Skip to main content
NCBI home page
Animals : an Open Access Journal from MDPI logoLink to Animals : an Open Access Journal from MDPI
. 2026 Jul 15;16(14):2200. doi: 10.3390/ani16142200

Transcriptome Sequencing Reveals That Curcumin Protects Leghorn Chicken Cardiomyocytes from Heat Stress-Induced Iron Dysregulation

Meng Bian 1, Xiaojuan Zeng 1, Dingding Zhang 1, Jiapei Bu 1, Dingping Bai 1,*
Editor: Jeffrey Downing1
PMCID: PMC13404801  PMID: 42511079

Simple Summary

We investigated the protective impact of curcumin on cardiomyocytes during heat stress using RNA-seq. Our research may offer fresh insight into the harm that heat stress causes, which could be the foundation for the application of curcumin in poultry. Pathway enrichment research suggests that heat stress can affect cell proliferation, the base repair process, and induce proteotoxic stress. By suppressing the expression of genes linked to ferritinophagy and boosting the expression of genes associated with heme synthesis, iron storage, and antioxidants, curcumin may shield cells against the toxicity of labile iron pool (LIP). Curcumin could increase heme production and enhance iron storage capacity to shield cardiomyocytes from heat stress. The results of this study have significant ramifications for both animal welfare and animal productivity.

Keywords: cardiomyocytes, curcumin, Fe-S cluster, heat stress, heme, homeostasis, iron

Abstract

The purpose of this study was to offer a theoretical foundation for the use of curcumin in poultry systems for anti-stress responses. Fourteen-day-old SPF Leghorn embryonic eggs were isolated and digested to produce primary cultured cardiomyocytes for this investigation. The primary cultured cardiomyocytes were divided into three groups: the CK group, serving as the control check; the HS group, which underwent a heat stress challenge; and the HS_Cur group, which was pre-treated with curcumin prior to experiencing heat stress. Twenty hours prior to the heat stress phase, the HS_Cur group received 15 μmol/L of curcumin. The culture medium’s cells and supernatant were extracted. Curcumin has been shown to protect cells against heat stress by drastically inhibiting the release of CK-MB and LDH, reducing the generation of MDA, and improving the potential of the mitochondrial membrane. Heat stress may alter cell proliferation, the base repair process, and cause proteotoxic stress, according to pathway enrichment analysis. Several iron metabolism-related pathways were both shown in CK vs. HS and HS vs. HS_Cur comparisons. Curcumin can promote heme synthesis and improve iron storage and antioxidant capacity by suppressing the expression of FTL, MAP1LC3C, and FXN and increasing the expression of SLC7A11, FTH1, FECH, SQSTM1, and NQO1, according to our subsequent analysis of iron metabolism-related DEGs. Curcumin may protect cells from the toxicity of LIP by inhibiting the expression of ferritinophagy-related genes and increasing the expression of heme production, iron storage, and antioxidant-related genes.

1. Introduction

One of the most important environmental limitations in poultry systems is heat stress (HS), which directly reduces growth performance, feed efficiency, and survivorship and eventually results in significant financial losses [1,2]. By controlling their cardiovascular systems to lower their body temperature, poultry adjust to hot environments. Heat stress causes a persistent overproduction of reactive oxygen species (ROS) in the heart, which is the primary organ responsible for blood circulation and body temperature regulation. The cardiomyocytes’ nucleic acids, proteins, and lipids are harmed by this high ROS, which induces myocardial remodeling and heart failure [3]. Research demonstrates that in fast-growing chickens, heat stress dramatically lowers heart weight by enhancing apoptosis and reducing cell cycle activity [4]. A relatively small heart may explain why modern fast-growing chickens are susceptible to heat stress [4]. In the meantime, heat stress causes a breakdown in cellular homeostasis and thermoregulatory control, which results in severe cardiovascular loads [5]. This evidence may suggest a connection between heat tolerance and heart health. As the primary pathogenic element in the development of fatal heart failure, cardiomyocytes are essential. Additionally, they participate in processes like ferroptosis and autophagy [6].

Heme is an iron containing molecule, and its homeostasis is essential for the health of cardiomyocytes. The study discovered that the heart failure model’s hemoglobin levels had significantly increased [7]. The degradation of heme was thought to be an important source of the LIP, which causes ferroptosis [8]. Mitochondria are the organelles responsible for heme synthesis. δ-aminolevulinate synthase (ALAS) and ferrochelatase (FECH) are the rate-limiting enzymes in heme biosynthesis [9,10]. Porphyrins are transported to the mitochondria by ATP-binding cassette transporter B6 (ABCB6), where they are utilized for heme synthesis and energy production [11]. Inhibition of ALAS2 and FECH expression will cause lack of heme and mitochondrial iron overload [9,12]. The preservation of mitochondrial iron homeostasis depends on the ATP-binding cassette transporter ABCB8 [13]. Research has demonstrated that malfunction of ABCB8 can cause iron excess in cardiomyocytes, which in turn can cause ferroptosis [14]. ABCB10 and mitochondrial ferritin-1 (SLC25A37) take part in the uptake and utilization of iron in mitochondria, and in cardiomyocytes, they work with iron chelatase and mitochondrial ferritin-1 (SLC25A37) to synthesize heme [15,16]. Iron is delivered to the mitochondria by NCOA4-mediated ferritinophagy, facilitating the production of heme and iron-sulfur (Fe-S) clusters [17].

Oxidative stress always coexists with heat stress [18]. Curcumin is a phenolic compound of turmeric, which has been proven to be an excellent anti-oxidant [19]. Curcumin has been shown in studies to alleviate unfavorable remodeling in the complicated cardiovascular environment, reduce myocardial cell damage, restrict fibrosis, and block inflammatory signaling [20]. However, nothing is known about whether curcumin can lessen the harm that heat stress causes to Leghorn cardiomyocytes by controlling iron metabolism.

Here, we used RNA-seq to investigate curcumin’s protective effect on cardiomyocytes during heat stress. Curcumin could increase heme production and enhance iron storage capacity to shield cardiomyocytes from heat stress. Our study may provide a new insight of the damage caused by heat stress. Additionally, we verified that curcumin protects cardiomyocytes from heat stress, which could serve as a basis for curcumin’s use in poultry.

2. Materials and Methods

2.1. Isolation and Heat Stress Model of Primary Chicken Cardiomyocytes

All animal experiments received approval from the Institutional Animal Care and Use Committee of Fujian Agriculture and Forestry University, China. Every procedure was conducted strictly following the committee’s established regulations and guidelines. Fourteen-day-old specific pathogen-free (SPF) Leghorn embryonated eggs were obtained from Sparfas Poultry Company (Jinan, China). The eggs were opened in a bio-clean environment. Ventricular tissue was then cut into pieces and washed four times with pre-cooled PBS. The tissue underwent digestion five times with pre-warmed (37 °C) 0.05% trypsin-EDTA (Gibco, Grand Island, NY, USA) for 5 min each; the first digestion was discarded. The remaining digests were centrifuged at 1000 rpm for 10 min. The precipitate was re-suspended in DMEM/high glucose (Hyclone, Logan, UT, USA) supplemented with 20% FBS (Gemini, Montgomery, AL, USA) and 0.1 mmol/L 5-Bromo-2-deoxyuridine (BrdU, Sigma, St. Louis, MO, USA). Cells were initially cultured in plates in a humidified incubator (Wuxi Marite Technology Co., Ltd., Wuxi, China) with 5% CO2 at 37 °C for 2 h. Afterwards, they were transferred to new culture plates and cultivated for 48 h in DMEM/high glucose containing 20% FBS and 0.1 mmol/L BrdU.

