Intramuscular Myoepithelioma‐Like Hyalinizing Epithelioid Tumor With OGT::FOXO3 Intraexonic DNA Fusion Confirmed by Nanopore Sequencing

ABSTRACT

Myoepithelioma‐like hyalinizing epithelioid tumor (MHET) is a rare mesenchymal neoplasm characterized by rearrangements of the OGT gene. MHET typically presents as a small tumor in the subcutis and generally follows a benign clinical course. Histologically, MHET is characterized by a hyalinized stroma exhibiting a distinctive “two‐tone” appearance, epithelioid tumor cells with cellular processes encircling matrix globules, and a minor spindle cell component. The tumor also demonstrates rich vasculature with occasional fringe‐like vessels, accompanied by perivascular concentric spindle cell proliferation and hyalinization. Nearly all documented OGT fusions in MHET are intraexonic; however, their precise genomic DNA breakpoints and the mechanisms underlying fusion transcript generation remain unclear. We report a case of MHET in a 17‐year‐old boy and investigate the genomic breakpoint of the fusion gene. Although the tumor showed atypical features, including large size, intramuscular location, and focal cytokeratin (CAM5.2) expression, the histologic findings were characteristic of MHET. Reverse transcription‐polymerase chain reaction (RT‐PCR) identified an intraexonic, in‐frame OGT::FOXO3 fusion transcript. To clarify the genomic breakpoint, nanopore DNA sequencing demonstrated that the DNA breakpoint was identical to the fusion junction in the mRNA transcript. These findings demonstrate that the fusion transcript was generated directly from rearranged genomic DNA without splice site involvement. This mechanism may contribute to the rarity of MHET and warrants further investigation.

1. Introduction

Myoepithelioma‐like hyalinizing epithelioid tumor (MHET), also known as OGT‐rearranged mesenchymal tumor, is a recently defined and rare mesenchymal neoplasm characterized by rearrangements of the OGT gene [1]. Fusion partners of the OGT gene include members of the forkhead box (FOXO) family—FOXO1, FOXO3, and FOXO4—as well as CITED1. MHET typically presents as a small tumor in the subcutis and generally follows a benign clinical course [1, 2, 3, 4, 5, 6, 7, 8].

Histologically, MHET is characterized by a hyalinized stroma with a distinctive “two‐tone” appearance, epithelioid tumor cells with cellular processes encircling matrix globules, a minor spindle cell component, and rich vasculature. Occasional fringe‐like vessels accompanied by perivascular concentric spindle cell proliferation and hyalinization may also be observed [1]. Immunohistochemically, MHET is typically positive for CD34 and CD99; however, it is negative for S100, GFAP, p63, and SMA, which are markers characteristic of true myoepithelial tumors [1]. A minority of MHETs show cytokeratin or CD4 positivity.

In most gene fusions, genomic rearrangements occur within introns, producing canonical exon–exon junctions in the mRNA through RNA splicing. However, tumors harboring “intraexonic” fusions, in which the breakpoint occurs within an exon, have also been reported. Intriguingly, nearly all documented fusions in MHET are intraexonic; however, the precise genomic DNA breakpoints remain unknown. In particular, it is unclear whether these intraexonic fusions result from alternative splicing or from direct intraexon–intraexon DNA fusion.

In this report, we present a case of MHET in a 17‐year‐old boy. Although the large tumor size, intramuscular location, and focal cytokeratin expression were atypical for MHET, we identified an OGT::FOXO3 fusion transcript using reverse transcription‐polymerase chain reaction (RT‐PCR), establishing the diagnosis of MHET. Furthermore, we performed nanopore sequencing to analyze the genomic DNA of the tumor.

2. Case Presentation

2.1. Clinical Findings

A 17‐year‐old boy was referred to our hospital with a painless intramuscular mass in the left medial forearm. Medical and family histories were unremarkable, and there was no history of trauma. Magnetic resonance imaging (MRI) revealed a 15 × 4 × 4 cm intramuscular mass with smooth margins within the muscle. The mass showed slightly high signal intensity on T1‐weighted images (Figure 1A) and heterogeneous high signal intensity on T2‐weighted images, with peripheral flow voids observed at the edge of the tumor margin (Figure 1B).

