Extracellular serine availability regulates inflammatory skin phenotypes

Abstract

Serine has recently emerged as an important regulator of epidermal cell growth and skin repair, and modulation of serine metabolism through inhibition of Serine Hydroxy-Methyl Transferases (SHMTs) is already known to attenuate the development of skin inflammatory features in vivo. However, the contribution of serine/glycine free diet to inflammatory skin phenotypes, including psoriasis, has not yet been explored. Here, we investigated the role of serine/glycine availability, demonstrating that serine/glycine free diet has an impact on epidermal inflammation. Using a mouse model of inflammation fed either a standard diet or a serine/glycine-deprived diet, followed by topical application of the psoriatic-like inducer IMIQUIMOD (IMQ), we observed a substantial reversal of the IMQ-induced phenotype. This effect was associated with alterations in keratinocyte proliferation and differentiation, as well as inflammatory cell infiltration, leading to reduced epidermal thickening, improved skin organization, and a decrease in CD3⁺ T-lymphocyte infiltration. Taken together, our findings expand current knowledge of the interplay between serine metabolism and the development of skin inflammatory features, providing further evidence for a link between amino acid homeostasis and disease progression. This metabolic connection may be exploited to develop alternative therapeutic strategies for the treatment and management of chronic inflammatory diseases such as psoriasis or atopic dermatitis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13062-026-00825-0.

Introduction

The skin is the most extended body organ, serving as both a physical and immune barrier which protects the organism against water loss, mechanical insults, and pathogen infection. It is a tissue with an active metabolic and renewing profile, consisting of a multi-layered epithelium of epidermal cells (keratinocytes) at different stages of maturation which reside within the skin alongside with other cell types including immunocytes [1, 2]. Given its fundamental protective role, skin homeostasis must be tightly regulated, and the proper crosstalk between skin cellular types ensures tissue integrity and functioning; however, this regulation might fail, leading to disorders such as skin cancer and inflammatory-mediated skin diseases (ISDs) such as psoriasis. Psoriasis is an immune-mediated skin disorder affecting around 2–3% of population worldwide and is characterized by the presence of lesions known as “plaques”, which consist of extremely hurting, inflamed skin portions containing an immune cell infiltrate together with keratinocytes displaying aberrant proliferation and differentiation capabilities; psoriasis is caused by the occurrence of triggering stimuli in genetically susceptible individuals, and is often associated to the presence of other metabolic comorbidities such as dyslipidaemia, metabolic syndrome, obesity, and other, and lifestyle habits (such as diet) also contribute to psoriasis development; in particular, glucose and amino acid homeostasis disruption are known to be important players in both psoriasis onset and maintenance [3–7]. For these reasons, the conception of psoriasis has shifted over time towards the consideration of this pathology as a systemic metabolic disorder rather than a solely skin compartment-affecting disorder. As regards disease treatment, the currently available therapeutic options can only provide affected individuals with short-term benefits, due to long-term administration-associated dangerous side effects; plus, they are characterized by continuous need for re-administration in clinical setting, show loss of efficacy over time and are extremely expensive so that psoriasis represents to date a socially relevant disease with a strong and ongoing need for new and alternative therapy development [8, 9]. Serine is a non-essential amino acid that can be either taken up from the bloodstream or synthesized de novo from glucose via the glycolytic pathway. It represents a central hub for the generation and displacement of monocarbonic units during One-Carbon Metabolism reactions, which are used in cells to support anabolic processes, via the reaction of the Serine Hydroxy-Methyl Transferases (SHMTs) which convert serine into glycine and a folate-bound One-Carbon (1 C) unit (5,10-methylenetetrahydrofolate – 5,10-CH₂-THF) [10, 11]. Due to its ability to support anabolic processes such as cellular replication, serine metabolism alterations have been widely reported in cancer [12–14]. However, serine has emerged as a central player also in other proliferation-requiring processes, such as epidermal growth, immune cell expansion and skin repair after injury [15–17]; in addition, a role for serine metabolism alterations has also been reported in psoriasis-like phenotype, where SHMT enzymes chemical inhibition was shown to attenuate inflammatory features development [18]. Here, we investigated the contribution of serine/glycine free diet to the development of psoriatic-like features. Despite the fact that imiquimod is strictly a model of epidermal inflammation, it has several aspect resembling psoriasis, therefore we decided to use a murine psoriasis-like model (IMIQUIMOD, a Toll-Like Receptor 7/8 activator that induces a psoriatic-like phenotype – [19, 20]), we found that dietary restriction of serine and glycine effects parallel the results observed in the same system after chemical inhibition of SHMTs activity [18]. Specifically, this restriction reduced IMQ-induced skin thickening by limiting cellular proliferation and partially restoring skin structure through effects on epidermal differentiation. In terms of immune response, we observed a significant decrease in the number of CD3 + T lymphocytes in the skin of IMQ-treated mice fed a serine/glycine-restricted diet, confirming that extracellular serine and glycine availability play an important role in regulating immune cell proliferation in the epidermis.