The primary cultured cells were divided into three groups: the CK group (control check), the HS group (heat stress challenge), and the HS_Cur group (pre-treated with curcumin before heat stress). Previous studies have demonstrated that treatment with 15 μmol/L curcumin for 20 h effectively induces its biological effects without inducing excessive cytotoxicity [21]. Therefore, this condition was selected for subsequent experiments. The HS_Cur group received 15 μmol/L curcumin (Sigma, St. Louis, MO, USA) 20 h before the heat stress phase. At the start of heat stress, both HS and HS_Cur groups were placed in a humidified incubator with 5% CO2 at 43 °C for 4 h, while the CK group remained at 37 °C with 5% CO2 for 4 h. Afterward, cells and the culture media supernatant were collected for further analysis.

2.2. Immunofluorescence

Isolated cells were seeded onto cell slides pre-installed in 6-well plates and subjected to the same protocol as the control group. After cell fixation, the samples were sent to Wuhan Savill Biotechnology Co., Ltd. Wuhan, China. for testing.

2.3. Detection of Cardiomyocytes-Related Enzymes

Cells and the culture media supernatant were collected to measure the activity of enzymes related to cardiomyocyte injury. Lactate dehydrogenase (LDH) and creatine kinase-myocardial band (CK-MB) activities were determined following the instructions provided with commercial kits (Nanjing Jiancheng Bioengineering Co., Ltd., Nanjing, China). Each set of data comes from three independent biological replicate experiments. Each sample was tested three times consecutively. The release ratio was calculated by dividing the enzyme activity in the culture media supernatant by the activity within the cells.

2.4. Analysis of Mitochondrial Membrane Potential (Δψm)

Apoptosis detection was performed using JC-1 Apoptosis detection kit (Keygen biotechnology Co., Ltd., Nanjing, China), with cell staining strictly conducted according to the manufacturer’s instructions. Select three independently cultured biological replicates. For each replicate, cells were cultured separately and harvested independently after treatment. The cell samples were analyzed using a flow cytometer (BD AccuriTM, Ann Arbor, MI, USA). Two independent computer-based data acquisitions were conducted separately, with 10,000 cell events measured per sample.

2.5. Assessment of Gsh and Gssg Content

GSH and GSSG were determined using GSH and GSSG detection kit, with all procedures strictly following the manufacturer’s instructions (Beyotime Biotechnology Co., Ltd., Shanghai, China). Three independent cell culture batches were selected. For each biological replicate sample, the lysate was divided into three portions and the protein concentrations in each group were measured using the BCA protein detection kit as instructed (Beyotime Biotechnology Co., Ltd., Shanghai, China).

2.6. Evaluation of Mda Content

The determination of MDA content was performed using the MDA assay kit, strictly following the procedures specified in the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Co., Ltd., Nanjing, China). All MDA content data were derived from three independent cell culture batches. Each batch sample was tested with three technical replicate wells. The BCA protein detection kit was used to measure the protein concentration in each group according to the manufacturer’s instructions (Beyotime Biotechnology Co., Ltd., Shanghai, China).

2.7. RNA Extraction, Library Preparation, and Transcriptome Sequencing

The extraction of total RNA was performed using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) in strict accordance with the manufacturer’s instructions. To obtain mRNA molecules with Poly-A tails, oligo-dT-attached magnetic beads were used to purify the extracted total RNA, followed by enzymatic digestion of the purified mRNA with fragmentation buffer. The first strand of cDNA was synthesized using random hexamer primer and reverse transcriptase, followed by the synthesis of the second strand of cDNA using DNA polymerase and RNase H. The synthesized cDNA products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). The purified cDNA fragments underwent sequential steps including end repair, addition of a single’ A’ base, and adapter ligation, followed by further purification and final cDNA library construction via PCR enrichment. Sequencing of the library was performed by Guangzhou Gene Denovo Bioinformatics Technology Co., Ltd., Guangzhou, China. on an Illumina® HiSeq 2500 platform.

2.8. Quality Control, Mapping, and Functional Annotation of Sequence Data

The quality assessment of the raw reads was performed using the FastQC [22]. To obtain high-quality, clean reads suitable for subsequent analyses, raw reads containing adapter sequences, those with an unknown base percentage exceeding 10%, or those failing to meet base quality standards were filtered out. Next, the qualified reads were aligned to the ribosomal database using the Bowtie tool to remove rRNA sequences. The remaining reads were then aligned to the reference genome (Gallus gallus) using the TopHat2 [23]. Following the alignment, the Cufflinks reference annotation-based transcript (RABT) assembly algorithm was employed to splice and assemble the successfully aligned reads into candidate transcripts, ultimately yielding the complete transcriptome assembly [24]. For functional enrichment analysis using Gene Ontology (GO) and pathway enrichment analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG), the statistical significance of both analyses was determined based on p-values.

2.9. RNA-Seq Data Analysis

In this study, DEseq2 was employed to analyze the read numbers mapped to each gene. Based on the gene length and the total number of reads aligned to the gene region, the FPKM (fragments per kilobase of transcript per million mapped reads) value for each gene was calculated. Differential expression analysis was performed using DEseq2, and differentially expressed genes (DEGs) were identified by screening with the following criteria: a corrected p-value of <0.05 and |fold change| > 1.2.

2.10. Real-Time Pcr Assay

cDNA reverse transcription was performed using the GoScript™ Reverse Transcription System (Promega, Madison, WI, USA), with all procedures conducted in accordance with the manufacturer’s instructions. Quantitative gene expression levels were achieved through real-time quantitative PCR using the CFX96 Touch Deep Well Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Amplification of target genes was performed with the specific primers listed in Table 1, with β-actin selected as the internal reference gene. The reaction mixture contained 6.25 μL of 2× GoTaq® qPCR Master Mix (Promega, Madison, WI, USA), and operations were strictly carried out according to the manufacturer’s protocol. Each sample was run in three parallel reaction wells. The qRT-PCR protocol consisted of 3 min of pre-denaturation at 95 °C followed by 39 cycles of 95 °C for 20 s and 60 °C for 30 s. Fluorescence signals generated during the reaction were collected and analyzed using Bio-Rad CFX Manager 3.1, relative expression levels were calculated using the 2−ΔΔCt method, with target gene expression data standardized relative to β-actin expression levels. To ensure data reliability, all primers were pre-validated using standard curves to confirm amplification efficiency (90–110%) and linear range (R2 ≥ 0.99), with melting curve analysis demonstrating a single peak, thereby verifying primer specificity meeting experimental requirements. Melting curves were plotted after completion of qPCR amplification. Primer information and candidate gene details are provided in Table 1.

Table 1.

Primer sequences for target genes and internal reference genes required for qRT-PCR.

Gene Primer Sequence (5′→3′)
β-actin (F)GTGGATCAGCAAGCAGGAGT
(R)ATCCTGAGTCAAGCGCCAAA
caspase3 (F)GATGCTGCAAGTGTCAGA
(R)ATCGCCATGGCTTAGCA
caspase9 (F)TCAGACATCGTATCCACCA
(R)AAGTCACAGCAGGGACA
HSF1 (F)GCTCATTCCATGCCGAAATA
(R)GGATGAATCGGGGGAGTAG
HSF2 (F) ATGGCCAGAGTTTCTTGGTG
(R) GGACAACTTTACGGAAGCCA
HSF3 (F) TCAAGCAATGTTATCTGGGAA
(R) CTTCAAACAACGAAAGCAGAG
HSF4 (F) CATCGCTGTATGTTCCATCT
(R) ACTGGTTGTTATCAGTCGAA
HSP70 (F)CCAAACAAACACAGACCTTC
(R)CGTTCAGGATACCATTAGCA
HSP90aa (F)AAAAGAGGGCTTAGAGCTTC
(R)CATTGTGGAGTTGTCTCTCA
HSP90ab (F)CTCTCACCCTGCTGGAC
(R)GGTAATGACAACCACCTTCT
Cytb-DNA (F) CCTCACACTCATAGCCACCG
(R) CCCCTCAGGCTCACTCTACT
Gapdh-DNA (F) GGGGAAAGTCATCCCTGAGC
(R) TTGGCTGGTTTCTCCAGACG
Open in a new tab

2.11. Statistical Methods

Differences between groups were statistically analyzed using ANOVA. All experimental data were expressed as the mean ± SE of results from three independent experiments. To enhance the precision of testing, the Tukey method was employed. A p-value less than 0.05 was considered statistically significant for inter-group differences. All statistical analyses in this study were performed using SPSS 20.0.