FIGURE 1.

Radiological and pathological findings of the tumor. T1‐weighted MRI reveals a 15 × 4 × 4 cm intramuscular mass with slightly high signal intensity (A). T2‐weighted MRI showed heterogeneous high signal intensity with flow voids at the periphery (B). The surgically resected specimen was a smooth‐surfaced, firm, solid tumor (C). Low‐power histology shows the characteristic “two‐tone” stroma (D). Higher magnification shows uniform epithelioid to spindle tumor cells with minimal cytologic atypia (E). Epithelioid cells with cellular processes encircling matrix globules are observed (F). The tumor displays rich vasculature (G), including focal fringe‐like small vessels (H). Perivascular whorling and concentric spindle cell proliferation are evident (I). Immunohistochemistry demonstrates positivity for CD34 (J), CAM5.2 (K), and CD4 (L).

Although two needle biopsies were performed, a definitive diagnosis could not be established. The tumor was subsequently treated with marginal excision. The patient remained disease‐free 36 months post‐surgery.

2.2. Surgical Resection

A 15.5 × 7.0 × 4.0 cm, smooth‐surfaced, firm, solid tumor was surgically resected (Figure 1C). The cut surface showed a milky‐white to light brown appearance with scattered blood vessels.

Histologically, the stroma exhibited a characteristic “two‐tone appearance,” consisting of alternating densely hyalinized areas and hypercellular myxoid or fibrous zones (Figure 1D). The tumor consisted of epithelioid‐to‐spindle cells with minimal cytologic atypia, arranged in areas of varying cellularity (Figure 1E). Epithelioid tumor cells with cellular processes encircling matrix globules were also observed (Figure 1F). The tumor displayed rich vasculature (Figure 1G), including small fringe‐like vessels (Figure 1H). Patterns of perivascular whorling and concentric spindle cell proliferation were also present (Figure 1I). Mitotic activity was inconspicuous, and tumor necrosis was absent.

Immunohistochemical analysis demonstrated that tumor cells were diffusely positive for CD99 and CD34 (Figure 1J), whereas CAM5.2 (Figure 1K), ERG, and CD4 (Figure 1L) were focally positive. The tumor cells were negative for AE1/AE3, EMA, SMA, S‐100 protein, STAT6, GLUT1, MUC4, MDM2, myoD1, PLAG1, and SOX10. Rb expression was retained.

2.3. RT‐PCR

RT‐PCR was performed using primer pairs 3′‐GGAGCATTATGCAGCTGGCAAC‐5′ and 3′‐CAGGTTTCCCCAGGCGTTCC‐5′, followed by Sanger sequencing. This analysis revealed an in‐frame intraexonic fusion involving OGT (NM_181672.3, exon 22, intraexonic) and FOXO3 (NM_001455.4, exon 1, intraexonic) (Figure 2A).

FIGURE 2.

Molecular identification of the OGT::FOXO3 fusion. Sanger sequencing chromatogram of the RT‐PCR product confirms an intraexonic and in‐frame fusion of OGT (exon 22) and FOXO3 (exon 1) (A). Nanopore DNA sequencing identifies the corresponding OGT::FOXO3 intraexonic fusion at the genomic level, with breakpoints identical to mRNA fusion (B).

Based on these molecular findings, a definitive diagnosis of MHET was established.

2.4. Nanopore Sequencing

Nanopore DNA sequencing was performed as previously described [9]. DNA was extracted from fresh‐frozen tumor tissue using a Zymo Extraction Kit (D6015 and D4013; Zymo Research, Irvine, CA, USA) according to the published protocol. The library was prepared using the Ligation Sequencing Kit V14 (SQK‐LSK114; Oxford Nanopore Technologies, Oxford, United Kingdom) following the manufacturer's instructions.

Sequencing was performed for 72 h using a Mk1B sequencer with a MinION Flow Cell R10.4.1 (FLO‐MIN114, Oxford Nanopore Technologies). Data acquisition was performed in adaptive sampling mode using MinKNOW 22.10.7 on a Windows 10 desktop computer equipped with an NVIDIA RTX A4000.

The FAST5 files were converted to POD5 format using the pod5 tool, and base‐calling was performed using Dorado version 0.4.0 with a high‐accuracy model (dna_r10.4.1_e8.2_400bps_hac@v4.0.0).