Materials and methods

Mice serine/glycine dietary restriction and imiquimod treatment

Twenty-four 8-week-old female BALB/C mice were purchased from Charles River and divided into four experimental groups. 15 days before (Day − 15) the “START” point (Day 0) two mice groups (CTR + SG and IMQ + SG) were fed with control diet (Mucedola SRL, Settimo Milanese (MI), Italy) while the other two groups (CTR -SG and IMQ -SG) were fed with serine/ glycine free diet (Mucedola SRL, Settimo Milanese (MI), Italy). Starting from Day 0 (” START”) two mice groups (IMQ + SG and IMQ -SG) were daily administered with 5% IMIQUIMOD (ALDARA Cream, Meda AB, Solna, Sweden) for 5 consecutive days. All the mice belonging to the different experimental groups were anyways shaved on their backs. On the 6th day, 24 h after the IMQ administration on the 5th day (“END”), mice were sacrificed and full thickness skin biopsies of the treated area were collected, alongside with mice sera. Serine and glycine serum levels were determined by using the serine and glycine fluorometric detection kits (Abcam, Catalog #ab241027 and #ab211100, respectively) according to manufacturer’s protocol. Skin biopsies were either snap frozen in liquid RLT buffer (Qiagen) for total RNA extraction or fixed in neutral buffered formalin (Sigma-Aldrich, St. Louis, MO, USA) for further histologic analyses. All mouse procedures were conducted in accordance with institutional standard guidelines.

RNA extraction and qRT-PCR analysis

Total RNA extracts from murine back skin sections were obtained using the RNeasy Mini Kit (Qiagen) following the manufacturer’s protocol. Murine back skin sections were lysed in RLT buffer (Qiagen). Total extracted RNA was then quantified using the Nano Drop spectrophotometer (Thermo Scientific). 500 ng of RNA was subsequently used for cDNA synthesis by the SensiFAST™ cDNA Synthesis Kit (Invitrogen, Catalog #11754050). qPCR was performed with the GoTaq Real Time PCR System (Promega) in Applied QuantiStudio 3 or 5 Real-Time PCR System (Applied Biosystems) using appropriate qPCR primers (Table 1). β2-Microglobulin was used as housekeeper gene for murine mRNAs relative quantifications. The expression of each gene was calculated by the detection of their Threshold Cycle (CT) in the 2^-ΔΔCT comparative method, using SYBR Green for fluorescence detection. Obtained values were averaged and presented as their mean ± SD.

Table 1.

List of primers pair used for quantitative Real Time PCR

Real time primer	sequence
mPHGDH fw	CCTCCTTTGGTGTTCAGCAGCT
mPHGDH rev	CGCACACCTTTCTTGCACTGAG
mPSAT1 fw	CATTGGCAACGCCAAAGGAGAC
mPSAT1 rev	GTGACAGCGTTATACAGAGAGGC
mPSPH fw	CCACATCTGACTCCTGGCATAAG
mPSPH rev	AGCTTTGCAGCAACGTGCTCCA
mSHMT1 fw	TACTCGGTGGGTCCTGTAGC
mSHMT1 rev	CGTCATCCCAGCCCTAACAC
mSHMT2 fw	AGATGTCACTCCTCTCTGGGT
mSHMT2 rev	TGTCAACTGGGTGCTTCGTG
mIL-17 fw	GCTGACCCCTAAGAAACCCC
mIL-17 rev	GAAGCAGTTTGGGACCCCTT
mIL-22 fw	GCTCATCGGGGAGAAACTGT
mIL-22 rev	TGTAGGGCTGGAACCTGTCT-
mB2M fw	TGCTATCCAGAAAACCCCTCA
mB2M rev	TGTTCGGCTTCCCATTCTCC