3. Results

3.1. Isolation, Extraction and Identification of Chicken Embryo Cardiomyocytes

The immunofluorescence results for α-actin are shown in Figure 1c; α-actin is specific to muscle cells. The isolated chicken embryonic cardiomyocytes are spindle-shaped, and when the cells are aggregated, a pulsating cell population can be observed (Figure 1a). The blue fluorescence in the figure represents DAPI-labeled nuclei, while the red fluorescence indicates α-actin protein (Figure 1b,c). As shown in the figure, most cells exhibit strong red fluorescence, suggesting that the isolated cells are predominantly cardiomyocytes.

Figure 1.

Figure 1

Open in a new tab

Immunofluorescence results. (a) Morphology of cardiomyocytes under light microscopy (400×); (b) DAPI-stained nuclei (400×); (c) α-actin immunofluorescence staining (400×); (d) DAPI and α-actin fluorescence overlap.

3.2. The Protective Impact of Curcumin on Cardiomyocytes Under Heat Stress

Here, we evaluated the preservative effect of curcumin on cardiomyocytes under heat stress by measuring the release ratio of CK-MB and LDH, the cellular MDA, and mitochondrial membrane potential (ΔΨm). As shown in Figure 2a,b, the release ratio of CK-MB and LDH was significantly enhanced in HS group compared to CK group. And compared with HS group, curcumin could significantly decrease the release ratio of CK-MB and LDH. MDA is a lipid peroxidation product, its quantity can assess the degree of lipid peroxidation. Compared to CK group, heat stress significantly increased the MDA level. And compared with the CK and HS group, curcumin significantly decreased the MDA level (Figure 2c). ΔΨm reflects the function of mitochondria, and the decrease in ΔΨm is a sign of early stage apoptosis. Compared to the CK group, ΔΨm was significantly decreased by heat stress. The decreased ΔΨm will be increased by curcumin (Figure 2d). Above all, curcumin can protect cardiomyocytes from heat stress.

Figure 2.

Figure 2

Open in a new tab

The protective effect of curcumin on cardiomyocytes under heat stress. (a) Release ratio of CK-MB; (b) release ratio of LDH; (c) MDA; (d) mitochondrial membrane potential.

3.3. Overview of RNA-Seq Results

To investigate the protective mechanism of curcumin on cardiomyocytes under heat stress, we conducted a transcriptome analysis of cardiomyocytes in CK group, HS group and HS_Cur group. The results of the RNA-seq sequencing analysis are presented in Table 1 and Table 2, and Figure 2. The number of clean reads obtained from each sequencing library ranged from 44,118,656 to 60,782,244, with a Q20 value exceeding 97.53% (Table 2). After filtering out low-quality reads, adapter-contaminated sequences, and rRNA reads from the raw data, the clean reads exhibited a matching rate of up to 89.70% to the Gallus gallus genome (Table 3). Compared to the CK group, the HS treatment group showed a significant up-regulation trend in 2395 DEGs and a significant down-regulation trend in 3199 DEGs. In contrast, the HS_Cur group, demonstrated a significant up-regulation of 413 DEGs and a significant down-regulation of 601 DEGs compared to the HS treatment group (Figure 3).

Table 2.

Summary of the RNA-seq data collected from CK, HS and HS_Cur groups.

Sample Name Raw Reads Clean Read Number Adapter (%) Low-Quality (%) Poly-A (%) N (%) Q20 (%) GC (%)
CK-1 58,123,746 57,977,880 (99.75%) 32,440 (0.06%) 113,426 (0.20%) 0 (0.00%) 0 (0.00%) 855,3457,054 (98.11%) 4,621,415,178 (53.01%)
CK-2 50,523,024 50,339,438 (99.64%) 65,802 (0.13%) 117,262 (0.23%) 522 (0.00%) 7,391,027,586 (97.53%) 3,900,775,977 (51.47%)
CK-3 53,047,124 52,861,240 (99.65%) 50,118 (0.09%) 135,766 (0.26%) 0 (0.00%) 7,786,833,986 (97.86%) 4,139,385,618 (52.02%)
HS-1 49,843,686 49,668,590 (99.65%) 46,910 (0.09%) 128,186 (0.26%) 0 (0.00%) 7,317,180,832 (97.87%) 3,874,100,693 (51.82%)
HS-2 59,920,998 59,727,944 (99.68%) 51,386 (0.09%) 141,668 (0.24%) 0 (0.00%) 8,798,278,794 (97.89%) 4,683,940,374 (52.11%)
HS-3 44,118,656 43,964,594 (99.65%) 43,902 (0.10%) 110,160 (0.25%) 0 (0.00%) 6,482,605,394 (97.96%) 3,450,258,130 (52.14%)
HS_Cur-1 47,472,910 47,324,684 (99.69%) 38,214 (0.08%) 110,012 (0.23%) 0 (0.00%) 6,977,589,562 (97.99%) 3,740,338,975 (52.53%)
HS_Cur-2 54,398,710 54,215,084 (99.66%) 51,138 (0.09%) 132,488 (0.24%) 0 (0.00%) 7,987,638,682 (97.89%) 4,268,991,696 (52.32%)
HS_Cur-3 60,782,244 60,574,466 (99.66%) 59,056 (0.10%) 148,722 (0.24%) 0 (0.00%) 8,931,523,593 (97.96%) 4,769,054,275 (52.31%)
Open in a new tab

Table 3.

Summary of clean reads mapped to reference genome from CK, HS and HS_Cur groups.

Sample Name Total Reads Multiple Mapped Unique Mapped Known Genes Novel Genes Total Genes
CK-1 57,031,154 1,318,452 (2.31%) 51,729,650 (90.70%) 15,185 (91.65%) 923 (98.09%) 16,108 (92.00%)
CK-2 49,379,568 1,075,082 (2.18%) 45,161,442 (91.46%) 15,159 (91.50%) 926 (98.41%) 16,085 (91.87%)
CK-3 52,159,982 1,127,740 (2.16%) 47,247,607 (90.58%) 15,136 (91.36%) 921 (97.87%) 16,057 (91.71%)
HS-1 48,847,168 1,030,944 (2.11%) 44,431,101 (90.96%) 15,040 (90.78%) 926 (98.41%) 15,966 (91.19%)
HS-2 58,463,770 1,295,756 (2.22%) 52,443,260 (89.70%) 15,188 (91.67%) 928 (98.62%) 16,116 (92.04%)
HS-3 43,283,996 911,348 (2.11%) 39,175,523 (90.51%) 14,987 (90.46%) 928 (98.62%) 15,915 (90.90%)
HS_Cur-1 46,659,624 985,291 (2.11%) 42,529,811 (91.15%) 15,095 (91.11%) 930 (98.83%) 16,025 (91.52%)
HS_Cur-2 53,466,102 1,168,828 (2.19%) 48,499,911 (90.71%) 15,146 (91.42%) 926 (98.41%) 16,072 (91.79%)
HS_Cur-3 59,775,552 1,285,962 (2.15%) 54,311,280 (90.86%) 15,203 (91.76%) 931 (98.94%) 16,134 (92.15%)
Open in a new tab

Figure 3.

Figure 3

Open in a new tab

Differentially expressed genes statistics. The number of up-regulated and down-regulated genes in the CK vs. HS and HS vs. HS_Cur comparisons are summarized.