Structural variants were identified using SVIM. This analysis detected an OGT::FOXO3 genomic fusion, with a breakpoint identical to the fusion junction identified in the mRNA transcript (Figure 2B).

3. Discussion

We report a case of MHET. Although the large tumor size, intramuscular location, and focal cytokeratin expression were atypical for MHET, the tumor exhibited several characteristic histologic features. These included a “two‐tone” stroma, epithelioid tumor cells with cellular processes encircling matrix globules, rich vasculature, fringe‐like vessels, and perivascular whorling [1]. Based on these distinctive morphologic findings, molecular analyses identified an OGT::FOXO3 fusion, thereby establishing the diagnosis of MHET.

MHET is a rare mesenchymal tumor that can affect patients across a wide age range (Table S1) [1, 2, 3, 4, 5, 6, 7, 8]. Reported cases include individuals from early adulthood to 96 years of age. Although MHET most commonly arises in the subcutis of acral soft tissues, such as the hands and feet, tumors occurring in non‐acral locations, including the shoulder, forearm, and buttocks, have also been documented. To the best of our knowledge, the present case represents the first reported intramuscular MHET. Clinical follow‐up data remain limited; however, no recurrences or metastases have been reported to date. Consistent with previous reports, the patient in our case has remained disease‐free for 36 months after surgery, supporting the generally benign clinical course of MHET.

The immunohistochemical profile of MHET is generally nonspecific, as summarized in Table S1. CD34 (8/8) and CD99 (2/2) have been consistently positive and were also positive in the present tumor. EMA (6/8) is frequently positive, whereas cytokeratin (2/8) is only rarely expressed. Therefore, the focal cytokeratin (CAM5.2) positivity and EMA negativity observed in this case represent an unusual and potentially misleading finding. CD4 positivity was observed in 1 of 2 MHET cases [1] and was also observed in the present case. Further investigations in larger cohorts are warranted to elucidate the diagnostic utility of CD4 immunohistochemistry in MHET.

Based on the histologic findings and nonspecific immunohistochemical profile, the differential diagnosis included several tumors. A comprehensive panel of immunostains was performed to exclude these tumors. Sclerosing well‐differentiated liposarcoma typically shows MDM2 positivity. Spindle cell/sclerosing rhabdomyosarcoma is MyoD1‐positive. Low‐grade fibromyxoid sarcoma shows MUC4 positivity. YAP1::KMT2A‐rearranged sarcoma and soft tissue angiofibroma are usually EMA‐positive. Epithelioid hemangioendothelioma exhibits strong, diffuse ERG expression. Solitary fibrous tumor is characterized by STAT6 positivity. Ossifying fibromyxoid tumor often shows focal S‐100 protein and MUC4 positivity. Myoepithelioma is typically S100‐positive. Following exclusion of these entities by immunohistochemistry, RT‐PCR analysis detected an intra‐exonic, in‐frame OGT::FOXO3 fusion transcript, confirming the diagnosis.

The genetic hallmark of MHET is recurrent fusion of OGT with members of the FOXO family (FOXO1, FOXO3, and FOXO4) or CITED1 [1, 2, 3, 4, 5, 6, 7, 8]. A distinctive feature of these fusions is the presence of intraexonic breakpoints, rather than the typical exon–exon junctions seen in most gene fusions. In previously reported cases with available sequence data, these fusions were consistently in‐frame, except for one case involving an exon–intron junction. While genomic rearrangements in most fusion‐driven tumors occur within introns, resulting in exon–exon fusion transcripts, intra‐exonic rearrangements have also been documented in several other bone and soft tissue tumors. Examples include chondroid lipoma [10], BCOR::CCNB3 sarcoma [11], CIC::DUX4 sarcoma [12, 13, 14, 15, 16, 17], and FOS‐rearranged neoplasms such as osteoid osteoma [18], osteoblastoma [18, 19, 20, 21], epithelioid hemangioma [22, 23], and proliferative fasciitis/myositis [24]. We recently reported a case of dermatofibroma with an intra‐exonic CD63::PRKCD fusion [25]. These previously reported intraexonic mRNA breakpoints are in Table S2. To determine whether intraexonic mRNA fusion arise from intraexonic splicing or direct intraexon‐intraexon DNA fusion, we searched the genomic sequences corresponding to the mRNA breakpoints. Cases containing insertion sequences were excluded because the splice site sequences could not be reliably evaluated.

