: HG + si‐NC, HG + si‐USP30, HG + si‐USP30 + pcDNA‐NC, and HG + si‐USP30 + pcDNA‐TRAF6. Subsequently, in accordance with the specified settings for each group, si‐NC, si‐USP30, pcDNA‐NC, or pcDNA‐TRAF6 were transfected into the corresponding cells. (a–c) The Fe²⁺, MDA, and SOD levels in HUVECs were measured using specific cell metabolism kits. (d) The ROS levels in HUVECs were detected by flow cytometry. (e) GPX4 and SLC7A11 protein levels were examined using western blot assay. (f) Wound healing assay was used to assess the migration capacity of HUVECs. (g) The angiogenic capacity of HUVECs was evaluated by tube formation assay. **P < 0.01, ***P < 0.001, n = 3. HG, high glucose; HUVECs, human umbilical vein endothelial cells; MDA, malondialdehyde; SOD, superoxide dismutase; TRAF6, tumor necrosis factor receptor‐associated factor 6; USP30, Ubiquitin‐specific protease 30.

In vivo, USP30 knockdown accelerated wound healing in DFU

To investigate the role of USP30 in promoting UFD wound healing in vivo, we established a mouse model of UFD. The HE and Masson staining of wound tissues showed that the control group had intact skin structure with evenly distributed collagen fibers, while the STZ group exhibited significant tissue damage with pathological changes in the epidermis, dermis, and blood vessels (Figure 8a). Compared to the STZ group, the STZ + sh‐USP30 group demonstrated reduced damage and improved pathological changes, albeit not reaching the normal state of the control group (Figure 8a). Compared to the control group, the wound healing rate in the STZ group showed a noticeable decrease; whereas, the wound healing rate in the STZ + sh‐USP30 group was higher than that in the STZ group, yet it did not reach the level of the control group (Figure 8b). The cystine/glutathione (GSH)/GPX4 pathway is a classic modulator of ferroptosis, with SLC7A11 facilitating cystine uptake for GSH synthesis, which GPX4 then uses to reduce peroxidized phospholipids, effectively inhibiting cell ferroptosis ³¹ . Western blot results showed that compared with the control group, the expression levels of USP30 and TRAF6 were increased in the STZ group, while the expression levels of GPX4 and SLC7A11 were decreased; however, it is noteworthy that these expression changes were effectively reversed when USP30 was knocked down (Figure 8c). Furthermore, ELISA assay results indicated that compared to the control group, the MDA levels were significantly elevated and the SOD activity was markedly decreased in the STZ group, but this trend was effectively reversed in the STZ + sh‐USP30 group (Figure 8d,e). The aforementioned results suggest that USP30 knockdown facilitates DFU wound healing and inhibits ferroptosis.

Figure 8.

Knockdown of USP promotes DFU wound healing. Mice were randomly assigned to the control group, the STZ group, and the STZ + sh‐USP30 group. Subsequently, STZ was administered to mice in both the STZ group and the STZ + sh‐USP30 group, with the latter group also receiving a total of 200 μL USP30 knockdown‐expressing adenovirus vector (Ad‐sh‐USP30) injected into the sites of skin wound. (a) Pathologic changes in wound tissue of DFU mice were detected by HE and Masson staining. (b) Wound healing rate in DFU mice. (c) The expression levels of USP30, TRAF6, and iron death‐associated protein proteins (GPX4 and SLC7A11) in DFU mice wound tissues were detected by western blot. (d, e) The levels of ferroptosis‐related markers (MDA and SOD) in the serum of DFU mice were detected through ELISA assay. ***P < 0.001, n = 10. MDA, malondialdehyde; SOD, superoxide dismutase; TRAF6, tumor necrosis factor receptor‐associated factor 6; USP30, ubiquitin‐specific protease 30.

DISCUSSION

The roles of USP30 and TRAF6 in various diseases have been extensively studied ³² , ³³ . It is well‐established that the dysregulated expression of USP30 is closely associated with the initiation and progression of numerous diseases ³⁴ . In breast and lung cancers, it has been discovered that the overexpression of USP30 stabilizes oncogenic proteins, thereby enhancing the proliferation and invasion capabilities of cancer cells. Conversely, inhibiting USP30 activity leads to the degradation of these oncogenic proteins, suppressing cancer cell growth and metastasis ³² , ³⁵ , ³⁶ . Research has shown that increasing the expression level of USP30 activates dynamin‐related protein 1 (DRP1), which in turn modulates insulin responsiveness in individuals with type 2 diabetes ³⁷ .