3.4. Degs Functional Annotation

The DEGs from CK vs. HS and HS vs. HS_Cur comparisons were annotated using the GO database (Figure 4). In the CK vs. HS comparison, metabolic process, cellular response to stress, organic matter metabolic process and cellular response to DNA damage stimulus were the most frequent terms in biological process. This may indicate that cellular metabolism was altered and DNA was damaged by heat stress. Catalytic activity, guanyl-nucleotide exchange factor function and activity of ras guanyl-nucleotide exchange factor were the top terms in molecular function. Intracellular part, intracellular and cytoplasm were the top terms in cellular component.

Figure 4.

Figure 4

Open in a new tab

GO classification of DEGs. The blue column represents biological process; the red column represents molecular function; the green column represents cellular component. (a) CK vs. HS comparison; (b) HS vs. HS_Cur comparison.

In the HS vs. HS_Cur comparison, multicellular organismal process, inflammatory response and the processes related to single-multicellular organism were the most prevalent terms in biological process; RNA-directed DNA polymerase function, binding activity, and protein binding were the top terms in molecular function; extracellular region, extracellular space and extracellular region part were the top terms in cellular component.

Pathway enrichment analysis was conducted based on the KEGG pathway database (Figure 5). In CK vs. HS comparison, Ubiquitin-mediated proteolysis, eukaryotes ribosome biogenesis, and endoplasmic reticulum protein processing were related to proteotoxic stress caused by heat stress [25,26,27], which were shown in the top 25 KEGG list. Cell cycle, DNA replication and base excision repair were also shown in the list, which indicated that cell proliferation and base repair will be altered by heat stress. Terpenoid backbone biosynthesis was also shown in the KEGG list, which is related to the synthesis of CoQ and GPX4 and could increase the resistant ability of cell to iron.

Figure 5.

Figure 5

Open in a new tab

The top 25 pathways in KEGG enrichment by p-value. (a) CK vs. HS comparison; (b) HS vs. HS_Cur comparison.

In HS vs. HS_Cur, ferroptosis, porphyrin and chlorophyII metabolism were involved in iron metabolism. The KEGG analysis also identified pathways related to fluid shear stress and atherosclerosis, adrenergic signaling in cardiomyocytes, and cardiac muscle contraction, which were related to the function of cardiomyocytes.

3.5. Identification of the DEGs Related to Iron Homeostasis

Iron metabolism-related pathways were shown in the KEGG list in both comparisons. Ferroptosis, an iron-catalyzed form of regulated necrosis, results from the excessive peroxidation of polyunsaturated fatty acids (PUFAs) [28]. The ferroptosis pathway enrichment was statistically significant between the HS and Cur groups (p < 0.05).

GSH is the co-factor of GPX4, which is a central enzymatic component of the antioxidant system [29]. Compared with the CK group, SLC7A11 was down-regulated and GCLC was up-regulated by heat stress, which resulted in no significant difference in the content of GSH in the HS group (Table 4 and Figure 6). Compared with the HS group, SLC7A11 was up-regulated by curcumin, which resulted in a significant increase in GSH (Table 4 and Figure 6). Mevalonate pathway produces isopentenyl pyrophosphate (IPP) and farnesyl diphosphate (FPP) [30]. IPP could provide selenium for the active center of the GPX4 [31]. FPP is a vital molecule for respiratory chain and resisting to ferroptosis [31]. Compared with the CK group, the expression of several genes involved in the mevalonate pathway (HMGCR, HMGCS1, MVK, MVD and PMVK) were significantly decreased in the HS group. There was no notable difference in the expression of mevalonate pathway-related genes between HS group and HS_Cur group.

Table 4.

Identification of the DEGs related to iron homeostasis.

Function Gene Name CK vs. HS HS vs. Cur Products
log2FC UP or DOWN log2FC UP or DOWN
GSH synthase SLC7A11 −0.399 DOWN 0.397 UP solute carrier family 7 member 11
GCLC 0.358 UP 0.113 N.S glutamate-cysteine ligase catalytic subunit
Ser-tRNA isoprenylation HMGCR −0.406 DOWN 0.065 N.S 3-hydroxy-3-methylglutaryl-CoA reductase
HMGCS1 −0.341 DOWN −0.062 N.S 3-hydroxy-3-methylglutaryl-CoA synthase 1
MVK −0.371 DOWN −0.228 N.S mevalonate kinase
MVD −0.48 DOWN 0.166 N.S mevalonate diphosphate decarboxylase
PMVK −0.665 DOWN −0.065 N.S phosphomevalonate kinase
Iron regulator IRP1 0.474 UP 0.021 N.S aconitase 1
Fe2+ storage FTL 0.113 N.S −0.265 DOWN ferritin light chain
FTH1 0.178 N.S 0.316 UP ferritin heavy chain 1
Fe2+ release NCOA4 0.428 UP −0.063 N.S nuclear receptor coactivator 4
MAP1LC3B2 −0.263 DOWN 0.133 N.S microtubule associated protein 1 light chain 3 beta 2
MAP1LC3C −0.273 N.S −0.437 DOWN microtubule associated protein 1 light chain 3 gamma
FPN 0.346 UP 0.017 N.S Ferroportin
heme synthase ALAS2 −0.316 DOWN 0.186 N.S 5-aminolevulinate synthase 2
ALAD −0.721 DOWN 0.052 N.S aminolevulinate dehydratase
HMBS −0.405 DOWN 0.013 N.S hydroxymethylbilane synthase
ABCB6 −0.523 DOWN 0.206 N.S ATP binding cassette subfamily B member 6
FECH −0.334 DOWN 0.353 UP ferrochelatase
ABCB8 0.414 UP −0.022 N.S ATP binding cassette subfamily B member 8
ABCB10 0.468 UP 0.098 N.S ATP binding cassette subfamily B member 10
SLC25A37 0.561 UP 0.094 N.S solute carrier family 25 (mitochondrial iron transporter), member 37
Fe-S cluster synthesis ISCA1 0.437 UP −0.057 N.S iron-sulfur cluster assembly 1
IBA57 1.217 UP −0.064 N.S IBA57 homolog
NFU1 −0.314 DOWN −0.117 N.S NFU1 iron-sulfur cluster scaffold
FXN −0.006 N.S −0.415 DWON frataxin
anti-oxidate Nrf2 −0.523 DOWN 0.002 N.S nuclear factor, erythroid 2 like 2
KEAP1 0.526 UP 0.383 UP kelch-like ECH-associated protein 1
SQSTM1 −0.347 DOWN 0.277 UP sequestosome 1
NQO1 −0.253 N.S 0.528 UP NAD(P)H dehydrogenase [quinone] 1 isoform 1
Open in a new tab

Figure 6.

Figure 6

Open in a new tab

Evaluation of GSH and GSSG content (a) GSH; (b) GSSG; (c) GSH/GSSG.

Next, we paid attention to several iron metabolism-related genes. FTL and FTH1 are the compositions of ferritin, which is utilized to store excess iron [32]. When cellular iron is depleted, FTL knockout cells inhibit ferritin degradation by decreasing interactions with NCOA4 [33]. MAP1LC3B2 and MAP1LC3C participate in ferritinophagy [33]. Currently, FPN stands as the only known protein capable of exporting iron [34]. Compared to the CK group, heat stress could increase the iron releasing by up-regulating the expression of NCOA4. Meanwhile, heat stress could decrease the iron content by inhibiting the expression of MAP1LC3B2 and promoting the transcription of FPN. We found that curcumin could up-regulate FTH1 and down-regulate FTL and MAP1LC3C to increase iron storage ability and inhibit ferritin degradation.

ISCA2 and IBA57 is the composition of ISA complex, which participates in the Fe/S assembly in mitochondria [35]. NFU1 transfers [4Fe-4S] cluster from the ISA complex to client protein to protect [4Fe-4S] cluster from oxidative damage [36]. Frataxin (FXN) functions as both an iron oxidase and an iron chaperone, regulating iron homeostasis and providing an iron source for heme biosynthesis [37]. In the curcumin-treated group, FXN was significantly down-regulated compared to HS group. The inhibition of heme and [4Fe-4S] cluster by heat stress may increase the LIP and disturb the distribution of intracellular iron.

