METTL14 Downregulation Accelerates HBV‐Related Cirrhosis and Hepatocellular Carcinoma by Promoting Type I Interferon Release via the cGAS–STING Pathway Through m⁶A Modification

ABSTRACT

The pathogenesis of Hepatitis B virus (HBV)‐related cirrhosis and hepatocellular carcinoma (HCC) has not been fully elucidated at present. While METTL14 is crucial in innate immunity, its specific role in HBV‐related liver disease progression is unclear. We analyzed METTL14 expression in patient tissues and bioinformatics datasets. Mouse models of HBV‐related cirrhosis and HCC were established to evaluate liver injury, fibrosis, and tumorigenesis. Mechanistic studies utilized MeRIPqPCR, RIP, and Actinomycin D assays, and hepatocyte‐stellate cell co‐cultures to investigate METTL14's impact on cGAS mRNA stability, the cGAS‐STING pathway, and IFNB1 secretion. METTL14 was downregulated in HBV infection, cirrhosis, and HCC. METTL14 knockdown aggravated liver injury, fibrosis, and tumor formation in mice. Mechanistic studies revealed that METTL14 overexpression in HBV‐infected hepatocytes promoted the degradation of cGAS mRNA by increasing its m6A modification, thereby suppressing the cGAS–STING pathway activation and IFNB1 release. Consequently, METTL14 overexpression inhibited stellate cell activation, which was reversed by cGAS‐STING agonists. Downregulation of METTL14 reduces the degradation of cGAS mRNA through m⁶A modification, facilitates the cGAS–STING pathway activation and IFNB1 release, thereby accelerating HBV‐related cirrhosis and HCC progressions.

1. Introduction

Hepatocellular carcinoma (HCC) is the third most common cause of cancer‐related deaths worldwide [1]. HCC treatment is extremely challenging, and most patients have a short survival time after diagnosis [2]. Advanced HCC patients typically exhibit a median survival of only 6–10 months [3]. Epidemiological data indicate that more than half of HCC cases globally are caused by Hepatitis B virus (HBV) infection [4], suggesting that HBV infection is a key part of HCC pathogenesis. Furthermore, the finding of chronic HBV infection inducing persistent hepatitis has been confirmed [5]. During chronic hepatitis progression, sustained hepatocyte damage and repair result in liver fibrosis, eventually developing into cirrhosis [6]. As a significant precancerous lesion, cirrhosis, with its abnormal microenvironment and persistent inflammation, markedly increases the risk of malignant transformation of hepatocytes and serves as the primary pathological basis for HCC occurrence [7]. Thus, it is necessary to investigate deeply the molecular mechanisms of HBV‐related cirrhosis and HCC to seek new therapeutic targets.

In the process of HBV infection leading to HCC, persistent liver inflammation is a key carcinogenic factor [8, 9]. During this process, aberrantly activated innate immune signaling pathways may further exacerbate the inflammation. The cyclic GMP‐AMP synthase (cGAS)–stimulator of interferon genes (STING) signaling pathway, as an immune sensor of cytosolic DNA, can recognize mis‐localized nuclear DNA or mitochondrial DNA‐derived double‐stranded DNA. By triggering type I interferon responses and proinflammatory cytokine release, it assumes a pivotal role in HBV‐related chronic liver inflammation [10]. However, the specific molecular mechanisms by which activation of the cGAS–STING–IFN1 pathway affects the progression of HBV‐related cirrhosis and HCC remain to be further elucidated.

Methyltransferase‐like protein 14 (METTL14) is a core catalytic component of the m⁶A methyltransferase complex. It collaborates with METTL3 to catalyze the methylation of the sixth nitrogen atom of adenosine in RNA, thereby regulating gene expression, RNA stability, and translation efficiency [11]. Downregulated in HCC tissues and cells, METTL14 suppresses HCC cell migration and invasion via m⁶A methylation of ribosomal protein large P2 (RPLP2) [12]. In summary, METTL14 may play a critical role in HCC through m⁶A modification, but its regulatory mechanism in the progression of HBV‐related cirrhosis and HCC needs further investigation.

In this study, we found low expression of METTL14 in HBV‐related HCC. Its downregulation leads to reduced m⁶A modification of cGAS mRNA, thereby inhibiting cGAS mRNA degradation, activating the cGAS–STING pathway, promoting IFN‐I release, and ultimately accelerating HBV‐related cirrhosis and HCC progressions. Overall, this study identifies METTL14 as crucial in HBV‐related cirrhosis and HCC, offering novel perspectives for developing targeted epigenetic therapies.

2. Materials and Methods

2.1. Collection of Clinical Tumor Tissue Samples From Patients With HBV‐Related HCC

This study collected 10 pairs of paraffin‐embedded HBV‐related HCC samples, non‐HBV‐related HCC tumor tissues, and adjacent normal tissues (Normal) from postoperative patients at General Hospital of Ningxia Medical University from 2024.7 to 2025.4. The collection of clinical samples followed strict ethical guidelines. Informed consent was secured from all patients prior to sample collection, and all experimental protocols received approval from the Medical Research Ethics Review Committee of General Hospital of Ningxia Medical University (No. KYLL‐2024‐0932).

2.2. Bioinformatics Analysis

First, data sets of cirrhosis, HCC, and normal liver tissues (GSE25097) were downloaded from the GEO database. Second, the Wilcoxon test was applied to compare METTL14 expression levels in cirrhosis, HCC tissues, and normal liver tissues. The m⁶A modification sites of cGAS were forecasted in the SRAMP website (http://www.cuilab.cn/sramp).

2.3. Cell Transfection and Lentivirus Preparation

Short hairpin RNA targeting METTL14 (sh‐METTL14) and overexpression vector (oe‐METTL14), along with corresponding control empty plasmids, were sourced commercially from Shanghai Hanheng Biotechnology Co. Ltd. (China). Upon reaching a suitable state for transfection (approximately 70%–80% confluency), transfection was performed utilizing Lipofectamine™ transfection reagent (Invitrogen, USA). Transfection efficiency was confirmed via qRT‐PCR 48 h post‐transfection.

To prepare lentiviral particles, human embryonic kidney 293 T cells underwent an inoculation in 6‐well plates and co‐transfected employing a three‐plasmid system: including sh‐METTL14 or shRNA, the packaging plasmid pSPAX2, and the envelope plasmid pVSV‐G (Nanjing Jiangyuan Biotechnology, China). Lentiviral particle‐containing supernatant was collected 72 h post‐transfection, filtered (0.45 μm), aliquoted, and stored at −80°C.