USP30 plays a crucial role in maintaining mitochondrial homeostasis and functionality. Mitochondria are indispensable “energy factories” within cells ²⁹ , ³⁸ . Any disruption in mitochondrial function can have profound implications in the development of diabetes and its complications, particularly DFU ³⁹ . In patients with DFUs, mitochondrial dysfunction not only significantly slows the wound healing process but also potentially increases the risk of infection ⁴⁰ , ⁴¹ . In the study, it was observed that HG treatment increased the concentrations of Fe²⁺, MDA, and ROS in HUVECs, and decreased the SOD activity. This finding is highly relevant to the context of mitochondrial dysfunction in DFUs. Previous studies have suggested that Fe²⁺ overload can lead to the generation of ROS through the Fenton reaction, which in turn causes oxidative damage to cellular components, including lipids, proteins, and DNA ⁴² . MDA is a well‐known marker of lipid peroxidation, and its increased levels in HG‐treated HUVECs further confirm the presence of oxidative stress ⁴³ . SOD is an important antioxidant enzyme that scavenges superoxide anions, and its decreased activity under HG conditions indicates a compromised antioxidant defense system ⁴⁴ . These changes in Fe²⁺, MDA, ROS, and SOD levels collectively suggest that HG induces oxidative stress and lipid peroxidation in HUVECs, which are key features of mitochondrial dysfunction. Mitochondrial dysfunction can disrupt energy production, impair cell survival and function, and ultimately contribute to the pathogenesis of DFUs, such as by inhibiting endothelial cell proliferation and migration, promoting apoptosis, and affecting angiogenesis ⁴⁵ . Therefore, the significance of USP30 is particularly evident in the complex pathological mechanisms of DFUs. USP30 is not only intimately linked to mitochondrial function but also profoundly influences various aspects of DFU pathogenesis, including vascular pathology, neuropathy, and immune dysfunction ⁴⁶ , ⁴⁷ . This study found that USP30 content was upregulated in HG‐induced HUVECs, stabilizing TRAF6 protein expression through deubiquitination, and thereby exacerbating HG‐induced damage to HUVECs, including inhibiting proliferation and promoting apoptosis and ferroptosis.

TRAF6 serves as a critical node in numerous signaling pathways, participating in the regulation of inflammatory responses and cellular apoptosis processes ⁴⁸ , ⁴⁹ . The dysregulated expression of TRAF6 is closely associated with the initiation and progression of multiple diseases ³⁶ , ⁵⁰ . It has been reported that TRAF6 also plays an important role in the pathogenesis of DFUs. Research has indicated that TRAF6 expression is increased in the aortic tissue of STZ‐induced diabetic mice, and it mediates endothelial dysfunction induced by HG through the NF‐κB and activator protein‐1 (AP‐1) signaling pathways ⁵¹ . This study found that HG can induce high expression of TRAF6 in HUVECs, thereby exacerbating HG‐induced cellular damage. By knocking down TRAF6 expression, it is possible to effectively alleviate the inhibitory effects of HG on HUVECs, promoting cell growth and inhibiting ferroptosis. The results suggest that TRAF6 could potentially become a new therapeutic target for DFUs. Adjusting its expression levels might improve the functionality of vascular endothelial cells and accelerate the healing of DFUs.