LIP is one of the sources for ROS, which will be eliminated by Nrf2 target proteins. Keap1 is the negative regulator of Nrf2 [38], which was up-regulated by heat stress. Compared to HS group, Keap1 was up-regulated by curcumin. SQSTM1 could activate Nrf2 by inactivation of Keap1 [39]. SQSTM1 was down-regulated by heat stress compared to CK group. While SQSTM1 was up-regulated by curcumin compared to HS group. NQO1 is the negative regulator of ferroptosis [40]. It was up-regulated by curcumin compared to the HS group.

3.6. Verification of Degs by Qpcr

To confirm the accuracy, reliability, and experimental reproducibility of the results obtained from this transcriptome sequencing analysis, we selected four genes to conduct RT-qPCR validation (Figure 7). Using RT-qPCR technology, we analyzed the expression profiles of these four candidate genes and found that the results were consistent with those obtained from RNA-seq sequencing, demonstrating our transcriptome analysis.

Figure 7.

Figure 7

Open in a new tab

Expression levels of candidate genes by RT-qPCR and RNA-seq. The heat map shows the FPKM values for the four selected candidate genes. GAPDH was used as the reference gene. (a) SLC7A11; (b) GCLC; (c) LPCAT3; (d) PTGS2.

4. Discussion

Apoptosis, inflammation, autophagy, heat shock response, and oxidative stress are the main topics of many studies on heat stress [18,41,42,43,44]. Iron homeostasis receives less attention. In this paper, we investigated the protective impact of curcumin on heat-stressed cardiomyocytes using transcriptome analysis. ABC transporters participate in mitochondrial iron transport, which was the most significantly enriched term in both comparisons [45,46,47]. In addition to taking part in tissue pathological processes, the ABC transporter shields the heart from oxidative stress damage brought on by medicines and harmful chemicals [48]. Ferroptosis-related terpenoid backbone biosynthesis was displayed in the KEGG list in the CK vs. HS comparison [49,50]. Iron metabolism-related ferroptosis, porphyrin, and chlorophyll II metabolism were also displayed in both comparisons. Ferroptosis is a unique process of cell death involved in high iron and lipid peroxidation [51]. Porphyrin and chlorophyII metabolism is a pathway that is involved in the synthesis of heme [11]. The majority of iron in the human body is used for the creation of Heme- and Fe-S cluster cofactors. Iron metabolism may potentially be impacted by heme production. We assumed that heat stress may disturb iron homeostasis, and curcumin can protect cells from toxicity caused by free iron [8].

We concentrated on the DEGs associated with iron metabolism in our DEG analysis. Research has demonstrated that mitochondrial iron excess is associated with altered Fe-S cluster and heme biogenesis [52]. Thus, we also focused on DEGs associated with heme production and Fe-S clusters. Under heat stress, we discovered that five DEGs relevant to heme synthesis were down-regulated, including the rate-limiting enzymes FECH and ALAS2 [53]. Heat stress inhibited NFU1, which is necessary for transporting Fe-S to client protein [54]. Heat stress may encourage additional iron to be imported into mitochondria by interfering with the production of heme and Fe-S to client protein. In our investigation, we discovered that heat stress increased the expression of ferritinophagy-related NCOA4, SLC25A37, and mitochondrial iron importer ABCB10. Iron overload in the cytosol and mitochondria may result from the overexpression of ABCB10, SLC25A37, and NCOA4. These will cause ferritinophagy-related MAP1LC3B2 to be down-regulated and iron exporter ABCB8 and ferroportin to be up-regulated. Curcumin could up-regulate the expression of FECH and down-regulate FXN to promote the synthesis of heme. Curcumin may promote FTH1 expression in the cytoplasm to boost iron storage capacity. Moreover, curcumin may prevent ferritinophagy by down-regulating the expression of FTL and MAP1C3C. Heat stress has been shown to enhance iron buildup and change the expression of iron regulatory proteins [55]. This result is similar with ours, while the cellular concentration of iron in our study needs further investigation.

The primary source of hydroxyl radicals, which might result in lipid peroxidation, is an excess of iron [56]. Lipid-based reactive oxygen species are the hallmark of ferroptosis, a novel type of cell death [57]. For cells to survive under heat stress, they must be able to get rid of lipid-based reactive oxygen species. Thus, we also examined the DEGs associated with antioxidants. There was no discernible change in the GSH level as a result of heat stress repressing the expression of SLC7A11 and increasing the representation of GCLC. However, heat stress considerably raised the MDA level, indicating that lipid peroxidation was higher in the heat-stressed group than in the control group. Polyunsaturated fatty acids are shielded from lipid peroxidation by GPX4 [29]. Ferroptosis, LPO buildup, and lipid peroxidation are caused by GPX4 deficiency. Curcumin can trigger the Nrf2 protein to reach the nucleus and promote the production of antioxidant genes, as we have shown in earlier research [19]. According to recent research, Nrf2 regulates a number of genes associated with heme synthesis (such as ABCB6 and FECH), iron storage (such as ferritin heavy chain FTH1 and ferritin light chain FTL), and iron transport (such as iron transporter FPN) [58,59]. Curcumin could up-regulate SLC7A11 to increase the GSH level and inhibit the production of MDA. In the meantime, curcumin could increase the number of activated Nrf2 by increasing the expression of SQSTM1, which will induce the expression of NQO1, FECH, FTH1.

5. Conclusions

On the one hand, we discovered that heat stress reduced the representation of genes linked to heme production. These may decrease the utilization of iron from LIP. On the other hand, the suppression of heme and NFU1 expression may have led to a shortage of heme and prevented Fe-S from reaching client protein, which could trigger iron starvation stress. IRP1 and ferritinophagy-related NCOA4 were up-regulated in heat stress group, which elevates LIP. LIP is one of the sources of ROS and could induce ferroptosis. The Nrf2 activity may be suppressed by activating the representation of KEAP1 and inhibiting the representation of SQSTM1 under heat stress (Figure 8a). We discovered that heat stress may reduce GPX4 function by inhibiting the production of genes linked to the mevalonate pathway, which may result in lipid peroxidation. (Figure 8b).

Figure 8.

Figure 8

Open in a new tab

The explanation of the protective effect of curcumin on cardiomyocytes under heat stress from the perspective of mRNA level. (a) Heme and Fe-S with iron homeostasis; (b) GPX4 and lipid peroxidation. The blue oval represents that there was no significant difference between CK and HS group; the red oval represents that it was up-regulated in HS group compared to CK group; the green oval represents that it was down-regulated in HS group compared to CK group; the red arrow represents that it was up-regulated in HS_Cur group compared to HS group; the green arrow represents that it was down-regulated in HS_Cur group compared to HS group.

Curcumin could enhance the heme level and iron utilization by suppressing the expression of FXN and increasing the expression of FECH. Curcumin altered ferritin’s composition, which may improve iron storage capacity and prevent ferritinophagy. Curcumin may prevent ferroptosis by increasing GSH production and SQSTM1 and NQO1 expression (Figure 8). Direct measurements of parameters like LIP and GPX4 activity are still necessary to conclusively establish the functions of these processes, even if our data strongly suggest their existence. Future studies will directly measure key functional parameters to conclusively confirm this mechanism.