2.4. Construction of HBV‐Infected Cirrhosis and HCC Mouse Models

This study involved 12 wild‐type C57BL/6 mice and 24 C57BL/6‐HBV transgenic mice (HBs‐Tg) (Beijing Vitalstar Biotechnology Co. Ltd., China), all maintained under SPF conditions. Immune‐mediated liver injury was induced in C57BL/6‐HBV transgenic mice via intraperitoneal injection of CD137 monoclonal antibody (BE0239, Bio X Cell, USA) for seven consecutive weeks, followed by tail vein administration of lentivirus to establish animal models of HBV‐associated liver cirrhosis and HCC. The experiment was randomly divided into three groups blindly (n = 12/group): WT‐sh‐NC group (wild‐type control + lentiviral empty vector control), HBs‐tg‐sh‐NC group (HBV transgenic + CD137 antibody treatment + lentiviral empty vector control), and HBs‐tg+sh‐METTL14 group (HBV transgenic + CD137 antibody + lentivirus‐mediated METTL14 knockdown). Samples were collected on day 21 (with six mice sacrificed per group) to evaluate the progression of liver cirrhosis and fibrosis, while the remaining animals were maintained until the 7‐month endpoint before sacrifice. Liver tissues and serum were then harvested to assess the incidence and pathological characteristics of macroscopic HCC tumor nodules. All experimental procedures complied with animal ethics regulations and were approved by the Medical Research Ethics Review Committee of General Hospital of Ningxia Medical University (No. KYLL‐2024‐0932).

2.5. Kit Detection of Alanine Aminotransferase (ALT) and Aspartate Aminotransferase (AST) Levels

Employing the enzyme kinetics approach, we determined liver function indicators. ALT activity was quantified with the ALT Assay Kit, while AST activity was assessed with the AST Assay Kit (both from Nanjing Jiancheng Bioengineering Institute, China). By employing a full‐wavelength microplate reader (Bio‐Rad, USA), absorbance values were detected at specific wavelengths (505 nm). Standard controls and quality control samples were incorporated into each experiment.

2.6. Histological Staining

First, dissected mouse liver tissues were subjected to fixation with 4% paraformaldehyde (Solarbio, China) for 24 h to maintain tissue morphological integrity. Following dehydration in a graded ethanol series and xylene clearing, the tissues were paraffin‐embedded, and continuous sections (5 μm thickness) were prepared for subsequent staining analysis. Hematoxylin and eosin (HE) staining kit (Solarbio, China) was employed to stain liver tissues to evaluate basic pathological alterations, including histological features such as inflammation and liver nodules. Briefly, after baking to secure tissue, sections underwent dewaxing in xylene and rehydration via an ethanol gradient. This was followed by hematoxylin staining and rinsing with flowing water, differentiation with hydrochloric acid in ethanol, eosin staining, dehydration through a graded ethanol series, clearing with xylene, and finally mounting with neutral gum.

Simultaneously, the Sirius Red staining kit (Solarbio, China) was leveraged to stain liver tissues to analyze the liver fibrosis degree and collagen deposit distribution. Briefly, after dewaxing and rehydration, tissue sections were stained with Sirius Red staining solution (0.1% in saturated picric acid), rinsed with flowing water, counterstained with hematoxylin, quickly dehydrated, cleared, and mounted. Images were acquired via an inverted microscope (Zeiss, Germany).

2.7. Terminal Deoxynucleotidyl Transferase (TdT) Nick‐End Labeling (TUNEL) Staining

We leveraged a TUNEL apoptosis detection kit (Abcam, UK) to assess apoptosis in liver tissue cells. After dewaxing with xylene and hydration via a graded ethanol series, paraffin sections were incubated with TdT enzyme reaction mixture (37°C, 60 min). After PBS washing, DAB (Beyotime, China) chromogenic solution was introduced for color development, and nuclei were counterstained with hematoxylin. After mounting with neutral gum, images were observed and acquired by a laser scanning confocal microscope (Zeiss, Germany).

2.8. Immunohistochemical (IHC) Analysis

IHC analysis was performed to detect the expression levels of HBsAg, α‐smooth muscle actin (α‐SMA), and Ki67 in mouse liver tissues. Paraffin sections underwent dewaxing in xylene (Sinopharm Group, China) followed by rehydration via an ethanol gradient (Sinopharm Group, China). Microwave heat‐induced epitope retrieval was constructed utilizing sodium citrate buffer (Beyotime, China). Subsequently, sections underwent sequential blocking: endogenous peroxidase activity was quenched with 3% hydrogen peroxide (Sinopharm Group, China) for 10 min, followed by blocking of nonspecific sites with 5% BSA (Solarbio, China) for 30 min. The sections were incubated overnight at 4°C with HBsAg antibody (ab68520, Abcam), α‐SMA antibody (ab5694, Abcam, UK), and Ki67 antibody (ab16667, Abcam, UK), respectively, followed by 1 h room temperature incubation with HRP‐conjugated goat anti‐rabbit secondary antibody (ab205718, Abcam, UK). After color development with DAB (Beyotime, China), nuclei were counterstained with hematoxylin (Solarbio, China). IHC images were analyzed by ImageJ (NIH, USA).

2.9. Western Blot (WB)

The collected cell samples from each experimental group were lysed on ice for 15 min utilizing RIPA lysis buffer (Beyotime, China) containing protease inhibitors and underwent centrifugation at 4°C and 12,000 × g for 20 min to harvest the supernatant. Following quantification with a BCA protein detection kit (Invitrogen, USA), equal protein loads were separated via 4%–20% SDS‐PAGE (Bio‐Rad, USA) and transferred to PVDF membranes (Millipore, USA). The membranes were then blocked with 5% skim milk for 1 h before sequential incubation with primary and secondary antibodies. Finally, signals were developed using the ECL substrate (Invitrogen, USA) and visualized through a ChemiDoc imaging system (Bio‐Rad, USA). The following primary antibodies were involved: rabbit anti‐METTL14 (ab252562, Abcam, UK), rabbit anti‐cGAS (PQA3430, Abmart, China), rabbit anti‐STING (PA5‐23381, Invitrogen, USA), rabbit anti‐IRF3 (MA5‐32348, Invitrogen, USA), rabbit anti‐p‐IRF3 (ab76493, Abcam, UK), rabbit anti‐IFNB1 (PA6218, Abmart, China), rabbit anti‐α‐SMA (14395‐1‐AP, Proteintech, China), rabbit anti‐COL1A1 (PA5‐29569, Invitrogen, USA), rabbit anti‐TIMP1 (16644‐1‐AP, Proteintech, China), rabbit anti‐β‐actin (ab8227, Abcam, UK), Anti‐SLC10A1/NTCP1 (ab131084, Abcam, UK), and CYP3A4 (18227‐1‐AP, Proteintech, China). Additionally, the secondary antibody applied in this study was goat anti‐rabbit IgG H&L (HRP) antibody (ab205718, Abcam, UK).

2.10. qRT‐PCR

Total RNA was isolated using an RNA extraction kit (TaKaRa, Japan), followed by concentration and purity assessment via a NanoDrop spectrophotometer (Thermo Fisher, USA). Complementary DNA was synthesized by reverse transcription, leveraging PrimeScript RT Master Mix (TaKaRa, Japan). Subsequently, qRT‐PCR was constructed on an ABI 7500 system (Applied Biosystems, USA) utilizing TB Green Premix Ex Taq II (TaKaRa, Japan). Data were analyzed via the 2^−ΔΔCT method with β‐actin as the internal reference gene. The primer sequences are provided in Table 1.