Haematoxylin and eosin (H&E) staining

Paraffin-embedded murine skin sections were deparaffinized by 1 h incubation at 60 °C and then washed 5 min in Bio-Clear (Bio-Optica). Samples were then rehydrated by two consequential 5-minute incubations in 100% and 95% ethanol aqueous solutions respectively and then water. Samples were subsequently incubated in haematoxylin solution (Bio-Optica) for 6 min, followed by 1 min rinse in water, and then in eosin solution (Bio-Optica) for 4 min, followed by 1 final minute rinse in water. Samples were then dehydrated by two subsequent 2 min incubations in 95% and 100% ethanol aqueous solutions and finally Bio-Clear for 5 min. Coverslips were eventually mounted using Bio Mount HM (Bio-Optica).

Immunohistochemical (IHC) and immunofluorescence staining

CTR and IMQ-treated mice back skin sections (5 μm), were dewaxed for 2 h at 60 °C, then treated with Bio-Clear (Bio-Optica) and rehydrated via a decrescent alcohol scale − 100% − 95% − 90% − 70% − 50% and finally ddH₂O. Samples were then boiled at 95 °C either in Na-Citrate buffer pH 6,0 (Keratin 10) for 10 min or in DAKO Buffer at 96 °C for 25 min (Ki67) in order to obtain antigen retrieval. Samples were then incubated with anti-Keratin10 (1:1000, Covance, Catalog #PRB-159P), anti CD3 (1:100, Dako, catalog#A0452) or anti-Ki67 (1:250, Novocastra, Catalog #NCLk67P) primary antibodies. Immunohistochemical staining was performed using UltraTek HRP anti-polyvalent (DAB) Staining System (ScyTek laboratories, Catalog #AMF080). Sections were in the end counterstained with Mayer’s haematoxylin (Bio-Optica), dehydrated and then the coverslip was mounted using Bio-Mount HM (Bio-Optica). For immunofluorescence staining, FFPE Sect.  (5 μm) of mice skin were dewaxed for 2 h at 60 °C, treated with Bio-Clear (Bio Optica) and rehydrated in a series of alcohol solutions and ddH2O. The following primary antibodies were used: anti keratin 14 (1:500; ab7800), anti-keratin 10 (1:1000; BioLegend 905404), anti-filaggrin (1:1000; Covance PRB-417P). The following secondary antibodies were used: anti-rabbit 488- or 568-AlexaFluor-conjugated antibodies (Invitrogen, 1:1000) together with 1 µg/mL DAPI (Sigma) for nuclear DNA staining. Samples were analysed with Stellaris-5 confocal system (Leica) and related with LASX software.

Statistical analysis

Statistical analysis was performed using Student’s T-test as also specified in the figure legends. All analyses were conducted using Prism v.8.0 (GraphPad Software, La Jolla, CA, USA). Values were expressed as mean ± S.D., and statistical significance was assumed at a p value of 0,05 or less (*=p < 0,05; **=p < 0,01; ***=p < 0,001; ****=p < 0,0001).

Results

Extracellular serine and glycine dietary restriction impacts psoriasis-like skin features induced by imiquimod

Since previous studies have reported a role for serine metabolism in both epidermal growth [15] and inflammation [18], we explored the impact of serine/glycine free diet in a mouse model of imiquimod (IMQ)-induced skin inflammation. The IMQ-induced psoriasis-like mouse model is characterized by epidermal hyperplasia, abnormal epidermal differentiation, and inflammatory cell infiltration. Figure 1A shows a schematic representation and detailed description of the experimental design. To confirm the effectiveness of the dietary restriction, serum levels of serine and glycine were measured. Serine and glycine concentrations were significantly decreased in mice fed the restricted diet, in both control and IMQ-treated groups, confirming effective extracellular serine and glycine deprivation (Fig. 1B).

Fig. 1.