Abbreviations

DEGs differentially expressed genes
LIP labile iron pool
ALAS δ-aminolevulinate synthase
FECH Ferrochelatase
ABCB6 ATP-binding cassette transporter B6
ABCB8 ATP-binding cassette transporter B8
ABCB10 ATP-binding cassette transporter B10
ALA δ-aminolevulinic acid
SLC25A37 solute carrier family 25 (mitochondrial iron transporter), member 37; mitoferrin-1
FTH1 ferritin heavy chain
FTL ferritin light chain
FPN ferroportin
ARFs ADP-ribosylation factors
ISC iron-sulfur cluster
PUFAs polyunsaturated fatty acids
IPP isopentenyl pyrophosphate
FPP farnesyl diphosphate
SLC7A11 solute carrier family 7 member 11
GCLC glutamate-cysteine ligase catalytic subunit
HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase
HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1
MVK mevalonate kinase
MVD mevalonate diphosphate decarboxylase
PMVK phosphomevalonate kinase
NCOA4 nuclear receptor coactivator 4
MAP1LC3B2 microtubule associated protein 1 light chain 3 beta 2
MAP1LC3C microtubule associated protein 1 light chain 3 gamma
ALAD aminolevulinate dehydratase
HMBS hydroxymethylbilane synthase
ISCA1 iron-sulfur cluster assembly 1
IBA57 IBA57 homolog
NFU1 NFU1 iron-sulfur cluster scaffold
FXN frataxin
Nrf2 nuclear factor, erythroid 2 like 2
KEAP1 kelch-like ECH-associated protein 1
SQSTM1 sequestosome 1
NQO1 NAD(P)H dehydrogenase [quinone] 1 isoform 1
Open in a new tab

Author Contributions

Conceptualization, D.B.; Methodology, M.B. and D.B.; Validation, X.Z.; Formal Analysis, M.B. and D.Z.; Investigation, M.B., X.Z., D.Z. and J.B.; Resources, D.B.; Data Curation, M.B.; Writing—Original Draft, M.B.; Writing—Review and Editing, M.B. and D.B.; Visualization, M.B.; Supervision, D.B.; Project Administration, D.B.; Funding Acquisition, D.B. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

All animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee of the College of Animal Science, Fujian Agriculture and Forestry University (protocol code PZCASFAFU24042 and the clearance date is 15 March 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare that they have no competing interests.