Table 1.

Primer sequence table of qRT‐PCR.

Primer	Forward (5′‐3′)	Reverse (5′‐3′)	Species
cGAS	AATGATACAGCGCAGCGAGA	CTGCAACAACCCATGCAACA	Mus musculus
STING	GCTGCTGATGCCATACTCCA	TGGATCCTTTGCCACCCAAA	Mus musculus
IRF3	GGGACAAAACACAGCATGGC	TGCTCCACGTAGGGACAATG	Mus musculus
IFNB1	AACTCCACCAGCAGACAGTG	GGTACCTTTGCACCCTCCAG	Mus musculus
β‐actin	CACTGTCGAGTCGCGTCC	CGCAGCGATATCGTCATCCA	Mus musculus
METTL14	GTAGCACAGACGGGGACTTC	AGGCGTCTTCTACCAAGACAA	Homo sapiens
METTL3	CAAGGCTTCAACCAGGGTCT	GGGTTGCACATTGTGTGGTC	Homo sapiens
cGAS	GAAGGCCTGCGCATTCAAAA	GTGAGAGAAGGATAGCCGCC	Homo sapiens
STING	GACCCCAACATTCGCTTCCT	GTCATCTGCAGGTTCCGCT	Homo sapiens
IRF3	TTCATTGTAGGCTCCTGGGC	GCACAACCTTGACCATCACG	Homo sapiens
IFNB1	TCTCCTGTTGTGCTTCTCCAC	GCCTCCCATTCAATTGCCAC	Homo sapiens
β‐actin	TTCACAATGTGGCCGAGGA	AGTGGGGTGGCTTTTAGGATG	Homo sapiens

2.11. ELISA

Utilizing ELISA, we measured the levels of liver fibrosis‐related factors in homogenates derived from mouse liver tissue. Fibrosis assessment was conducted by using mouse‐specific Hydroxyproline (Elabscience, China) and Hyaluronic Acid (CUSABIO, China) ELISA kits, while IFNB1 expression levels were evaluated with mouse‐specific (absin, China) and human‐specific IFNB1 (COIBO, China) ELISA kits. Absorbance was read on a full‐wavelength microplate reader (Bio‐Rad, USA). Samples were run in triplicate wells, and the entire experiment was performed three times independently.

2.12. Cell Culture and Reagents

This study involved Human normal hepatocyte MIHA (ML096857, MLBio, China), human normal hepatic stellate cell LX‐2 (GNHu58, TCCCAS, China), and human embryonic kidney cell 293 T (SCSP‐502, TCCCAS, China). RPMI‐1640 complete medium (Gibco, USA) containing 1% double antibiotics (Solarbio, China) and 10% FBS (BNCC, China) was applied for the culture of MIHA cells. LX‐2 cells were cultured in DMEM complete medium (Procell, China) with 5% FBS, while 293 T cells were grown in DMEM‐H complete medium (BNCC, China) containing 1% double antibiotics, 1% glutamine (Gibco, USA), and 10% FBS. All cells were grown in an incubator (Thermo Fisher, USA) at 37°C with 5% CO₂.

2.13. Construction of HBV‐Susceptible MIHA Cell Model

MIHA cells were seeded into 24‐well plates at a density of 1 × 10⁵ cells per well and cultured overnight in an incubator at 37°C with 5% CO₂ to ensure sufficient cell adherence. Lentiviruses harboring NTCP and wild‐type CYP3A4 were designed, packaged, and concentrated by Shanghai Genechem Co. Ltd. For every 1 × 10⁵ MIHA cells, infection was performed using 500 μL of complete culture medium containing the corresponding lentivirus at a multiplicity of infection (MOI) of 10. The infection efficiency was evaluated by RT‐qPCR, WB analysis, and immunofluorescence staining [13].

2.14. HBV Infection Assay

Genotype D HBV particles were extracted from the culture supernatant of HepG2.2.15 cells. After centrifugation at 1000 rpm to remove debris, the viral suspension was filtered through a 0.22 μm filter and mixed with PEG8000 to a final concentration of 8%. Following gentle agitation at 4°C for 6 h, the mixture was centrifuged at 12,000 rpm for 20 min at 4°C. The viral pellet was resuspended in 2% serum‐containing medium, aliquoted, and stored at −80°C. Viral titers were determined using a commercial HBV DNA quantification kit. Cells in the HBV infection group were treated with pre‐diluted concentrated HBV solution (10⁵ IU/L HBV DNA), whereas control cells were incubated with complete medium alone. After 24 h of incubation, the cells were maintained in fresh complete DMEM supplemented with 10% FBS. Cell pellets were harvested at 72 h post‐infection for subsequent DNA extraction.

2.15. HBV DNA Quantification

After infection, the culture medium was discarded, and cells were rinsed with PBS. Total cellular genomic DNA was extracted using the NucleoSpin Tissue kit (Macherey‐Nagel, Düren, Germany). Quantitative detection of HBV DNA was performed using an ABI 7500 real‐time fluorescent quantitative PCR system (Applied Biosystems, USA). The relative copy number of HBV DNA was calculated using the 2^−ΔΔCT method with β‐actin as the internal reference gene. The primers used are listed in Table 2.

Table 2.

Primer sequence table of qRT‐PCR.

Primer	Forward (5′‐3′)	Reverse (5′‐3′)	Species
HBV DNA	GTTGCCCGTTTGTCCTCTAATTC	GGAGGGATACATAGAGGTTCCTTGA	Homo sapiens
β‐actin	TTCACAATGTGGCCGAGGA	AGTGGGGTGGCTTTTAGGATG	Homo sapiens

2.16. HBsAg Detection

Serum levels of HBsAg were measured using an HBsAg ELISA detection kit (Shanghai Jianglai Biotechnology Co. Ltd., China). Procedures were performed strictly in accordance with the manufacturer's instructions. The absorbance at 450 nm was measured using a microplate reader, and HBsAg concentrations were calculated based on the standard curve.

2.17. MeRIP‐qPCR

The BeyoRIP RNA Immunoprecipitation Detection Kit (Beyotime, China) was employed to analyze m⁶A modification. Specifically, total RNA was isolated by implementing an RNA extraction kit (TaKaRa, Japan) and fragmented to 100–200 nucleotides. Subsequently, Protein A/G Agarose was mixed and incubated with rabbit anti‐m⁶A antibody (A19841, ABclonal, China) at 4°C for 2 h with rotation. After centrifugation at 4°C and approximately 1000 × g for 1 min, the supernatant of the pre‐bound Protein A/G Agarose was removed. Then, 5 μg of fragmented RNA and 40 U of RNase inhibitor (Beyotime, China) were added and incubated at 4°C for 6 h. After digestion with proteinase K (Solarbio, China) at 55°C for 1 h to release the RNA, the RNA was extracted. Finally, qRT‐PCR was employed to detect the enrichment level.