In chondroid lipoma, BCOR::CCNB3 sarcoma, and dermatofibroma, fusion transcripts may be generated through splicing at splice donor sequences (GT) located within exons. Based on these observations, we initially hypothesized that the OGT::FOXO3 fusion transcript might arise through a similar splicing mechanism involving GT/AG sequences within the exons of OGT and FOXO3. However, analysis of the DNA sequence at the fusion junction revealed no splice‐site signals.

To clarify the precise genomic breakpoint, nanopore DNA sequencing was performed. This analysis successfully identified the OGT::FOXO3 genomic fusion and revealed that the DNA breakpoint was identical to the fusion junction in the mRNA transcript. These findings demonstrated that the fusion transcript was generated directly from the rearranged genomic DNA without splicing at the junction. Notably, previously reported MHET cases also lacked splice‐site sequences, supporting the hypothesis of direct intra‐exon–intra‐exon DNA fusion.

Compared with tumors characterized by conventional exon–exon fusion events, the rarity of MHET may be associated with the requirement for intra‐exonic genomic breakpoints, because protein‐coding exons are generally much shorter than introns. In the human genome, the intron‐to‐exon ratio is estimated to be approximately 10–20. Consistent with this observation, OGT and FOXO3 genes contain relatively long introns and short exons, with an intron–exon ratio of 7.87 and 16.98, respectively.

Direct intraexonic DNA fusion without canonical GT/AG splice‐site sequences has also been observed in FOS‐rearranged neoplasms and CIC::DUX4 sarcomas, which occur far more frequently than MHET. However, OGT‐rearrangements may be more difficult to generate. For instance, in contrast to the in‐frame fusions observed in MHET, FOS fusions often involve non‐coding sequences that produce a non‐functional C‐terminus, which may arise readily through random genomic events. CIC::DUX4 sarcomas generally harbor intraexonic in‐frame fusion transcripts, although one exception has been reported [12]. The highly repetitive sequence of DUX4 may contribute to the higher incidence of CIC::DUX4 sarcomas compared with MHET. Further studies are needed to elucidate the relationship between DNA breakpoints and tumor incidence.

In conclusion, we report a case of cytokeratin‐positive intramuscular MHET. Despite atypical features, including large tumor size, intramuscular location, and focal cytokeratin expression, the tumor exhibited characteristic histologic features, and an intraexonic in‐frame OGT::FOXO3 fusion transcript was detected by RT‐PCR. Nanopore DNA sequencing further demonstrated that the genomic fusion breakpoint was identical to the mRNA junction, indicating direct intraexon–intraexon DNA fusion without splice‐site involvement. This unusual fusion mechanism may be associated with the rarity of MHET. Further studies are required to elucidate the relationship between genomic breakpoint architecture and tumor incidence.

Author Contributions

N.T. wrote the manuscript. N.M. conceived and designed the study and contributed to writing, editing, and review of the manuscript. N.T., N.M., M.O., Y.A., T.S., and A.A. performed histological assessments. N.M., H. Kageyama, and M.K. performed the molecular analyses. H. Kinoshita, H. Kamoda, Y.H., and T.Y. collected the clinical samples. All authors reviewed and approved the final manuscript.

Funding

This work was supported in part by the Japan Society for the Promotion of Science KAKENHI (Grant No. JP23K06438, N.M.), the Takeda Science Foundation (N.M. and M.K.), the Foundation for Promotion of Cancer Research in Japan (N.M.), and the ICHIRO KANEHARA Foundation for the Promotion of Medical Science and Medical Care (N.M.).

Ethics Statement

This study was approved by the Chiba Cancer Center Institutional Review Board (Approval No. M04‐005).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Table S1: Reported cases of myoepithelioma‐like hyalinizing epithelioid tumor.

Table S2: Reported cases of tumors with intra‐exonic fusions.

Data Availability Statement

The datasets generated and analyzed during the current study are available from the corresponding author upon reasonable request and with institutional review board approval.