During in vivo experiments, this study showed that knocking down USP30 promoted the healing of DFU wounds. Moreover, significant changes were observed in the expression levels of key molecules within the cystine/GSH/GPX4 pathway, which is associated with ferroptosis, following USP30 knockdown. These changes were consistent with the results of in vitro experiments, further confirming the crucial role of USP30 in the pathogenesis of DFU. The changes in the cystine/GSH/GPX4 pathway are also closely related to the oxidative stress and lipid peroxidation observed in our study. GPX4 uses GSH to reduce peroxidized phospholipids, effectively inhibiting cell ferroptosis ⁵² . SLC7A11 facilitates cystine uptake for GSH synthesis. In the STZ‐induced diabetic mouse model, the decreased expression of GPX4 and SLC7A11 and the increased expression of USP30 and TRAF6 in the STZ group compared to the control group suggest an impaired antioxidant defense system and enhanced ferroptosis. When USP30 was knocked down, these expression changes were effectively reversed, indicating that USP30 knockdown can restore the antioxidant capacity and inhibit ferroptosis, thereby promoting DFU wound healing. This is consistent with our in vitro findings that USP30 knockdown alleviates HG‐induced oxidative stress and lipid peroxidation in HUVECs. There are several limitations to this study. First, off‐target effects and potential toxicity from USP30 knockdown may influence experimental outcomes. Moreover, it has been reported that MF‐094, a potent and selective USP30 inhibitor, accelerates diabetic wound healing by inhibiting the NLRP3 inflammasome in diabetic rats ²⁸ . Herein, the current work preliminarily validated that MF‐094 (USP30 inhibitor) addition could improve GPX4 and SLC7A11 expression in HG‐treated HUVECs, verifying that the USP30/TRAF6 axis could regulate ferroptosis in HG‐treated HUVECs. In future studies, we will further investigate the role of MF‐094 in modulating the USP30/TRAF6 axis during hyperglycemia‐induced HUVEC injury and wound healing in diabetic mice. Furthermore, given the crucial role of keratinocytes and fibroblasts in tissue repair, we plan to incorporate these cell types in subsequent experiments to delve deeper into the mechanisms by whih USP30 mediates intercellular interactions. This will enable a more systematic elucidation of the multicellular regulatory mechanisms underlying diabetic wound healing.

In summary, this study elucidates the pivotal roles of USP30 and TRAF6 in the processes of DFU and ferroptosis. USP30 exerts its effects by stabilizing TRAF6. Knocking down USP30 effectively mitigated the damage to HUVECs induced by HG, promoted wound healing, and inhibited ferroptosis. These findings not only provide a new perspective for understanding the pathogenesis of DFU but also offer a crucial basis for identifying potential therapeutic targets.

DISCLOSURE

The authors declare no conflicts of interest.

Approval of the research protocol: All animal experiments were conducted in compliance with the ARRIVE guidelines and approved by the Ethics Committee of the 970th Hospital of the Joint Service Support Force of the Chinese People's Liberation Army.

Informed consent: N/A.

Registry and the registration no. of the study: N/A.

Animal studies: N/A.

Supporting information

Figure S1. TRAF6 expression in glucose‐treated HUVECs. HUVECs were divided into four groups: NG group, 12.5 mm Glucose group, 25 mm Glucose group, and 50 mm Glucose group. (A) Cell viability was assessed using MTT assay. (B) Western blot analysis was performed to assess the effect of Glucose treatment on TRAF6 expression. *P < 0.05, ** P < 0.01, ***P < 0.001, n = 3.

Figure S2. Effect of NG and Mannitol on HUVEC phenotypic behaviors. HUVECs were treated with NG (5.5 mm glucose) or Mannitol (5.5 mm glucose + 19.5 mm Mannitol) for 48 h. (A) HUVEC proliferation was assessed using EdU assay. (B) The apoptotic status of HUVECs was examined using the TUNEL assay. (C–E) The levels of Fe²⁺, MDA, and SOD within HUVECs were determined using specific kits. (F) Flow cytometry was employed to detect the levels of ROS within HUVECs. (G) GPX4 and SLC7A11 protein levels were detected using western blot in treated HUVECs. (H) The wound healing assay was used to assess the migratory capacity of HUVECs. (I) The tube formation assay was performed to evaluate the angiogenic capacity of HUVECs. ns, no significant, n = 3.

Figure S3. Effects of Z‐VAD‐FMK (apoptotic inhibitor) and Fer‐1 (ferroptosis inhibitor) on HG‐mediated HUVEC injury. HUVECs were treated with NG, HG, HG+ Z‐VAD‐FMK, HG + Fer‐1 (ferroptosis inhibitor), and HG + Z‐VAD‐FMK + Fer‐1. (A) TUNEL assay was used to evaluate apoptosis of HUVECs. (B–D) The Fe²⁺, MDA, and SOD levels in HUVECs were determined using specific kits. (E) The ROS levels in HUVECs were analyzed using flow cytometry. (F) GPX4 and SLC7A11 protein levels were detected using western blot assay. **P < 0.01, ***P < 0.001, ns, no significant, n = 3.

Figure S4. Effects of MF‐094 (USP30 inhibitor) on USP30, TRAF6, GPX4, and SLC7A11 expressions in HG‐treated HUVECs. (A–E) USP30, TRAF6, GPX4, and SLC7A11 protein levels were determined using western blot assay in HUVECs treated with NG, HG, or HG + MF‐094. **P < 0.01, ***P < 0.001, n = 3.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.