2.18. RNA Stability Assay

To determine the half‐life of cGAS mRNA, we utilized the transcription blocker actinomycin D (ActD). Specifically, HBV‐infected MIHA cells (grouped: sh‐NC, sh‐METTL14) were treated with 5 μg/mL ActD (Selleck, China). Cells were harvested at 0, 3, and 6 h, and total RNA was extracted. cGAS mRNA levels were measured via qRT‐PCR following the established protocol.

2.19. Co‐Culture System

We applied a Transwell co‐culture system (Corning, USA) to evaluate the interaction between human normal hepatocyte MIHA and normal hepatic stellate cell LX‐2. Specifically, the basal chamber received LX‐2 cells (5 × 10⁴ cells/well) in DMEM complete medium (Procell, China) containing 5% FBS (BNCC, China), while the apical chamber housed MIHA cells (2.5 × 10⁴ cells/well) in RPMI‐1640 complete medium (Gibco, USA) with 10% FBS. The co‐culture system was maintained in an incubator (Thermo Fisher, USA) at 37°C with 5% CO₂, with medium renewal occurring every 48 h.

2.20. Immunofluorescence (IF)

IF was leveraged to assess the activation status of human normal hepatic stellate cells in the co‐culture system. Briefly, after co‐culture, cells were subjected to 15‐min fixation with 4% paraformaldehyde (Solarbio, China), 20‐min permeabilization with 0.5% polyethylene glycol tert‐octylphenyl ether (Triton X‐100, Solarbio, China), and 1‐h blocking with 5% BSA (Solarbio, China). Subsequently, cells were incubated with rabbit anti‐α‐SMA primary antibody (14395‐1‐AP, Proteintech, China) at 4°C overnight, followed by 1‐h incubation with Alexa Fluor 488‐labeled goat anti‐rabbit secondary antibody (ab150077, Abcam, UK) at room temperature in the absence of light. After nuclear staining with DAPI (Invitrogen, USA), images were collected via a laser scanning confocal microscope (Zeiss, Germany).

2.21. Dot Blot Analysis

Total RNA was extracted from liver tissues (Non‐HBV‐HCC and HBV‐HCC) using TRIzol reagent (Invitrogen). A total of 400 ng RNA per sample was transferred onto a nitrocellulose membrane (Amersham, GE Healthcare), followed by ultraviolet cross‐linking. The membrane was then blocked with TBST containing 5% non‐fat milk and incubated with an anti‐m⁶A antibody (Abcam) overnight at 4°C. Staining with 0.02% methylene blue served as a loading control. Signal intensities were quantified using ImageJ software and normalized to methylene blue staining results.

2.22. Flow Cytometry

Mouse liver tissues were minced and digested to prepare single‐cell suspensions. For intracellular cytokine detection, cells were stimulated ex vivo with PMA and ionomycin (BioLegend, USA) in the presence of Brefeldin A and incubated at 37°C for 4 h. After stimulation, cells were fixed and permeabilized using the Tru‐Nuclear Transcription Factor kit (BioLegend), followed by staining with anti‐CD8α antibody and anti‐IFN‐γ antibody, respectively. Stained samples were analyzed on a flow cytometer (Agilent, USA), with data processed using corresponding software (Agilent, USA) in strict accordance with the manufacturer's protocols.

2.23. RNA Immunoprecipitation (RIP)

RNA immunoprecipitation was performed using the Magna RIP RNA‐Binding Protein Immunoprecipitation Kit (Millipore, Germany). Briefly, cells were washed twice with PBS, harvested, and resuspended in IP lysis buffer (Beyotime, China) for 30 min of incubation. Protein A/G magnetic beads were incubated with anti‐METTL14 antibody (Abcam, UK) or IgG antibody overnight at 4°C, followed by incubation with cell lysates to enrich RNA‐protein complexes. The beads were then washed three times with RIPA buffer (Beyotime, China), and RNA was isolated after cross‐linking reversal. qRT‐PCR was performed to determine gene expression levels.

2.24. Statistical Analysis

Data analysis was conducted using SPSS 26.0 (IBM, USA) and GraphPad Prism 9.0 (GraphPad, USA) software. Quantitative data presentation follows the mean ± SD format. All experiments were performed independently in triplicate at least. Intergroup comparisons employed Student's t‐test (two groups) and one‐way ANOVA (≥ 3 groups). Statistical significance was assigned when a p‐value < 0.05.

3. Results

3.1. The Low‐Expression of METTL14 in Tumor Tissues of Patients With HBV‐Related HCC

To investigate METTL14's function in HBV‐related HCC, we harvested 10 pairs of tumor tissues from patients with HBV‐related HCC (HBV‐HCC), non‐HBV‐related HCC tumor tissues (Non‐HBV‐HCC), and adjacent normal tissues (Normal). qRT‐PCR results revealed no significant differences in the mRNA and protein expression levels of METTL14 between the control group and Non‑HBV‑HCC tumor tissues. By contrast, METTL14 expression was markedly downregulated in HBV‑HCC tumor tissues relative to the Non‑HBV‑HCC group (Figure 1A,B). Given that METTL3 and METTL14 form a heterodimeric complex, we further examined the mRNA expression of METTL3. Only a mild reduction in METTL3 expression was observed in HBV‑HCC tumor tissues (Figure 1A). Collectively, subsequent investigations focused primarily on alterations in the expression of METTL14. Dot‐blot analysis revealed that the overall m⁶A signal intensity was markedly diminished in HBV‐HCC tissues compared with the Non‐HBV‐HCC group (Figure 1C). Bioinformatics analysis further confirmed that METTL14 expression was noticeably downregulated in liver cirrhosis and HCC tissues versus normal liver tissues (Figure 1D). To further clarify whether this reduced expression was specifically induced by HBV infection in a large cohort, we employed the TCGA database to comprehensively analyze the expression profile of METTL14 in HBV‐positive and HBV‐negative subgroups (Figure 1E). The results indicated that METTL14 expression was significantly lower in tumor tissues than in matched adjacent non‐tumor tissues within the HBV‐positive subgroup. In contrast, no statistically significant difference in METTL14 expression was observed between tumor and adjacent non‐tumor tissues in the HBV‐negative subgroup. Moreover, no significant difference was detected in the overall METTL14 expression level between HBV‐positive and HBV‐negative HCC samples. These findings suggest that the downregulation of METTL14 may be specifically triggered by or closely associated with HBV infection. Additionally, human normal hepatocyte MIHA cells were cultured with or without HBV infection. To establish a valid in vitro HBV infection model, lentiviral transfection was used to overexpress the HBV entry receptor NTCP and the key metabolic enzyme CYP3A4 in MIHA cells. RT‐qPCR, WB, and immunofluorescence assays were performed to evaluate the mRNA and protein expression levels of CYP3A4 and NTCP, as well as their subcellular localization. Compared with the untransfected group, both mRNA and protein levels of NTCP and CYP3A4 were significantly upregulated in MIHA cells following single or combined lentiviral transfection. CYP3A4 was predominantly localized in the cytoplasm, whereas NTCP was mainly expressed on the cell membrane (Figure S1A–D). Subsequently, culture supernatants were collected at 72 h post‐infection, and HBV DNA loads were quantified by qPCR. The results demonstrated a prominent elevation in HBV DNA levels in the supernatant of HBV‐treated MIHA cells (Figure S1E), verifying the reliability of the infection model. On this basis, qRT‐PCR and WB analyses showed that both mRNA and protein expression of METTL14 were substantially reduced in MIHA cells infected with HBV (Figure 1F,G). These results suggest that METTL14 shows low expression during the progression of HBV‐related HCC.