Funding Statement

This work was supported by the Natural Science Foundation of Fujian Province of China [2019J01377] and the Discipline Development Grant from the College of Animal Sciences FAFU [2018DK006]. The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Abu Hemayet M., Sarker M.S.K., Bin Idrus Z., Ali M.Z., Sazili A.Q., Alam Bhuyian M.S., Khatun H., Lestari D.A., Setiaji A., Kamalludin M.H. Comparative Analysis of Physiological, Biochemical and Immunological Responses to Heat Stress in Hybrid and Purebred Ducks in Tropical Environments. Vet. Anim. Sci. 2026;33:100716. doi: 10.1016/j.vas.2026.100716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.He Y., Yu J., Song Z., Tang Z., Duan J.-A., Zhu H., Liu H., Zhou J., Cao Z. Anti-Oxidant Effects of Herbal Residue from Shengxuebao Mixture on Heat-Stressed New Zealand Rabbits. J. Therm. Biol. 2024;119:103752. doi: 10.1016/j.jtherbio.2023.103752. [DOI] [PubMed] [Google Scholar]
  • 3.Yu J., Wang Q., Xu M., Wang S., Xu Y., He H. Exploring the Mechanism of Qiling Jiaogulan Powder in Protecting Heart Injury of Heat-Stressed Broilers Based on Transcriptome. Poult. Sci. 2025;104:105962. doi: 10.1016/j.psj.2025.105962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zhang J., Schmidt C.J., Lamont S.J. Transcriptome Analysis Reveals Potential Mechanisms Underlying Differential Heart Development in Fast- and Slow-Growing Broilers under Heat Stress. BMC Genom. 2017;18:295. doi: 10.1186/s12864-017-3675-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yang Z., Hua X., Wang F., Wang Y., Hou X., Yang F., Chen X., Liu T., Ma X., Valdivia H.H., et al. OpiCa1 Reduces Inflammation and ROS Levels Counteracting Heat Stress-Induced Cardiac Injury. Eur. J. Pharmacol. 2025;999:177711. doi: 10.1016/j.ejphar.2025.177711. [DOI] [PubMed] [Google Scholar]
  • 6.Lai X., Wang Y., Zhang J., Xie H., Wu S., Wang L. Finerenone Improves Doxorubicin-Induced Cardiotoxicity by Inhibiting Cardiomyocyte Apoptosis through the TAK1-p38 Axis. Biochem. Pharmacol. 2026;249:117877. doi: 10.1016/j.bcp.2026.117877. [DOI] [PubMed] [Google Scholar]
  • 7.Arami S., Chaboki B.G., Salari A., Baharvand F., Mousavi S.M., Ahmadnia Z. Red Blood Cell Metrics as Predictors of Cardiovascular Risk in Anemic versus Non-Anemic Heart Failure Patients. BMC Cardiovasc. Disord. 2026;26:200. doi: 10.1186/s12872-026-05530-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bian R., Shang Y., Xu N., Liu B., Ma Y., Li H., Chen J., Yao Q. HDAC Inhibitor Enhances Ferroptosis Susceptibility of AML Cells by Stimulating Iron Metabolism. Cell. Signal. 2025;127:111583. doi: 10.1016/j.cellsig.2024.111583. [DOI] [PubMed] [Google Scholar]
  • 9.Chitrakar I., Roberson A.B., Ayres-Galhardo P.H., Brown B.L. A reversible feedback mechanism regulating mitochondrial heme synthesis. J. Biol. Chem. 2026;302:111089. doi: 10.1016/j.jbc.2025.111089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang F., Zhang M., Wu Y., Cheng J., Chen R., Pan H., Lu L., He X., Yi H., Tang S. No interaction between genetic variants and DNA methylation of the ferrochelatase gene in relation to antituberculosis drug-induced liver injury. Pharmacogenet. Genom. 2026;36:71–79. doi: 10.1097/FPC.0000000000000583. [DOI] [PubMed] [Google Scholar]
  • 11.Singh H., Shyamveer, Mahajan S.D., Aalinkeel R., Kaliyappan K., Schwartz S.A., Bhattacharya M., Parvez M.K., Al-Dosari M.S. Identification of novel genetic variations in ABCB6 and GRN genes associated with HIV-associated lipodystrophy. Clin. Chim. Acta. 2024;556:117830. doi: 10.1016/j.cca.2024.117830. [DOI] [PubMed] [Google Scholar]
  • 12.Yang C., Wang T., Zhao Y., Meng X., Ding W., Wang Q., Liu C., Deng H. Flavonoid 4,4′-dimethoxychalcone induced ferroptosis in cancer cells by synergistically activating Keap1/Nrf2/HMOX1 pathway and inhibiting FECH. Free Radic. Biol. Med. 2022;188:14–23. doi: 10.1016/j.freeradbiomed.2022.06.010. [DOI] [PubMed] [Google Scholar]
  • 13.Sun Y., Zuo Y., Zhang J., Wu Y., Xia X., Liu J. Plasma-Derived Exosomal hsa-miR-3677-3p Induces Ferroptosis in Neurons by Targeting ABCB8 in Perioperative Neurocognitive Disorders After Prostate Surgery. Neurochem. Res. 2026;51:59. doi: 10.1007/s11064-026-04665-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Menon A.V., Kim J. Iron Promotes Cardiac Doxorubicin Retention and Toxicity Through Downregulation of the Mitochondrial Exporter ABCB8. Front. Pharmacol. 2022;13:817951. doi: 10.3389/fphar.2022.817951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Do Y., Yagi M., Hirai H., Miki K., Fukahori Y., Setoyama D., Yamamoto M., Furukawa T., Kunisaki Y., Kang D., et al. Cardiomyocyte-specific deletion of the mitochondrial transporter Abcb10 causes cardiac dysfunction via lysosomal-mediated ferroptosis. Biosci. Rep. 2024;44:BSR20231992. doi: 10.1042/BSR20231992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Seguin A., Takahashi-Makise N., Yien Y.Y., Huston N.C., Whitman J.C., Musso G., Wallace J.A., Bradley T., Bergonia H.A., Kafina M.D., et al. Reductions in the mitochondrial ABC transporter Abcb10 affect the transcriptional profile of heme biosynthesis genes. J. Biol. Chem. 2017;292:16284–16299. doi: 10.1074/jbc.M117.797415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ni F., Huang Z., Cui Y., Huang P., Xue Z., Huang G., Zhao Y. S-equol promotes ferroptosis in triple negative breast cancer by coordinating NCOA4-mediated ferritinophagy and PPARγ-mediated lipid metabolism. Mol. Cell. Biochem. 2026;481:2119–2137. doi: 10.1007/s11010-026-05524-y. [DOI] [PubMed] [Google Scholar]
  • 18.Giraldo-Acosta M., Giannilivigni A., Girolami F., Giantin S., Carisio L., Vigliante I., Dellapiana C., Gatti N., Quaglino A., Nebbia C., et al. Climate-related combined abiotic stress enhances dhurrin accumulation and drives metabolic reprogramming in Sorghum bicolor compromising forage safety. Plant Stress. 2026;2:101374. doi: 10.1016/j.stress.2026.101374. [DOI] [Google Scholar]
  • 19.Lin X., Bai D., Wei Z., Zhang Y., Huang Y., Deng H., Huang X. Curcumin attenuates oxidative stress in RAW264.7 cells by increasing the activity of antioxidant enzymes and activating the Nrf2-Keap1 pathway. PLoS ONE. 2019;14:e0216711. doi: 10.1371/journal.pone.0216711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cong P., Tong C., Liu J., Luo Z., Li H., Yao J., Liu Y. Curcumin alleviates cold stress-induced myocardial injury by regulating macrophage polarization through the STUB1/STAT1-STAT6-KLF4 signaling axis. Int. Immunopharmacol. 2026;185:117045. doi: 10.1016/j.intimp.2026.117045. [DOI] [PubMed] [Google Scholar]
  • 21.Li J., Feng M., Wu Z., Zhu H., Sun Z., Zhou Z., Zhao J. Curcumin Exerts Anticancer Effects in Osteosarcoma by Targeting FoxO3A. J. Hainan Med. Univ. 2025;31:561–569. doi: 10.13210/j.cnki.jhmu.20250325.002. [DOI] [Google Scholar]
  • 22.Wang Y., Huang Y., Zhen Y., Wang J., Wang L., Chen N., Wu F., Zhang L., Shen Y., Bi C., et al. De novo transcriptome assembly database for 100 tissues from each of seven species of domestic herbivore. Sci. Data. 2024;11:488. doi: 10.1038/s41597-024-03338-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kim D., Pertea G., Trapnell C., Pimentel H., Kelley R., Salzberg S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013;14:R36. doi: 10.1186/gb-2013-14-4-r36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Roberts A., Pimentel H., Trapnell C., Pachter L. Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics. 2011;27:2325–2329. doi: 10.1093/bioinformatics/btr355. [DOI] [PubMed] [Google Scholar]
  • 25.Xia B., Song J., Xin Q., Wang C., Yu W., Liu J., Yu G., Wang F., Xu D. Mechanisms of heat and hypoxia defense in the sea cucumber Apostichopus japonicus: Insights from ubiquitination regulation. Comp. Biochem. Physiol. Part D Genom. Proteom. 2026;59:101469. doi: 10.1016/j.cbd.2026.101801. [DOI] [PubMed] [Google Scholar]
  • 26.Liao X., Li X., Mou A., Zhang Q., Dong Y., Li Y., Zhang X., Xu Q. Thermal acclimatization mechanisms in the cold-water Ophiuroid Ophiura sarsii vadicola: Regulation of protein homeostasis and metabolic pathways. J. Therm. Biol. 2025;130:104137. doi: 10.1016/j.jtherbio.2025.104137. [DOI] [PubMed] [Google Scholar]
  • 27.Gao S., Zheng X., Jiang Y., Zhang F., Pei W., Yang G., Liu G. ER Proteotoxic Stress Drives Mitochondrial Dysfunction in Heat-Stressed Intestinal Epithelial Cells. Cells. 2026;15:486. doi: 10.3390/cells15050486. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lu X., Sharko O.L., Shmanai V.V., Shchepinov M.S., Markworth J.F. Deuterated polyunsaturated fatty acids alleviate in vitro skeletal muscle dysfunction induced by oxidative stress. Free Radic. Biol. Med. 2026;248:222–237. doi: 10.1016/j.freeradbiomed.2026.02.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Xue H., Huang S.Q., Xia Y.Q., Ding L.Y., Dong L., Huang H.L. Tiaojing Cuyun Recipe inhibits ferroptosis through SLC7A11/GSH/GPX4 axis to improve endometrial receptivity of mice with embryo implantation dysfunction. J. Tradit. Complement. Med. 2025;16:260–270. doi: 10.1016/j.jtcme.2025.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhang T., Cai Y., Zhang Q., Li B., Yao J., Lian H., Wang M., He B., Zhang H., Hou C. The isopentenyl diphosphate synthase gene family in Cinnamomum burmanni: Genome-wide identification and functional analysis. Plant Physiol. Biochem. 2026;231:111021. doi: 10.1016/j.plaphy.2026.111021. [DOI] [PubMed] [Google Scholar]