Extracellular Serine and Glycine deprivation reduce epidermal proliferation induced by imiquimod treatment. (A) Schematic representation of the experiments performed on mice subjected to serine and glycine dietary restriction, followed by back-skin treatment with imiquimod to induce psoriasis-like lesions. (B) Mouse serum serine and glycine quantification (nM) by using a fluorometric ELISA kit in all four experimental groups. (C) Measurement of epidermal thickness based on (D) H&E staining of + SG mice untreated skin, -SG mice untreated skin, +SG mice skin treated with IMQ and -SG mice skin treated with IMQ. Scale bar, 200 μm. (E) Quantification (%) of Ki67 positive cells in the epidermis and (F) corresponding immunohistochemistry staining for Ki67. For immunohistochemistry staining, one single representative picture is shown. Scale bar, 200 μm. P-values were obtained using Student’s T-test and p-values < 0,05 were considered significant. SG= serine/glycine; CTR= Control; IMQ= IMIQUIMOD

We next examined differences in the development of epidermal psoriatic-like features among the experimental groups. Quantification of epidermal thickness (Fig. 1C), based on hematoxylin and eosin (H&E) staining of back skin sections (Fig. 1D), revealed variations across all groups. Consistent with acanthosis, both IMQ (+ SG) and IMQ (–SG) groups displayed increased epidermal thickness relative to their respective control groups [(+ SG) CTR and (–SG) CTR]. Notably, the epidermis of IMQ (–SG) mice was significantly thinner than that of IMQ (+ SG) mice, indicating that dietary serine/glycine restriction reduces the pool of extracellular serine available to epidermal cells, thereby limiting their proliferative capacity. This metabolic constraint attenuates IMQ-induced hyperproliferation, resulting in reduced epidermal thickening and milder inflammatory features. Interestingly, CTR (–SG) mice also exhibited reduced epidermal thickness compared with CTR (+ SG) mice, further supporting a role for extracellular serine availability in epidermal homeostasis even under physiological conditions (Fig. 1C). In line with these findings, quantification of Ki67-positive cells (Fig. 1E) based on Ki67 immunohistochemistry (Fig. 1F) showed the expected increase in proliferative activity in IMQ-treated mice compared with controls. However, IMQ (–SG) mice displayed significantly fewer Ki67-positive cells than IMQ (+ SG) mice, consistent with the reduced epidermal thickness observed in H&E-stained sections.

Because psoriatic skin is characterized by aberrant keratinocyte differentiation, we evaluated key differentiation markers by immunofluorescence. Keratin 10 (K10) and filaggrin staining (Fig. 2A and B) revealed abnormal suprabasal deposition in both IMQ-treated groups (+ SG and –SG), as typically observed in psoriatic lesions. However, in IMQ (–SG) mice, K10 and filaggrin organization appeared more preserved compared with the markedly disrupted pattern observed in IMQ (+ SG) animals (Fig. 2A and B). Taken together, these data show that dietary serine and glycine deprivation mitigates IMQ-induced psoriatic-like features, affecting both keratinocyte proliferation and differentiation.

Fig. 2.

Extracellular Serine and Glycine deprivation impacts skin abnormal differentiation induced by imiquimod treatment. (A) Representative images of immunofluorescence staining for keratin 10, keratin 14 and (B) filaggrin and keratin 14 on skin mice of all four experimental groups. DAPI staining was used to detect cell nuclei. Scale bar, 50 μm. Data are presented as mean ± SD of n = 6 mice values. SG= serine/glycine; CTR= Control; IMQ= IMIQUIMOD. One single representative image is shown

Extracellular serine and glycine restriction mildly affects inflammatory skin condition after IMQ administration

After investigating the impact of serine and glycine dietary deprivation on the development of the psoriasis-like phenotype induced by IMQ treatment, we next focused on IMQ-induced skin inflammation. Immunohistochemical analysis followed by quantification of CD3⁺ cells revealed a significantly reduced number of inflammatory T cells (CD3⁺) in the skin of IMQ (–SG) mice compared to the IMQ (+ SG) group. (Figure 3A and B).

Fig. 3.

Extracellular serine and glycine deprivation impact on T lymphocytes CD3⁺ number in psoriasis-like lesion induced by IMQ. (A) Immunohistochemistry staining for Cd3 and (B) the corresponding quantification (%) of epidermal Cd3 positive cells. Scale bar, 200 μm. (C) Gene expression analysis by RT-qPCR of the inflammatory markers Il17a and Il22. Data are presented as mean ± SD of n = 6 mice values. P-values were obtained using Student’s T-test and p-values < 0,05 were considered significant. SG= serine/glycine; CTR= Control; IMQ= IMIQUIMOD. For immunohistochemistry analysis, one single representative picture is shown

As expected, the cytokine inflammatory profile of IMQ-treated skin showed to be higher, consistent with the well-established inflammatory state of psoriatic-like skin; however, although Il-17a and Il-22 levels were reduced, no significant differences were observed between the IMQ (+ SG) and IMQ (–SG) groups (Fig. 3C). Taken together, these data show that the availability of extracellular serine and glycine affects the number of T lymphocytes present in the inflammatory lesion but does not impact the production of inflammatory cytokines.

Extracellular serine and glycine deprivation does not lead to serine de novo biosynthesis enzymes upregulation

To evaluate a possible compensation for serine availability by endogenous production via the SSP, which would attenuate the effects of the serine/glycine-deprived diet, we also analysed genes of the serine de novo Synthesis Pathway (phgdh/ psat1/ psph) (Figure Supplementary 1A), as well as serine catabolism enzymes (shmt1/2) fluctuations (Figure Supplementary 1B) in the four experimental mice groups.

Consistent with a known upregulation of SSP and SHMT2 enzymes in human psoriasis [18], IMQ (+ SG) mice show an increased expression of such enzymes as compared to CTR (+ SG) mice; however, no significant differences were observed in the levels of expression of these enzymes’ mRNAs between the IMQ (+ SG) and IMQ (-SG) groups (Figure Supplementary 1A and B), although we noticed a tendency to increase, suggesting that serine/glycine restriction does not lead to the upregulation of endogenous serine production.

Taken together, these data show that there is no significant upregulation of endogenous serine/glycine synthesis enzymes at the mRNA level in mice fed a serine/glycine-deprived diet, suggesting the absence of compensatory mechanisms. However, assessing PHGDH, PSAT1, and PSPH at the protein level, as well as evaluating their metabolic products, would provide a more definitive verification of this point.

Discussion

The skin represents the interface between the organism and the outer world, serving as both a physical and immune barrier. The correct interplay between keratinocytes and immune cells in the skin ensures its self-renewal and proper functioning, which are crucial to organism wellness and survival. For this reason, skin homeostasis must be tightly regulated; however, such regulation might fail, leading to skin disorders as skin cancer and inflammatory-mediated skin diseases (ISDs), including psoriasis [1, 4, 6, 21]. Psoriasis is characterized by the presence of the so-called plaques, actively inflamed, extremely hurting skin portions that containing keratinocytes displaying aberrant proliferation and differentiation capabilities together with an immune cell infiltrate [3]. As regards disease onset, psoriasis pathogenesis is caused by the occurrence of triggering stimuli in genetically susceptible individuals, such as pathogen infection, smoking, UV exposition and other; in addition, it is often associated to the presence of other metabolic comorbidities such as dyslipidaemia, metabolic syndrome, obesity, and other, and lifestyle habits (such as diet) contribute to psoriasis development; in particular, glucose and amino acid homeostasis disruption are known to be important players in both psoriasis onset and maintenance [3, 5, 7]. Serine is a non-essential amino acid which sustains anabolic pathways networks such as the OCM via the SHMT enzyme’s reaction. Given its well-known role in sustaining cellular proliferation, serine metabolism alterations have been widely described in cancer [22–26]; however, important roles for serine metabolism have also emerged for other proliferation-requiring processes, such as keratinocyte growth, skin repair after injury [15, 17, 18] and immune cell expansion upon activation [16]. In addition, a role for serine metabolism has been reported also for psoriasis features development, where serine catabolism enzymatic inhibition was shown to attenuate the development of inflammatory features in a mouse model treated with IMQ, a TLR7/8 activator able to induce a psoriasis-like phenotype in murine models [18–20]. However, a detailed study of the precise effects of extracellular serine/glycine deprivation on epidermal inflammation in vivo had not been conducted yet. For these reasons, here we investigated the contribution on extracellular serine availability rather than on serine metabolism enzymatic inhibition, using an IMQ psoriatic-like mouse model to get a more well-rounded perspective on the contribution of extracellular serine metabolism to the disease. Despite the fact that imiquimod is strictly an inflammatory model, considering the analogy reported as psoriasis-like model, in this study, we demonstrated that in vivo extracellular serine and glycine deprivation, significantly revert the epidermal hyperplasia and skin abnormal differentiation induced by imiquimod treatment (Fig. 1). Serine and glycine dietary restriction experiments showed a reduced epidermal thickness alongside with a reduction in Ki67 positive cell number counts, mimicking the previously observed effects on psoriatic like features induced by modulation of serine metabolism via SHIN1 treatment [18]. Additionally, consistent with previously reported effects of SHMT inhibition, we also found that, in the absence of extracellular serine and glycine and following IMQ-induced skin treatment, the normal distribution of keratin 10 and filaggrin in the epidermis is restored (Fig. 2).

Another important aspect of the psoriasis-like establishment is the involvement of the immune system. In line with the previously reported role of the serine metabolism and of the SHMT enzymes in T cell proliferation [16], we show that in vivo extracellular serine deprivation leads to a decrease in the number of T lymphocytes CD3 + detected in mice skin upon IMQ treatment (Fig. 3A and B). RNA data showed an expected increase in inflammatory mediators (Il-17a and Il-22) production upon IMQ treatment (CTR VS IMQ groups), yet we measured a tendency to reduction that in our experimental conditions did not reach the statistical significance (see IMQ + SG and -SG groups) (Fig. 3C). Even if serine/glycine dietary restriction significantly reduced CD3⁺ T-cell infiltration in IMQ-treated skin, Il-17a and Il-22 mRNA reduced levels showed only a non-significant tendency. This apparent discrepancy may reflect the complexity of the local inflammatory response induced by IMQ, in which cytokine expression can be sustained by several and different immune and non-immune cell populations. Moreover, cytokine analysis was performed on total skin RNA and may therefore not fully capture cell-type-specific changes in inflammatory mediator production. Thus, our data suggest that serine/glycine availability affects immune cell accumulation in the lesion, while its impact on cytokine expression may require further investigation at the protein and single-cell level. While our mRNA analysis did not reveal a significant induction of the serine synthesis pathway enzymes PHGDH, PSAT1, PSPH and SHMT1/2 (Figure Supplementary 1), these data do not exclude compensatory regulation at the protein, enzymatic or metabolic flux level. Future investigations on SSP enzyme abundance, intracellular serine/glycine pools, one-carbon metabolism intermediates and pathway activity would be deeply helpful to define more precisely whether epidermal cells activate metabolic adaptations in response to dietary serine/glycine deprivation. (Figure supplementary 1).

Beyond inflammation, serine availability has recently been shown to play an important role in regulating skin repair kinetics after injury. Hair follicle stem cells (HFSCs) from serine-deprived mice repair wounds faster by activating the integrated stress response and delaying hair regeneration [17].

Although the IMQ model does not fully recapitulate the complexity of human psoriasis, it remains a useful model of epidermal inflammation, hyperproliferation and altered differentiation. Therefore, our findings may have huge relevance for chronic inflammatory skin conditions in which epidermal remodeling and immune activation coexist, including psoriasis and potentially other inflammatory barrier disorders such as atopic dermatitis. However, additional disease-specific models will be required to determine whether serine/glycine availability can have comparable effects across different inflammatory skin contexts.

Overall, this work broadens our understanding of how serine and glycine metabolism influences the development of epidermal inflammation in vivo, with a particular focus on extracellular serine/glycine availability (Fig. 4A). Extracellular serine and glycine are taken up through SLC transporters, which regulate intracellular and circulating amino acid levels important for metabolic homeostasis. These amino acids also support cellular proliferation, and their uptake, synthesis, and catabolism are known to increase in highly proliferative processes such as cancer, making amino acid transporters attractive therapeutic targets [27–31]. Since serine is also produced from glucose, and both glucose and amino acid homeostasis are disrupted in psoriasis [7], the findings presented here further support a link between amino acid availability, metabolic imbalance, and disease progression. This connection may help guide the development of new therapeutic strategies centred on amino acid homeostasis and nutrition in psoriasis.

Fig. 4.

Schematic representation of the effect of serine and glycine dietary restriction on a mouse model of imiquimod-induced psoriasis-like skin lesions

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

EC designed the research; SS performed Elisa assay and RTqPCRs; AM and MM performed immunohistochemistry; MM performed Immunofluorescence; AML and MM performed the IMQ-mouse model experiments; SS, AM and MM analyzed the data; EC, AM, MM and GM discussed the data and wrote the paper.

Funding

This work was mainly supported by the Ministry of Health and IDI-IRCCS, Grant RF − 2022-12375755 and Ricerca Corrente 2025 (to EC) and by PNRR - M4C2-I1.3 Project PE_00000019 “HEAL ITALIA”.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethical approval

All mouse procedures were conducted in accordance with institutional standard guidelines. The experimental design has been approved by the Italian Ministry of Health (Authorization #112/2021-PR).

Competing interests

The authors declare no competing interests.