Figure 1.

The low‐expression of METTL14 in tumor tissues of patients with HBV‐related HCC. Clinical sample groups: Non‐HBV‐HCC, HBV‐HCC, and adjacent normal tissues (Normal); (A) qRT‐PCR of METTL14 and METTL3 mRNA expression; (B) WB of METTL14 protein expression; (C) m⁶A modification levels in clinical specimens determined by dot‐blot analysis; (D) Analysis of METTL14 expression in liver cirrhosis and HCC tissues from the GEO database; (E) Expression levels of METTL14 in HBV‐positive and HBV‐negative HCC patients from the TCGA database. Cell groups: MIHA group (MIHA cells not infected with HBV), HBV‐MIHA group (MIHA cells infected with HBV); (F) qRT‐PCR of METTL14 mRNA expression; (G) WB of METTL14 protein expression; *p < 0.05.

3.2. METTL14 Knockdown Aggravates the Progression of HBV‐Related Cirrhosis and HCC in Mice

To further investigate the effect of METTL14 on the progression of HBV‐related liver disease, we injected CD137 antibody into HBV transgenic mice (HBs‐Tg) to establish mouse models of HBV infection‐induced cirrhosis and HCC (HBs‐tg group). Model group mice received sh‐METTL14 lentivirus via tail vein injection to establish METTL14 knockdown intervention (HBs‐tg+sh‐METTL14 group). The experimental workflow is illustrated in Figure 2A. At day 21 during the early stage of modeling, serum HBsAg levels were measured in mice from all groups. Compared with the WT‐sh‐NC group, serum HBsAg concentrations were significantly elevated in the HBs‐tg‐sh‐NC group, whereas knockdown of METTL14 led to a moderate reduction in serum HBsAg levels in the HBs‐tg+sh‐METTL14 group (Figure S2A). Meanwhile, IHC staining of liver tissues further revealed markedly enhanced HBsAg‐positive deposition in the HBs‐tg model group relative to the WT group. The HBsAg‐positive area decreased in the METTL14‐knockdown group compared with the model group (Figure S2B), confirming successful establishment of the HBV transgenic mouse model. Subsequently, we evaluated liver injury and the progression of hepatic fibrosis. As shown by ALT and AST detection, compared with the WT+sh‐NC group, serum ALT and AST levels were significantly increased in the HBs‐tg model group mice (Figure 2B,C). In liver pathological analysis, the liver tissues of mice in the HBs‐tg model group exhibited diffuse necroinflammation, collagen deposition, and severe fibrosis (Figure 2D). Furthermore, IHC results demonstrated that, contrasted with the WT+sh‐NC group, the α‐SMA‐positive staining area showed a significant increase in the HBs‐tg group mice (Figure 2D). In TUNEL staining, hepatocyte apoptosis was markedly elevated in the HBs‐tg group (Figure 2E). Furthermore, to investigate the association between anti‐CD137 antibody‐induced liver injury and the activation of CD8 + T cells, flow cytometry was performed to determine the proportion of IFN‐γ‐producing CD8 + T cells in liver tissues. The results demonstrated that the percentage of IFN‐γ + CD8 + T cells was significantly elevated in the livers of HBs‐tg mice (Figure 2F). Hydroxyproline and Hyaluronic Acid, key liver fibrosis markers, exhibited substantial increases in levels as detected by ELISA (Figure S2C,D). These results are consistent with the typical characteristics of HBV‐related cirrhosis mice, proving the successful construction of the HBV‐related cirrhosis mouse model. Notably, METTL14 knockdown further exacerbated these phenotypic indicators in the above HBs‐tg mice (Figure 2B–F, Figure S2C,D). WB results demonstrated that METTL14 protein expression levels were notably reduced in the HBs‐tg model group mice and were further decreased after METTL14 knockdown (Figure S2E). Thereafter, the remaining mice in each group were maintained for seven consecutive months to evaluate long‐term carcinogenic effects. Liver specimens were collected and subjected to HE staining. HE staining revealed distinct liver tumor nodules in the HBs‐tg model group, with METTL14 knockdown leading to a substantial increase in nodule number (Figure S2F,G). IHC analysis demonstrated that the proportion of Ki67‐positive cells was markedly increased in the liver tissues of HBs‐tg‐sh‐NC mice compared with the WT‐sh‐NC group, and METTL14 knockdown further elevated the percentage of Ki67‐positive cells (Figure S2H). These results confirm that METTL14 knockdown aggravates the progression of HBV‐related cirrhosis and HCC in mice.

Figure 2.

METTL14 Knockdown Aggravates the Progression of HBV‐Related Cirrhosis and HCC in Mice. Animal experiment groups: WT + sh‐NC group, Hbs‐tg + sh‐NC group, Hbs‐tg + sh‐METTL14 group; experiments were conducted 21 days after modeling. (A) Schematic diagram of the animal experimental protocol; (B) ALT kit detection of ALT levels in mouse serum; (C) AST kit detection of AST levels in mouse serum; (D) HE, Sirius Red, and IHC staining of inflammation, collagen deposition, and fibrosis in mouse liver tissues; (E) TUNEL apoptosis staining to detect apoptosis in mouse liver tissue cells; (F) Proportion of IFN‐γ + CD8 + T cells in mouse livers detected by flow cytometry; *p < 0.05.

3.3. METTL14 Promotes cGAS mRNA Degradation through M⁶A Modification

To further explore the impact of cGAS–STING activation levels on HBV‐related cirrhosis, we collected liver samples from the WT+sh‐NC group, HBs‐tg + sh‐NC group, and HBs‐tg+sh‐METTL14 group 21 days later for analyses. qRT‐PCR and WB analyses revealed significantly elevated mRNA and protein expression levels of cGAS, STING, IRF3, and IFNB1 in the liver tissues of HBs‐tg + sh‐NC mice compared to the WT + sh‐NC group. These levels were further increased following METTL14 knockdown (Figure 3A,B). Additionally, in ELISA, serum IFNB1 levels were significantly increased in the HBs‐tg + sh‐NC group mice and were further upregulated after METTL14 knockdown (Figure 3C). This suggests that METTL14 may promote the progression of HBV‐related cirrhosis and HCC through the cGAS–STING signaling pathway. Subsequently, we established MIHA cells stably overexpressing METTL14 and performed HBV infection, followed by the detection of viral DNA in the culture supernatant to verify infection efficiency. The results showed that viral load was significantly higher in the HBV‐infected group (HBV‐MIHA+oe‐NC) than in the uninfected control group, and METTL14 overexpression markedly suppressed HBV replication (Figure S1F). In further in vitro cell experiments, HBV‐infected MIHA cells also exhibited characteristics of cGAS–STING pathway activation, and IFNB1 levels were remarkably elevated. The protein expression of METTL14 was significantly downregulated. (Figure 3D–F). After METTL14 overexpression, these effects were partially reversed. Furthermore, our bioinformatics analysis demonstrated 15 potential m⁶A methylation modification sites in the cGAS mRNA sequence (Figure 3G). To further verify the bioinformatics analysis results, we first specifically knocked down METTL14 expression in HBV‐infected MIHA cells through shRNA and verified the interference efficiency by qRT‐PCR (Figure 3H). Subsequently, MeRIP‐qPCR experiments showed that METTL14 knockdown significantly reduced the m⁶A modification level of cGAS mRNA. Meanwhile, RIP assays revealed that cGAS mRNA was notably enriched by the METTL14 antibody, verifying the direct interaction between METTL14 and cGAS mRNA. Following ActD treatment, the stability of cGAS mRNA was noticeably improved in the sh‐METTL14 group (Figure 3I–K). To further verify the specificity of METTL14‐mediated regulation on cGAS mRNA, rescue experiments via overexpression were conducted. The results were completely opposite to those from knockdown assays: overexpression of METTL14 markedly elevated the m⁶A modification level of cGAS mRNA, significantly reduced its stability, and accelerated its degradation (Figure S3A–C). These results indicate that METTL14 may facilitate cGAS mRNA degradation through m⁶A modification, thereby affecting the development of HBV‐related mouse cirrhosis and HCC.

Figure 3.

METTL14 promotes cGAS mRNA degradation through m6A modification. Animal experiment groups: WT + sh‐NC group, Hbs‐tg + sh‐NC group, Hbs‐tg + sh‐METTL14 group; experiments were conducted 21 days after modeling. (A) qRT‐PCR of mRNA expression of cGAS, STING, IRF3, and IFNB1; (B) WB of protein expression of cGAS, STING, IRF3, and IFNB1; (C) ELISA of IFNB1 content in mouse serum; Cell experiment groups: MIHA + oe‐NC group, HBV‐MIHA + oe‐NC group, HBV‐MIHA + oe‐METTL14 group; (D) qRT‐PCR of mRNA expression of cGAS, STING, IRF3, and IFNB1; (E) WB of protein expression of METTL14; cGAS, STING, IRF3, and IFNB1; (F) ELISA of IFNB1 content in the supernatant; (G) Bioinformatics analysis of prediction of m⁶A modification sites of cGAS mRNA; Cell groups: sh‐NC, sh‐METTL14; (H) qRT‐PCR verification of knockdown efficiency; the above two groups of cells were infected with HBV; (I) MeRIP‐qPCR of the m⁶A modification level of cGAS; (J) Interaction between METTL14 and cGAS mRNA verified by RIP assay; (K) Detection of cGAS mRNA stability after ActD treatment for 2, 4, and 6 h; *p < 0.05; ns, no statistically significant difference.

3.4. METTL14 Inhibits Hepatic Stellate Cell Activation by Suppressing cGAS–STING Pathway‐Dependent IFNB1 Release

Based on the previous finding that METTL14 regulates cGAS mRNA stability through m⁶A modification and thereby affects the progression of HBV‐related cirrhosis and HCC, we further investigated whether METTL14 accelerates the progression through the cGAS–STING pathway. First, we established a METTL14 overexpression model in HBV‐infected hepatocytes and treated it in combination with a cGAS–STING activator (SNX281, MCE, USA). Prior to downstream mechanistic investigations, we reconfirmed the viral infection status. qPCR analysis revealed that viral DNA levels were markedly decreased in the METTL14‐overexpressing group, and this effect was partially reversed upon treatment with a cGAS‐STING agonist (Figure S1G). As shown by qRT‐PCR and WB, versus the control, the mRNA and protein expression levels of METTL14 were significantly increased in the METTL14 overexpression group, while these levels of cGAS, STING, IRF3, and IFNB1 were significantly decreased. After adding the cGAS–STING activator, these inhibitory effects were partially reversed (Figure 4A,B). ELISA demonstrated that IFNB1 secretion levels were significantly reduced in METTL14‐overexpressing cells versus the control group, and IFNB1 expression levels were reversed after treatment with the SNX281 activator (Figure 4C). It has been confirmed that IFNB1 facilitates the activation of human hepatic stellate cells by enhancing transforming growth factor β‐induced activation of SMAD family members 2 and 3, thereby assuming a pro‐fibrotic role in liver disease induced by human immunodeficiency virus type 1 infection and combined antiretroviral therapy [14]. To investigate whether the cGAS–STING pathway can boost hepatic stellate cell activation by releasing IFNB1 secretion, thereby exacerbating HBV‐related liver fibrosis and HCC progression, we established a co‐culture system of HBV‐infected MIHA and LX‐2 cells. To confirm that METTL14 modulates the activation of hepatic stellate cells (LX‐2) in the co‐culture system via regulating the cGAS‐STING/IFN‐β axis, functional rescue and blockade assays were performed in a co‐culture system consisting of HBV‐infected MIHA cells overexpressing METTL14 (oe‐METTL14) and LX‐2 cells. The results showed that, on the basis of suppressed LX‐2 activation (low α‐SMA expression) induced by METTL14 overexpression, exogenous supplementation with recombinant IFN‐β protein markedly restored the activation status of LX‐2, accompanied by a significant increase in α‐SMA mRNA levels. In contrast, combined treatment with a specific anti‐IFNAR2 neutralizing antibody significantly abolished this restorative effect. These findings indicated that METTL14 overexpression inhibited hepatic stellate cell activation by reducing IFN‐β secretion (Figure 4D). In WB, after co‐culture with METTL14‐overexpressing MIHA cells, the protein expression levels of α‐SMA, COL1A1, and TIMP1 in LX‐2 cells were significantly decreased, and SNX281 activator treatment remarkably reversed this inhibitory effect (Figure 4E). Additionally, IF staining further confirmed that α‐SMA‐positive hepatic stellate cells were remarkably reduced in the METTL14 overexpression group (Figure 4F). In addition, we performed rescue experiments via overexpressing METTL14 in METTL14‐knockdown HBV‐MIHA cells, followed by co‑culture with hepatic stellate LX‑2 cells. WB was used to detect the protein levels of α‑SMA, COL1A1, and TIMP1. WB results demonstrated that knockdown of METTL14 markedly upregulated the protein expression of α‑SMA, COL1A1, and TIMP1; such upregulation was substantially reversed upon overexpression of METTL14 (Figure S4). Taken together, METTL14 overexpression markedly attenuates hepatic stellate cell activation by suppressing cGAS–STING pathway‐dependent IFNB1 release.

Figure 4.

METTL14 inhibits hepatic stellate cell activation by suppressing cGAS–STING pathway‐dependent IFNB1 release. Cell experiment groups: oe‐NC + DMSO, oe‐METTL14 + DMSO, oe‐METTL14 + SNX281; (A) qRT‐PCR of mRNA expression of METTL14, cGAS, STING, IRF3, and IFNB1; (B) WB of protein expression of METTL14, cGAS, STING, IRF3, and IFNB1; (C) ELISA of IFNB1 expression in cells; the above groups were co‐cultured with hepatic stellate cells LX‐2; (D) Expression levels of α‐SMA mRNA in LX‐2 cells examined by exogenous IFN‐β rescue and anti‐IFNAR2 antibody blockade assays in the co‐culture system; (E) WB of protein expression of α‐SMA, COL1A1, and TIMP1; (F) Immunofluorescence observation of α‐SMA‐positive hepatic stellate cells; *p < 0.05; ns, no statistically significant difference.

4. Discussion

This study reveals that METTL14 affects the progression of HBV‐related cirrhosis and HCC by regulating the cGAS–STING pathway through m⁶A modification. First, it was confirmed from clinical samples, bioinformatics analysis, and cell experiments that METTL14 is low‐expressed in HCC, HBV infection, and liver cirrhosis. Second, in mouse models, METTL14 knockdown aggravated liver fibrosis and the occurrence of liver tumor nodules. At the mechanistic level, downregulation of METTL14 reduces m6A modification of the cGAS transcript and increases its stability, thereby activating this pathway and facilitating IFNB1 release. METTL14 overexpression can inhibit the activation process of hepatic stellate cells. Therefore, targeting METTL14 may offer a novel approach to treating HBV‐related liver disease.

As a principal catalytic component of the m⁶A methyltransferase complex, METTL14 is essential in tumors and infectious diseases [15, 16]. For example, METTL14 expression is reduced in HCC tissues, and METTL14 knockdown accelerates the migration, invasion, and epithelial‐mesenchymal transition of HCC cells in vitro/vivo [17]. Additionally, METTL14 inhibits the migration and invasion of HCC cells through m⁶A methylation of RPLP2 [12]. In this study, we innovatively discovered that METTL14 shows low expression in HBV‐related cirrhosis and HCC, and METTL14 knockdown further aggravates liver fibrosis and the occurrence of liver tumor nodules in mice with HBV‐related cirrhosis and HCC. Thus, our results confirm that METTL14 is a key regulatory factor in the progression we discussed. Previous studies have demonstrated that HBV represses METTL14 expression through diverse mechanisms. For instance, the HBV‐encoded HBx protein recruits epigenetic regulators such as DNMT3A to facilitate DNA methylation at the promoter region of target genes, thereby inhibiting gene transcription at the transcriptional level [18]. Yuan et al. [19] reported that chronic HBV infection triggers massive accumulation of mitochondrial reactive oxygen species (ROS) in hepatocytes, which further activates transcription factors, including Snail; subsequent recruitment of DNMT1 and HDAC1 consequently mediates epigenetic silencing of target genes. Nevertheless, whether HBV downregulates METTL14 via the above‐described mechanisms remains to be further investigated in future studies.

Given that METTL3 and METTL14 assemble into a heterodimeric complex to collaboratively catalyze m⁶A RNA methylation modification [20], we quantified the mRNA abundance of METTL3 in HBV‐HCC tumor tissues. Our results revealed only a marginal reduction in METTL3 expression relative to non‐HBV‐associated HCC specimens, implying that METTL3 is not the predominant regulatory molecule under the pathological context of HBV‐related HCC in our cohort. Numerous prior studies have documented overall upregulation of METTL3 in HCC tumor cells [21, 22]; however, accumulating evidence indicates that METTL3 can also exert tumor‐suppressive effects and is downregulated in certain liver diseases. For example, Lin et al. [23] demonstrated robust downregulation of METTL3 in advanced HCC and sorafenib‐resistant hypoxic HCC, whereas METTL3 knockdown augments sorafenib resistance in HCC cells. Using liver‐specific conditional knockout mouse models, Wei et al. [24] validated that METTL3 deletion accelerates HCC initiation and progression by triggering hepatocyte dedifferentiation and excessive proliferation. Another report illustrated that pharmacological inhibition of METTL3 alleviates hepatic injury in a mouse model of HBV‐associated acute‐on‐chronic liver failure [25]. Collectively, these findings suggest a dual role of METTL3 in HCC pathogenesis. The modest alteration of METTL3 observed herein raises the possibility that METTL3 cooperates with METTL14 to promote the progression of HBV‐induced liver cirrhosis and HCC, yet further experimental validation is required to verify this hypothesis.

The m⁶A modification holds a pivotal role in diseases through epigenetic transcriptome regulation by controlling key molecular processes such as RNA stability and degradation [26]. For example, in HBV‐related HCC, interferon α‐2a can promote the degradation of HBV pregenomic RNA by increasing its m⁶A modification, thereby inhibiting tumorigenesis [27]. Notably, m⁶A modification can play a part in cancer progression through pathways such as Wnt/β‐catenin, cGAS–STING, and HIF‐1α/VEGF [28, 29, 30]. Among them, the cGAS–STING pathway inhibits viral replication by recognizing viral DNA in the cytoplasm and activating the IFN‐I response, thus playing a crucial role in HBV‐related liver disease [31]. For example, increased m⁶A modification levels enhance mRNA stability in cGAS and STING1 and increase key protein expressions in the cGAS–STING pathway [32]. Through bioinformatics analysis, we found 15 potential m⁶A methylation modification sites in the cGAS mRNA sequence. Combined with cell experiments, it was confirmed that METTL14 knockdown markedly reduces the m⁶A modification level of cGAS mRNA and improves the stability of cGAS mRNA, accelerating the progression of HBV‐related cirrhosis and HCC in mice. Additionally, activation of the cGAS–STING–IFN I signaling pathway in nonalcoholic fatty liver disease can promote the sustained activation of inflammatory responses, thereby accelerating the liver fibrosis process [33]. Our research found that METTL14 downregulation can boost the activation of the cGAS–STING pathway and the IFNB1 release through m⁶A modification, thereby promoting the progression of HBV‐related cirrhosis and HCC. Nevertheless, we noted that the cGAS‐STING signaling pathway exerts a complex dual role in liver diseases, with its biological functions highly dependent on the disease stage and cellular microenvironment [10]. During the early phase of HBV infection, the type I interferon response mediated by cGAS‐STING is critical for restricting viral replication and eliminating infected cells, exerting protective antitumor and antiviral effects [34]. However, in the context of chronic inflammation, hepatic fibrosis, and HCC progression, the key stages focused on in this study, sustained and excessive cGAS‐STING activation, may trigger pathological immune dysregulation. Prolonged IFN‐β release not only promotes the activation of hepatic stellate cells and collagen deposition but also drives fibrogenesis and facilitates tumorigenesis. Such divergent functional effects suggest that the biological outcome of the cGAS‐STING pathway is likely determined by the specific stage of disease progression. In the advanced pathological milieu investigated herein, its pro‐inflammatory and pro‐fibrotic effects appear to predominate, rendering targeted intervention therapeutically promising at this stage, without precluding other physiological functions of this pathway in the early disease phase. Furthermore, we recognized that several interventions employed in this study, such as lentiviral delivery and CD137 antibody‐induced immune activation, may also induce hepatocellular DNA damage or mitochondrial stress, leading to non‐specific cGAS activation. To eliminate this confounding factor, rigorous empty vector control groups (sh‐NC/oe‐NC) were included in all experimental sets, ensuring that the observed phenotypic differences were primarily attributable to specific modulation of METTL14 rather than non‐specific injury caused by experimental procedures. Nonetheless, future studies employing conditional gene knockout mice to distinguish cGAS activation induced by viral DNA sensing from that triggered by damage‐associated molecular patterns will help to more precisely delineate the dynamic roles of this pathway across distinct disease stages. Notably, in HBV‐infected chronic hepatitis, hepatic stellate cells are activated and transformed into myofibroblasts with contractile and collagen‐synthesizing abilities, thereby accelerating liver fibrosis formation. This process is an indispensable pathological foundation for the occurrence of liver cirrhosis and HCC [35]. For example, activated hepatic stellate cells drive the progression and metastasis of liver cancer by promoting extracellular matrix remodeling in the tumor microenvironment, secretion of pro‐angiogenic factors, and recruitment of immunosuppressive cells [36]. In this study, through co‐culture of HBV‐infected human normal hepatocyte MIHA with human normal hepatic stellate cell LX‐2, we found that METTL14 overexpression can inhibit the activation of LX‐2 hepatic stellate cells by inhibiting cGAS–STING pathway‐mediated IFNB1 release. In summary, our study elucidates how METTL14 regulates hepatic stellate cell activation, offering novel insights into the molecular pathways underlying HBV‐related cirrhosis and HCC. This study systematically elucidates the mechanism of METTL14 in HBV‐related cirrhosis and HCC by integrating clinical sample analysis, animal model experiments, and in vitro cell experiments. Specifically, METTL14 holds a key function in HBV‐related cirrhosis and HCC by regulating the m⁶A modification of cGAS mRNA to affect its stability, thereby regulating the production of IFNB1 released by the cGAS–STING pathway. This discovery provides a theoretical basis for developing new targeted therapeutic strategies. It should be pointed out that the current research is mainly based on HBV transgenic mouse models and cell lines, and its clinical relevance still needs to be verified through large‐scale patient cohorts. Secondly, independent METTL14 knockdown experiments in wild‐type mice have not been performed in the present study. In future investigations, we will establish a METTL14‐knockdown mouse model on a wild‐type background and compare its phenotypes with those of HBV‐transgenic mice, which will help further clarify the specific regulatory function of METTL14 in HBV‐associated liver diseases and exclude potential hepatic dysfunction induced by METTL14 depletion under non‐HBV conditions. In vivo rescue assays will also be implemented to verify that METTL14 restrains the progression of HBV‐related liver cirrhosis and HCC via inhibiting the cGAS‐STING pathway. In addition, the exact m⁶A modification sites on cGAS mRNA targeted by METTL14 remain unidentified. Site‐directed mutagenesis will be utilized to validate predicted m⁶A loci in follow‐up experiments, so as to elaborate the molecular mechanism whereby METTL14 modulates cGAS mRNA stability through site‐specific m⁶A modification. In addition, whether METTL14 participates in the progression of liver disease through other epigenetic transcription or signaling pathways warrants further investigation. Subsequent research will deeply analyze the epitranscriptomic regulatory network mediated by METTL14 to provide a comprehensive theoretical basis for the treatment strategies.

Author Contributions

Yu Wang: methodology, data curation, formal analysis, investigation, writing – original draft. Hui Bai: methodology, data curation, formal analysis, investigation, validation, writing – original draft. Aiyun Zhang: data curation, investigation, writing – original draft. Rui Tao: data curation, visualization. Jiayi Wang: investigation, visualization. Xu Zhang: investigation, project administration, writing – original draft. Juan Ma: validation, project administration, writing – review and editing.

Ethics Statement

All experimental protocols received approval from the Medical Research Ethics Review Committee of General Hospital of Ningxia Medical University (No. KYLL‐2024‐0932). Informed consent was secured from all patients prior to sample collection.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: Establishment, Validation of the HBV‐Infected MIHA Cell Model and Detection of Viral Replication. (A–B) Relative mRNA expression levels of CYP3A4 (A) and NTCP (B) in MIHA cells after lentiviral transduction determined by qRT‐PCR; (C) Protein expression of CYP3A4 and NTCP in MIHA cells following lentiviral transduction detected by WB; (D) Subcellular localization and co‐expression of CYP3A4 (green) and NTCP (red) in MIHA cells observed by immunofluorescence staining; (E–G) Relative HBV DNA levels in the culture supernatant of HBV‐infected MIHA cells measured by qPCR. *p < 0.05

Figure S2: Validation of the Mouse HBV Infection Model. (A) Serum HBsAg levels in mice from each group detected by ELISA; (B) HBsAg expression in liver tissues of mice from each group observed by IHC staining. (C–D) ELISA of liver fibrosis factors Hydroxyproline (C) and Hyaluronic Acid (D) levels in mouse liver tissue homogenates; (E) WB of METTL14 protein expression levels; experiments were conducted after continuous modeling for 7 weeks; (F) HE staining of liver tissues to examine liver tumor nodules; (G) Statistical analysis of the number of liver tumor nodules in mice; (H) IHC analysis of Ki67 expression. *p < 0.05

Figure S3: METTL14 Promotes cGAS mRNA Degradation via m⁶A Modification. Cell groups: oe‐NC, oe‐METTL14; (A) qRT‐PCR verification of overexpression efficiency; the above two groups of cells were infected with HBV; (B) MeRIP‐qPCR of the m⁶A modification level of cGAS; (C) Detection of cGAS mRNA stability after ActD treatment for 2, 4, and 6 hours; *p < 0.05; ns, no statistically significant difference. *p < 0.05

Supporting File

Wang Y., Bai H., Zhang A., et al., “METTL14 Downregulation Accelerates HBV‐Related Cirrhosis and Hepatocellular Carcinoma by Promoting Type I Interferon Release via the cGAS–STING Pathway Through m⁶A Modification,” Journal of Medical Virology 98 (2026): e71064, 10.1002/jmv.71064.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.