  • 31.Stefely J.A., Pagliarini D.J. Biochemistry of Mitochondrial Coenzyme Q Biosynthesis. Trends Biochem. Sci. 2017;42:824–843. doi: 10.1016/j.tibs.2017.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Cloonan S., Zhang W., Kim K., Faherty L., Simmons W., Carrasco S., Hoffman K., Houghton S., Hsu C.-L., Haber L., et al. Targeted deletion of macrophage ferritin heavy chain protects from macrophage ferroptosis in acute respiratory distress syndrome. Res. Sq. 2026 doi: 10.21203/rs.3.rs-5276478/v1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Fujimaki M., Furuya N., Saiki S., Amo T., Imamichi Y., Hattori N. Iron Supply via NCOA4-Mediated Ferritin Degradation Maintains Mitochondrial Functions. Mol. Cell. Biol. 2019;39:e00010-19. doi: 10.1128/MCB.00010-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Banerjee S., Lu S., Jain A., Wang I., Tao H., Srinivasan S., Nemeth E., He P. Targeting PKCα alleviates iron overload in diabetes and hemochromatosis through the inhibition of ferroportin. Blood. 2024;144:1433–1444. doi: 10.1182/blood.2024023829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Nasta V., Da Vela S., Gourdoupis S., Ciofi-Baffoni S., Svergun D.I., Banci L. Structural properties of [2Fe-2S] ISCA2-IBA57: A complex of the mitochondrial iron-sulfur cluster assembly machinery. Sci. Rep. 2019;9:18986. doi: 10.1038/s41598-019-55313-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Melber A., Na U., Vashisht A., Weiler B.D., Lill R., Wohlschlegel J.A., Winge D.R. Role of Nfu1 and Bol3 in iron-sulfur cluster transfer to mitochondrial clients. eLife. 2016;5:e15991. doi: 10.7554/eLife.15991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Zhang J., Zhou Y., Duan Q., Xu X., Wang X., Wang J., Liu L. Characterization of Arabidopsis thaliana FRATAXIN HOMOLOG in heme catabolism. Biochimie. 2025;231:110–115. doi: 10.1016/j.biochi.2024.12.010. [DOI] [PubMed] [Google Scholar]
  • 38.Li K., Tang S., Ding J., Yang Y., Chen H., Jiang Q., Wei X., Yang J. N-acetylcysteine enhances antioxidant capacity and anti-bacterial immunity of T cells in tilapia by regulating KEAP1-NRF2 axis. Aquaculture. 2026;620:743949. doi: 10.1016/j.aquaculture.2026.743949. [DOI] [Google Scholar]
  • 39.Chen Y., Yu W., Wu X., Wang J., Li N., Jiang Z., Li X. Platanoside prevents ferroptosis in acute lung injury through Keap1 degradation-mediated activation of the Nrf2/GPX4 axis. Int. Immunopharmacol. 2026;168:115933. doi: 10.1016/j.intimp.2025.115933. [DOI] [PubMed] [Google Scholar]
  • 40.Li D., Song C., Huang L., Zhao X. Artemisinin Protects Diabetic Cardiomyopathy by Inhibiting Ferroptosis via Upregulating Nrf2/NQO1 and GPX4 Pathways. Mol. Nutr. Food Res. 2026;70:e70296. doi: 10.1002/mnfr.70296. [DOI] [PubMed] [Google Scholar]
  • 41.Wei L., Gao S., Lv Y., Lei X., Zheng H., Zhou Y., Tian S.-H., Liu Y.-L. Lycopene Regulates the JNK/p38MAPK Signalling Pathway and Alleviates Reproductive Oxidative Stress and Apoptosis Induced by Heat Stress in Male Rats. J. Funct. Foods. 2026;140:107258. doi: 10.1016/j.jff.2026.107258. [DOI] [Google Scholar]
  • 42.Al-Zghoul M.B., Shahatit S., Hundam S. Transcriptomic Insights into Thermal Manipulation and Heat Stress in Skeletal Muscles of Broiler Chickens. Poult. Sci. 2026;105:106846. doi: 10.1016/j.psj.2026.106846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Sun H., Zhang L.-H., Wang J.-H., Chen R., Liu Y., Zhang P.-C., Niu C. Lonicerin Regulates AMPK/SIRT1/Autophagy Pathway to Attenuate Heat Stress Intestinal Injury and Inhibit Inflammation. Int. Immunopharmacol. 2025;154:114549. doi: 10.1016/j.intimp.2025.114549. [DOI] [PubMed] [Google Scholar]
  • 44.Joshi N., Joshi N., Börner G.V. An H3K79 Methylation-Dependent Checkpoint Blocks Holliday Junction Resolution and Meiotic Divisions under Heat Stress. bioRxiv. 2025 doi: 10.64898/2025.12.09.692842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Osten V., Nitzpon D.L., Baier A., Moeller A., Schneider D. A Salt Bridge Pre-arranges the Structure of the ABC Transporter BmrA for Proper NBD Dimerization. J. Mol. Biol. 2026;438:169794. doi: 10.1016/j.jmb.2026.169794. [DOI] [PubMed] [Google Scholar]
  • 46.Elbahnsi A., Dragomirescu C.D., Palumbo N., Agachi B.V., Declèves X., Cisternino S., Isvoran A., Miteva M.A. Mapping the Inhibition Landscape of P-Glycoprotein via Conformational Ensemble Docking. Sci. Rep. 2026;16:15393. doi: 10.1038/s41598-026-46760-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Wu D., Nie J., Zhou S., Liu L., Wang L., Yang S., Peng J., Tan C. Iron Homeostasis: Effects of Different Levels of Protein Iron on Placental Iron Handling in Sows. J. Nutr. Biochem. 2026;148:110141. doi: 10.1016/j.jnutbio.2025.110141. [DOI] [PubMed] [Google Scholar]
  • 48.Villanueva S., Zhang W., Zecchinati F., Mottino A., Vore M. ABC Transporters in Extrahepatic Tissues: Pharmacological Regulation in Heart and Intestine. Curr. Med. Chem. 2019;26:1155–1184. doi: 10.2174/0929867325666180327092639. [DOI] [PubMed] [Google Scholar]
  • 49.Liang Z., Tang Z., Wang H., Zhao Z., Deng L., Luo C., Luo F., Yang J., Li J. Transcriptome and Metabolome Combined Analysis of the Molecular Mechanisms Underlying Dendrobine Biosynthesis in Dendrobium nobile. S. Afr. J. Bot. 2026;192:386–398. doi: 10.1016/j.sajb.2026.03.023. [DOI] [Google Scholar]
  • 50.Cheng Q., Jian M., Li W., Zhao C. Protection by Maslinic Acid against Cisplatin-Induced Ototoxicity: Rescue of Ferroptosis by Targeting the SLC7A11–GSH–GPX4 Pathway. Biochem. Biophys. Res. Commun. 2026;809:153480. doi: 10.1016/j.bbrc.2026.153480. [DOI] [PubMed] [Google Scholar]
  • 51.Zhu H., Li H., Shi Y., Liu J., Zhi H., Zhao X., Wang Z., Ping F. Ginsenoside Rb1-Engineered Nanocomposite Hydrogel Promotes Pressure Injury Repair through SIRT1-AMPK-Mediated Ferroptosis Inhibition and Angiogenesis Activation. J. Ginseng Res. 2026;50:100987. doi: 10.1016/j.jgr.2026.100987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sandoval-Acuña C., Torrealba N., Tomkova V., Jadhav S.B., Blazkova K., Merta L., Lettlova S., Adamcová M.K., Rosel D., Brábek J., et al. Targeting Mitochondrial Iron Metabolism Suppresses Tumor Growth and Metastasis by Inducing Mitochondrial Dysfunction and Mitophagy. Cancer Res. 2021;81:2289–2303. doi: 10.1158/0008-5472.CAN-20-1628. [DOI] [PubMed] [Google Scholar]
  • 53.Massaiu I., Campodonico J., Mapelli M., Salvioni E., Valerio V., Moschetta D., Myasoedova V.A., Cappellini M.D., Pompilio G., Poggio P., et al. Dysregulation of Iron Metabolism-Linked Genes at Myocardial Tissue and Cell Levels in Dilated Cardiomyopathy. Int. J. Mol. Sci. 2023;24:2887. doi: 10.3390/ijms24032887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Zhong H., Janer A., Khalimonchuk O., Antonicka H., Shoubridge E.A., Barrientos A. BOLA3 and NFU1 Link Mitoribosome Iron-Sulfur Cluster Assembly to Multiple Mitochondrial Dysfunctions Syndrome. Nucleic Acids Res. 2023;51:11797–11812. doi: 10.1093/nar/gkad842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Lei Y.P., Wang J., Yin P.L., Jia H., Ma W.Z. Melatonin Ameliorates Heat Stress-Induced Oxidative Apoptosis in Mouse Spermatocytes via Autophagy and Ferroptosis Pathways. Cell Stress Chaperones. 2025;30:100078. doi: 10.1016/j.cstres.2025.100078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Zhao Y., Zheng D., Wu J., Ye Y., Meng X., Xu L., Zeng L., Qin X., Yang X. A NIR Fluorescence Probe for Dynamic Profiling of Lipid Droplets in Iron Overload Cardiomyopathy. Sens. Actuators B. 2026;458:139819. doi: 10.1016/j.snb.2026.139819. [DOI] [Google Scholar]
  • 57.Guo Y., Cheng X., Song Y., Li D., Deng H., Qin X., Hao H., Han Y., Xu W., Zhao L., et al. Shunaoxin Dropping Pills Alleviate Cerebral Ischemia-Reperfusion Injury in MCAO Rats Associated with Ferroptosis Inhibition and AKT/Nrf2/HO-1 Pathway Activation. Fitoterapia. 2026;191:107245. doi: 10.1016/j.fitote.2026.107245. [DOI] [PubMed] [Google Scholar]
  • 58.Song B., Zhang K., Sun J., Gong X., Zhao J., Liu W., Wang Q. Tanshinone IIA Alleviates Ferroptosis and Oxidative Injury in Chronic Experimental Colitis through Nrf2 Activation. Biochem. Biophys. Res. Commun. 2026;817:153728. doi: 10.1016/j.bbrc.2026.153728. [DOI] [PubMed] [Google Scholar]
  • 59.Hu L., Li C., Chen M., Zhou Q., Jiang Z. Blockade of CD47 Signaling Improves Ferroptosis of Lung Cancer Cells via Activating Nrf2/FPN Signaling. Cell. Signal. 2026;139:112331. doi: 10.1016/j.cellsig.2025.112331. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Articles from Animals : an Open Access Journal from MDPI are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES