A Maximum 34% Substitution of Fish Meal by Soybean Meal Is Recommended for Rhynchocypris lagowskii Dybowski Cultured in Biofloc Systems: Evidence From Growth and Intestinal Barrier Function

Zhi-Yong Yang; Deng-Lai Li; Ke-xin Wang; Li-Fang Wu; Rui Zhu; Qiong Wu

doi:10.1155/anu/5561983

. 2026 Jul 28;2026:5561983. doi: 10.1155/anu/5561983

A Maximum 34% Substitution of Fish Meal by Soybean Meal Is Recommended for Rhynchocypris lagowskii Dybowski Cultured in Biofloc Systems: Evidence From Growth and Intestinal Barrier Function

Zhi-Yong Yang ^1,², Deng-Lai Li ³, Ke-xin Wang ³, Li-Fang Wu ^1,^✉, Rui Zhu ^4,^✉, Qiong Wu ^3,^✉

Editor: Ioannis T Karapanagiotidis

PMCID: PMC13409043 PMID: 42524090

Abstract

In this study, glucose was used as the carbon source for the bioflocs in each group, with a carbon‐to‐nitrogen ratio (C/N) of 20 : 1. Juvenile Rhynchocypris lagowskii Dybowski (6.89 ± 0.02 g) were used as the experimental animals. Soybean meal (SBM) protein replaced 0.0% (CK), 17.0% (B17), 34.0% (B34), 51.0% (B51), and 68.0% (B68) of fish meal protein to formulate five isonitrogenous and isolipidic experimental diets for an 8‐week feeding trial. Under biofloc technology (BFT) conditions, the B68 group exhibited significantly lower growth performance (final weight [FW], weight gain rate [WGR], specific growth rate [SGR], feed efficiency ratio [FER], protein efficiency ratio [PER]) and muscle crude protein content compared to the CK group (p < 0.05). The B51 group showed significantly reduced activities of hepatopancreatic and intestinal protease (PRS), as well as of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH‐PX), and total antioxidant capacity (T‐AOC) in the distal intestine (DI). Meanwhile, the malondialdehyde (MDA) content in the DI was significantly increased in both the B51 and B68 groups (p < 0.05). The B68 group showed significantly increased serum GPT, GOT, and immunoglobulin M (IgM) levels, and significantly decreased hepatopancreatic GPT and GOT activities as well as serum complement 3 (C3), complement 4 (C4), and LSZ levels (p < 0.05). In the B68 group, the expression levels of multiple genes were significantly downregulated (p < 0.05): IGF‐1 in the mid intestine (MI) and DI, S6K in the hepatopancreas and DI, and ZO‐1, mTOR, IL‐10, TGF‐β, Nrf2, Maf, HO‐1, CAT, GSH‐PX, and occludin‐a in the DI. In contrast, significant up‐regulation was observed for TNF‐α (in MI and DI), as well as for 4E‐BP, NF‐κB, IL‐1β, IL‐8, and Keap1 (p < 0.05). In the BFT, SBM substitution (replacing ≥51% of fish meal protein) disrupted intestinal morphological integrity. This led to reduced muscularis thickness and fold height, increased lamina propria width, villus breakage, altered gut permeability, and elevated serum endothelin‐1 (ET‐1), D‐lactic acid (D‐LA), 5‐hydroxytryptamine (5‐HT), and diamine oxidase (DAO) levels. These changes are accompanied by changes in the structure of dominant intestinal microflora. Concluded, the proportion of SBM replacing fish meal should be lower than 34% under BFT system.

Keywords: antioxidant capacity, biofloc, growth performance, immune function, Rhynchocypris lagowskii Dybowski

1. Introduction

Owing to its abundance of amino acids, vitamins, and micronutrients, fish meal is a critical high‐quality protein source in formulated fish feeds [1]. However, as intensive aquaculture expands, fish meal resources have become scarce. Consequently, identifying viable alternatives to fish meal protein has become a major focus of aquaculture research. Soybean meal (SBM) is nutrient‐rich, reasonably priced, and widely available. As one of the best plant‐based protein sources, SBM is used in compound fish feeds [2, 3]. However, SBM contains protease (PRS) inhibitors, soybean antigen protein, soybean lectin, and other antinutritional factors (ANFs) [4]. These substances affect fish health by destroying intestinal epithelium, activating inflammatory responses, and interfering with nutrient digestion and absorption [5–7]. Studies involving various species, including rainbow trout (Oncorhynchus mykiss) [8], orange‐spotted grouper (Epinephelus coioides) [9], Chinese sucker (Myxocyprinus asiaticus) [10], Japanese seabass (Lateolabrax japonicus) [11], and Asian seabass (Lates calcarifer) [12], confirm that excessive substitution of fish meal with SBM adversely affects key physiological processes in aquatic animals, including growth, digestion, metabolism, immunity, and antioxidant defense [13, 14].

At present, reducing the damage to aquatic animals caused by substituting fish meal with SBM and improving the feasibility of such substitution have become new research hotspots. Studies on various species, including rice field eel (Monopterus albus) [15], turbot (Scophthalmus maximus L.) [16], white seabream (Diplodus sargus) [17], largemouth bass (Micropterus salmoides) [18], and totoaba (Totoaba macdonaldi) [19], have shown that dietary supplementation with sodium butyrate, glutamine, carbohydrases, taurine, and prebiotic agavin can alleviate the detrimental effects on aquatic animals caused by soybean products. Biofloc technology (BFT) is a novel, high‐efficiency ecological aquaculture system [20]. By adding organic carbon sources to adjust the carbon‐to‐nitrogen ratio (C/N) of water, heterotrophic bacteria proliferate and assimilate inorganic nitrogen. Harmful nitrogenous compounds derived from uneaten feed, feces, and metabolites are thus converted into bacterial proteins that can be utilized by cultured animals [21, 22]. In addition, bioflocs can improve water quality, increase feed utilization efficiency, and enhance the immune function in aquatic organisms. Studies in Ictalurus puntatus [23], Cyprinus carpio [24], Clarias gariepinus [25], Nile tilapia [26], and Rhamdia Quelen [27] have found that bioflocs can enhance growth performance and digestive efficiency, strengthen immune responses, and boost antioxidant capacity in aquatic species. Based on this evidence, we hypothesize that BFT can mitigate the negative impacts associated with high‐level replacement of fish meal with SBM in cultured aquatic species. This is related to the active substances produced during the formation of bioflocs. Polyβ‐hydroxybutyrate (PHB), as one of the main active ingredients (content 5%–20%), can be degraded into β‐hydroxybutyric acid in the intestine and is absorbed and transported to various organs to play its role. Research shows that PHB can promote growth, enhance immunity and antioxidant capacity, and optimize the intestinal flora. Another report pointed out that in the biofloc culture mode, the negative impact of expanded SBM on the intestinal tract of fish has been reduced, which may be related to PHB [28]. Therefore, we speculate that BFT can alleviate the negative impact of high levels of SBM replacing fish meal on farmed aquatic species.

Rhynchocypris lagowskii Dybowski is a small omnivorous fish of commercial value in China, known for its delicate flesh, strong disease resistance, and notable tolerance to hypoxic conditions, making it a promising species for aquaculture [29]. Existing studies on this species have addressed its dietary protein requirements [29], tolerance to ANFs (including glycinin threshold [29] and taurine mitigation [30]), and alternative protein sources (SBM and fermented SBM). Therefore, this study aimed to elucidate the effects of replacing fish meal with SBM on the growth, immune function, and gut microbial community of Rhynchocypris lagowskii Dybowski under BFT conditions.

2. Materials and Methods

2.1. Experimental Diets

For BFT, glucose was selected as the carbon source, and the C/N ratio in each group was controlled at 20:1 [29]. The proportions of fish meal protein replaced by SBM were 0.0%, 17.0%, 34.0%, 51.0%, and 68.0%, respectively. These ingredients were used to formulate five isonitrogenous and isolipidic experimental diets, designated as CK, B17, B34, B51, and B68. All feed ingredients were ground, sieved through a 60‐mesh screen, and precisely weighed according to the formulated diet composition (Table 1). After thorough mixing, the mixture was pelleted into 2.0 mm diameter granules, air‐dried, and stored for subsequent use.

Table 1.

Formulation and nutritional composition of experimental diets (air‐dry basis) (%).

Ingredients	Groups
Ingredients	CK	B17	B34	B51	B68
Fish meal^a	45.00	37.35	29.70	22.05	14.40
Soybean meal^b	0.00	11.85	23.72	35.58	47.43
Wheatmeal	20.00	20.00	20.00	20.00	20.00
Corn gluten meal	4.00	4.00	4.00	4.00	4.00
Dextrin	22.42	18.25	14.08	9.91	5.75
Cellulose microcrystalline	3.34	2.68	2.01	1.34	0.67
Premix^c	0.5	0.5	0.5	0.5	0.5
Corn oil	1.78	2.00	2.22	2.44	2.66
Fish oil	1.78	2.00	2.22	2.44	2.66
Choline chloride	0.50	0.50	0.50	0.50	0.50
Lysine	0.24	0.36	0.47	0.59	0.71
L‐methionine	0.44	0.51	0.58	0.65	0.72
Nutritional level^d	—
Crude protein	36.09	36.17	36.14	36.20	36.23
Crude lipid	8.13	8.10	8.07	8.03	8.10
Ash	5.93	5.66	5.39	5.12	4.85

Open in a new tab

^aFish meal: 68.00% crude protein and 8.60% crude lipid, from Jingliang (Tianjin) Grain and Oil Industry Co., Ltd., China.

^bSoybean meal, purchased from Yihai (Taizhou) grain and oil industry co., Ltd., Taizhou, Jiangsu, China. The crude protein content is 44.21% and the crude fat content is 1.70%.

^cMineral and vitamin premix (per 100 g premix): vitamin A, 84–104 KIU; vitamin D, 56–59 KUI; vitamin E, ≥2400 mg; vitamin K, ≥162 mg; nicotinamide, ≥458 mg; pantothenic acid, ≥702 mg; folic acid, ≥106 mg; biotin, ≥4 mg; inositol, ≥3020 mg; copper, 96–110 mg; iron, 4060–5500 mg; manganese, 552–633 mg; cobalt, 6–8 mg; iodine, 13–20 mg; zinc, 2320–2660 mg; selenium, 8–12 mg.

^dMeasured value.

2.2. Experimental Conditions

Rhynchocypris lagowskii Dybowski used in this experiment was purchased from Quanyuan fry farm, Jiutai District, Jilin Province, China. In order to ensure that fish adapt to the experimental feed and laboratory breeding environment more quickly, fish were pre‐fed for 15 days before the start of the feeding experiment. We initiated an 8‐week feeding experiment using 450 healthy juvenile fish (6.89 ± 0.02 g) of uniform size. The fish were distributed among five treatment groups, each comprising three replicates stocked with 30 fish per replicate. During the whole experiment, the daily feeding rate was 2.0%–3.0% of the initial body weight, and it was fed three times a day. Depending on the method published by Yu et al. [29], glucose was selected as the carbon source, and the C/N ratio of each group was controlled to be 20:1. Continuous oxygenation was provided for 24 h and regular replenishment of water lost by evaporation. Glucose powder was added to the fish tank at 18:00 every day and form BFT. All the handling methods in this research are accords with the standards of the Ethics Committee of Jilin Agricultural University.

2.3. Fish Sampling

After 56 days of experimental feeding period, all fish were fasted for 24 h and maintained oxygen and carbon source addition (to maintain biological floc activity and water quality stability) to supplement evaporation water and keep water level constant. Initial data collection included counting and weighing all fish per tank to facilitate subsequent growth performance evaluation. The muscles above the lateral line and below the dorsal fin were taken and placed in a refrigerator at −80°C for the determination of muscle nutrients. Blood was drawn from the caudal vein into syringes and aliquoted into 2.0 mL tubes. Following 24 h refrigeration at 4°C, serum was isolated by centrifugation (1400 × g, 10 min) for the determination of intestinal permeability and immune markers. Three intestinal segments (proximal intestines [PIs], mid intestines [MIs], distal intestines [DIs]) were collected from 15 sacrificed fish and stored at −80°C for biochemical and molecular analyses. For microbiome studies, intestines from five euthanized fish were processed by removing adhering tissues, rinsing with deionized water, and snap‐freezing in liquid nitrogen before storage at −80°C. For intestinal micromorphological analysis, segments of the PI, MI, and DI were collected from five fish and fixed in 4% formalin solution.

2.4. Sample Analysis

2.4.1. Calculations Analysis

The determination of calculation of growth index is based on the method previously described [29].

2.4.2. Determination of Muscle Nutrient Composition

The determination of muscle nutrient content is based on the method previously described [29].

2.4.3. Determination of Levels of Enzymes

A suite of commercial assay kits was employed to quantify multiple biochemical parameters. These included serum biomarkers (diamine oxidase [DAO], PRS, endothelin‐1 [ET‐1], D‐lactic acid [D‐LA], 5‐hydroxytryptamine [5‐HT], lysozyme [LZM], complement 3 [C3], complement 4 [C4], and immunoglobulin M [IgM]), hepatopancreatic and intestinal oxidative stress markers (malondialdehyde [MDA], catalase [CAT], glutathione peroxidase [GSH‐PX], superoxide dismutase [SOD], and total antioxidant capacity [T‐AOC]), as well as digestive and metabolic enzymes (amylase [AMS] and lipase [LPS] in hepatopancreas and intestines; alanine aminotransferase [GPT] and aspartate aminotransferase [GOT] in hepatopancreas and serum). The protein concentration was determined using a protein quantification kit produced by Abbkine (Wuhan) Biotechnology Co., Ltd. For detailed information, please refer to the Supporting Information.

2.4.4. Determination of mRNA Expressions

For the methods, refer to the published articles [31]. Following extraction from hepatopancreatic tissues, total RNA was quantified and assessed for purity. The OD₂₆₀/OD₂₈₀ ratio served as the quality criterion, with values of 1.8–2.0 indicating satisfactory RNA integrity. Following the reverse transcription of RNA into cDNA with a dedicated kit (Takara), gene expression levels were quantified by real‐time PCR employing a fluorescent detection system (Takara). The primer sequences were synthesized by Sangon. The relative expression levels of genes were analyzed by the 2^−ΔΔCT method [32] (Table 2).

Table 2.

Primer sequences of target gene for the real‐time fluorescent quantitative PCR.

Genes	Sequences (5′–3′)		GenBank number
β-actin	Forward	CGGTATCCATGAGACCACCT	AAB97964.1
β-actin	Reverse	CTTCTGCATCCTGTCAGCAA	AAB97964.1
IGF-1	Forward	GGAGAAGGAGCGATTGAAGA	AY533140.1
IGF-1	Reverse	AGGCTTTCCCTTCTCGTCTC	AY533140.1
mTOR	Forward	TGCGAATAAGCAGTATGGAGGG	AB290031.1
mTOR	Reverse	AAAACTGGTGAAGGGCGTGA	AB290031.1
S6K	Forward	GGGCTATGATGAGGG	MK756115.1
S6K	Reverse	CTTCTGGTCCGTTGG	MK756115.1
4E-BP	Forward	AACACTCTTCTCCACCAC	KM199776.1
4E-BP	Reverse	CTCCTCCAACTCCTCTTT	KM199776.1
NF-κB	Forward	GAAGAAGGATGTGGGAGATG	KJ526214
NF-κB	Reverse	TGTTGTCGTAGATGGGCTGAG	KJ526214
IL-1β	Forward	CTGGAGCAATGCAATACAAA	AJ245635
IL-1β	Reverse	AGGTAGAGGTTGCTGTTGGAA	AJ245635
TGF-β	Forward	TTGGGACTTGTGCTCTAT	EU099588
TGF-β	Reverse	AGTTCTGCTGGGATGTTT	EU099588
IL-10	Forward	AATCCCTTTGATTTTGCC	AB110780.1
IL-10	Reverse	GTGCCATATCCTACAGTATGTT	AB110780.1
TNF-α	Forward	CCAGGCTTTCACTTCAGG	FN543477.1
TNF-α	Reverse	GCCATAGGAATCGGAGTAG	FN543477.1
IL-8	Forward	ATGAGTCTTAGAGGTCTGGGTG	DQ453125
IL-8	Reverse	ACAGTGAGGGCTAGGAGGG	DQ453125
Nrf2	Forward	GGAGAAGGAGCGATTGAAGA	MF150102.1
Nrf2	Reverse	AGGCTTTCCCTTCTCGTCTC	MF150102.1
Keap1	Forward	TTCCACGCCCTCCTCAA	XM_019274258.1
Keap1	Reverse	TGTACCCTCCCGCTATG	XM_019274258.1
HO-1	Forward	TGTCAGGAGGACAAGTGCTG	JX257180.1
HO-1	Reverse	CAGCTGCTTGAATCTGTTGG	JX257180.1
CAT	Forward	ACTACCAGTCAACTGCCCGTC	NM_130912.1
CAT	Reverse	TTTAGCACCTGAGTGAAGAACG	NM_130912.1
GSH-PX	Forward	ACAGAGGGTGGGCGTTAT	AW232474
GSH-PX	Reverse	TTCGGGCACCAGAGGA	AW232474
Maf	Forward	TGGAGCAGCAGAAGGAG	NM_131844.2
Maf	Reverse	GTGTTCAGACGGGGTGTTGT	NM_131844.2
ZO-1	Forward	GAAGACAAGCCATACAGA	XM_009303250.3
ZO-1	Reverse	GTGGGTCAAAGTTACGAG	XM_009303250.3
Occludin-a	Forward	TCCAGCATTTCTACCG	NM_212832.2
Occludin-a	Reverse	ACAGACAAAGATTCCCAC	NM_212832.2

Open in a new tab

Note: 4E-BP, eIF 4E binding protein; S6K, ribosomal protein S6 kinase, polypeptide.

Abbreviations: CAT, catalase; GSH-PX, glutathione peroxidase; HO-1, heme oxygenase‐1; IGF-1, insulin‐like growth factor‐1; IL-1β, interleukin‐1β; IL-8, interleukin‐8; IL-10, interleukin‐10; Keap1, kelch‐like ECH‐associated protein 1; Maf, musculoaponeurotic fibrosarcoma oncogene; mTOR, mammalian target of rapamycin; NF-κB, nuclear factor kappa B; Nrf2, nuclear factor E2‐related factor; TGF-β, transforming growth factor β; TNF-α, tumor necrosis factor‐α; ZO-1, zonula occludens‐1.

2.5. Statistical Analysis

Statistical analyses were performed with SPSS 20.0 using one‐way ANOVA. Significant differences identified by ANOVA were further analyzed with Duncan’s multiple comparison test. Data are expressed as mean ± SE, and differences at p < 0.05 were considered statistically significant.

3. Results

3.1. Growth and Muscle Nutrient Composition

Under BFT system, compared with the CK group, the B68 group final weight (FW), weight gain rate (WGR), specific growth rate (SGR), feed efficiency ratio (FER), and protein efficiency ratio (PER) were decreased significantly (p < 0.05), whereas hepatosomatic index (HSI) and viscerasomatic index (VSI) in other groups show no significant difference (p > 0.05) (Table 3).

Table 3.

Effects of soybean meal replacing fish meal on growth and feed utilization of Rhynchocypris lagowskii Dybowski under BFT system.

Indexes	Groups
Indexes	CK	B17	B34	B51	B68
IW (g)	6.87 ± 0.01^a	6.89 ± 0.15^a	6.88 ± 0.22^a	6.93 ± 0.26^a	6.88 ± 0.24^a
FW (g)	15.96 ± 0.58^a	15.84 ± 0.57^a	15.70 ± 0.64^a	15.57 ± 0.48^a	14.07 ± 0.26^b
WGR (%)	132.37 ± 7.96^a	130.04 ± 7.47^a	128.38 ± 9.86^a	124.60 ± 8.25^a	104.41 ± 3.81^b
SGR (%/d)	1.51 ± 0.07^a	1.49 ± 0.06^a	1.47 ± 0.08^a	1.44 ± 0.07^a	1.28 ± 0.04^b
FER (%)	70.48 ± 4.63^a	69.13 ± 4.78^a	66.17 ± 4.98^a	63.66 ± 2.54^a	54.52 ± 4.23^b
PER (%)	195.78 ± 12.87^a	192.04 ± 13.30^a	183.81 ± 13.83^a	176.83 ± 7.06^a	151.43 ± 11.74^b
CF (g/cm³)	2.03 ± 0.52^a	2.40 ± 0.23^a	2.24 ± 0.16^a	2.31 ± 0.10^a	2.15 ± 0.14^a
VSI (%)	11.63 ± 1.27^a	11.36 ± 0.46^a	10.66 ± 0.61^a	10.62 ± 1.66^a	10.91 ± 1.21^a
HSI (%)	2.35 ± 0.15^a	2.15 ± 0.13^a	2.23 ± 0.33^a	2.29 ± 0.16^a	2.14 ± 0.12^a
SR (%)	92.22 ± 3.85^a	93.34 ± 6.67^a	97.78 ± 1.92^a	94.44 ± 5.09^a	94.67 ± 4.33^a

Open in a new tab

Note: Different superscript lowercase letters on the shoulder of the same data indicate significant differences (p < 0.05).

Abbreviations: CF, condition factor; FER, feed efficiency ratio; FW, final weight; HSI, hepatosomatic index; IW, initial weight; PER, protein efficiency ratio; SGR, specific growth rate; SR, survival rate; VSI, viscerasomatic index; WGR, weight gain rate.

3.2. Muscle Nutrients

Muscle crude protein content was significantly lower in the B68 group than in the CK group (p < 0.05), whereas no significant differences were observed in muscle moisture, crude lipid, or ash content among groups (p > 0.05) (Table 4).

Table 4.

Effects of soybean meal replacing fish meal on muscle nutrients of Rhynchocypris lagowskii Dybowski under BFT system.

Groups	Indexes (%)
Groups	Moisture	Crude lipid	Ash	Crude protein
CK	77.17 ± 0.71^a	1.28 ± 0.28^a	1.48 ± 0.06^a	18.05 ± 0.31^a
B17	77.42 ± 0.45^a	1.39 ± 0.15^a	1.40 ± 0.08^a	17.80 ± 0.07^ab
B34	77.20 ± 0.47^a	1.38 ± 0.26^a	1.45 ± 0.21^a	17.82 ± 0.41^ab
B51	76.99 ± 0.50^a	1.37 ± 0.19^a	1.30 ± 0.08^a	17.48 ± 1.22^ab
B68	77.30 ± 0.80^a	1.41 ± 0.09^a	1.42 ± 0.18^a	16.70 ± 0.71^b

Open in a new tab

Note: Different superscript lowercase letters on the shoulder of the same data indicate significant differences (p < 0.05).

3.3. Digestive Enzyme Activities

Relative to the CK group, the B68 group exhibited significantly reduced PRS activities in the hepatopancreas and all intestinal segments (PI, MI, and DI) (p < 0.05). In contrast, the substitution of fish meal with SBM did not significantly alter the activities of AMS and LPS in these tissues (p > 0.05) (Figure 1).

Effects of soybean meal substitution for fishmeal on the intestinal digestive enzymes activities in *Rynchocypris lagowskii* Dybowski under BFT system. (a): PRS, protease; (b): AMS, amylase; (c): LPS, lipase;. Different lowercase letters above the bars show significant differences (p < 0.05).

3.4. Protein Metabolism

Significant metabolic alterations were observed in treatment groups. The B68 group showed increased serum GPT/GOT with decreased hepatopancreatic activities (p < 0.05), plus comprehensive downregulation of mTOR, IGF-1, and S6K transcripts and 4E-BP upregulation across all tissues. The B51 group exhibited targeted gene expression changes: reduced mTOR (DI), IGF-1 (MI and DI), and S6K (hepatopancreas and DI) with elevated 4E-BP (DI) (p < 0.05) (Figures 2 and 3).

Effects of replacing fishmeal with soybean meal on the protein metabolism activities of the *Rhynchocypris lagowskii* Dybowski under BFT system. GOT, aspartate aminotransferase; GPT, alanine aminotransferase. Different lowercase letters above the bars show significant differences (p < 0.05).

Effects of soybean meal substitution for fishmeal on the mRNA expression levels related to protein metabolism in *Rlynchocypris lagowskii* Dybowski under BFT system. (a): mTOR, mechanistic target of rapamycin; (b): IGF‐1, insulin‐like growth factor 1; (c): S6K, ribosomal protein S6 kinase; (d): 4E‐BP, eIF4E‐binding protein. Different lowercase letters above the barsshow significant differences (p < 0.05).

3.5. Immune Function and Inflammation

Significant decreases in serum C3, C4, and LSZ activity, along with an increase in IgM, were observed in the B68 group compared to the control group (p < 0.05). Relative to the control, mRNA levels of NF-κB, IL-1β, and IL-8 were significantly upregulated in the hepatopancreas, PI, MI, and DI of the B68 group and in the DI of the B51 group (p < 0.05). In contrast, TGF-β mRNA was downregulated in these same tissues (p < 0.05). Additionally, TNF-α mRNA was significantly increased in the hepatopancreas, PI, MI, and DI of the B68 group, as well as in the MI and DI of the B51 group (p < 0.05) (Figures 4 and 5).

Effects of soybean meal substitution for fishmeal on the immune function in *Rhynchocypris lagowskii* Dybowski under BFT system. C3, complement 3; C4, complement 4; IL‐1β: interleukin‐1 beta; IL‐8: interleukin‐8; IL‐10: interleukin‐10; NF‐κB, nuclear factor kappa‐light‐chain‐enhancer of activated B cells; TGF‐β: transforming growth factor beta; TNF‐α, tumor necrosis factor alpha. Different lowercase letters above the bars show significant differences (p < 0.05).

Effects of soybean meal substitution for fishmeal on the expression levels of immune‐related mRNA in *Rhynchocypris lagowskii* Dybowski under BFT system. (a): NF‐kB, nuclear factor kappa‐light‐chain‐enhancer of activated B cells; (b): TNF‐a, tumor necrosis factor alpha; (c): IL‐1β: interleukin‐1 beta; (d): IL‐8: interleukin‐8; (e): IL‐10: interleukin‐10; (f): TGF‐β: transforming growth factor beta. Different lowercase letters above the bars show significantdifferences (p < 0.05).

3.6. Antioxidant Capacity

Relative to the control, significant reductions in the activities of SOD, CAT, T‐AOC, and GSH‐PX were observed in the hepatopancreas, PI, MI, and DI of the B68 group and in the DI of the B51 group, concurrently with an increase in MDA content in these same tissues (p < 0.05). At the transcriptional level, mRNA levels of Nrf2, Maf, CAT, HO-1, and GSH-PX were downregulated in the hepatopancreas, PI, MI, and DI of the B68 group and in the DI of the B51 group (p < 0.05). In contrast, Keap1 mRNA was significantly upregulated in the hepatopancreas, PI, MI, and DI of the B68 group (p < 0.05) (Figures 6 and 7).

Effects of soybean meal substitution for fishmeal on the antioxidant indexes in *Rlynchocypris lagowskii* Dybowski under BFT system. (a): T‐SOD, totalsuperoxide dismutase; (b): T‐AOC, total antioxidant capacity; (c): CAT, catalase; (d): MDA, malondialdehyde; (e): GSH‐Px, glutathioneperoxidase. Different lowercase letters above the bars show significant differences (p < 0.05).

Effects of soybean meal substitution for fishmeal on the the expression levels of antioxidant‐related mRNA in *Rhynchocypris lagowskii* Dybowski under BFT system. (a): Keapl, kelch‐like ECH‐associated protein1; (b): Nrf2, nuclear factor erythroid 2‐related factor 2; (c): Maf, musculoaponeurotic fibrosarcomaoncogene homolog; (d): HO‐1, heme oxygenase‐1; (e): CAT, catalase; (f):GSH‐Px, glutathioneperoxidase. Different lowercase letters above the bars show significant differences (p < 0.05).

3.7. Intestinal Physical Barrier

Under the biofloc culture regime, the intestinal morphology was significantly altered by high levels of SBM substitution, and histopathological examination revealed that the B51 group displayed villus atrophy and breakage in the midgut, whereas the hindgut showed additional villus atrophy and lamina propria separation (Figure 8).

Effects of soybean meal substitution for fishmeal on the intestinal morphology in *Rlynchocypris lagowskii* Dybowski under BFT system (200x). PI: proximal intestine; MI: middle intestine; DI: distal intestine. No additional explanation is needed for the other annotations in this figure.

Groups B68 (all intestinal segments) and B51 (DI only) displayed significantly reduced intestinal fold height and muscle layer thickness, mirrored by a significant widening of the lamina propria in these same segments (p < 0.05). Intestinal mass, length, and related indices remained unchanged across all groups (Table 5).

Table 5.

Effects of soybean meal replacing fish meal on the intestinal morphological indicators of Rhynchocypris lagowskii Dybowski under BFT system

Indexes	Groups
Indexes	CK	B17	B34	B51	B68
Intestinal weight (g)	0.29 ± 0.10^a	0.27 ± 0.06^a	0.28 ± 0.10^a	0.28 ± 0.03^a	0.27 ± 0.07^a
Intestinal length (cm)	6.79 ± 0.11^a	6.73 ± 0.29^a	6.65 ± 0.23^a	6.51 ± 0.17^a	6.44 ± 0.11^a
Intestinal somatic index (%)	4.98 ± 0.43^a	5.08 ± 0.52^a	5.24 ± 0.74^a	5.39 ± 0.48^a	5.41 ± 0.22^a
Intestinal length index (%)	0.92 ± 0.10^a	0.95 ± 0.10^a	0.95 ± 0.09^a	0.95 ± 0.07^a	0.98 ± 0.16^a
PI folds heights (µm)	672.10 ± 51.83^a	625.79 ± 22.70^a	581.87 ± 48.45^ab	581.68 ± 55.09^ab	521.57 ± 74.00^b
MI folds heights (µm)	472.74 ± 73.43^a	419.39 ± 6.72^a	387.29 ± 62.71^ab	371.21 ± 62.59^ab	290.29 ± 51.85^b
DI folds heights (µm)	352.23 ± 48.36^a	314.24 ± 57.26^ab	288.70 ± 27.13^ab	247.93 ± 41.00^bc	187.45 ± 31.09^c
PI muscular layer thickness (µm)	20.09 ± 2.05^a	18.21 ± 2.21^a	16.98 ± 2.06^a	15.93 ± 3.90^a	10.68 ± 3.31^b
MI muscular layer thickness (µm)	17.53 ± 3.32^a	16.31 ± 3.56^a	14.65 ± 3.52^ab	12.43 ± 4.06^ab	8.11 ± 3.64^b
DI muscular layer thickness (µm)	15.27 ± 3.30^a	13.95 ± 3.29^ab	13.43 ± 2.50^ab	8.29 ± 3.79^b	7.75 ± 3.59^b
PI lamina propria width (µm)	14.66 ± 3.50^a	15.07 ± 3.02^a	16.79 ± 3.74^ab	17.07 ± 3.05^ab	22.95 ± 3.68^b
MI lamina propria width (µm)	12.25 ± 3.28^a	13.62 ± 3.50^a	14.40 ± 3.39^a	15.84 ± 3.54^ab	20.95 ± 3.08^b
DI lamina propria width (µm)	9.51 ± 1.27^a	11.80 ± 3.51^a	12.28 ± 3.90^a	19.44 ± 3.87^b	19.64 ± 3.69^b

Open in a new tab

Note: Different superscript lowercase letters indicate significant differences (p < 0.05).

Disruption of intestinal morphological structure may be accompanied by alterations in intestinal permeability and tight junction (TJ) mRNA expression. Through the detection of relevant indicators, it was found that the ET‐1, D‐LA, and 5‐HT contents and DAO activities in serum of B68 group and B51 group were significantly increased (p < 0.05) (Table 6).

Table 6.

Effects of soybean meal replacing fish meal on intestinal permeability of Rhynchocypris lagowskii Dybowski under BFT system.

Groups	ET‐1 (pg/mL)	D‐LA (μmol/L)	5‐HT (ng/mL)	DAO (U/mL)
CK	17.55 ± 1.74^a	11.63 ± 1.43^a	22.48 ± 2.06^a	28.67 ± 1.49^a
B17	18.86 ± 1.51^a	12.20 ± 1.51^a	23.02 ± 1.63^a	30.24 ± 1.99^a
B34	19.62 ± 0.98^a	13.57 ± 2.30^a	24.38 ± 1.86^a	31.61 ± 1.74^a
B51	20.13 ± 2.18^a	14.25 ± 1.85^a	25.13 ± 1.20^ab	37.82 ± 2.11^b
B68	24.21 ± 1.53^b	19.12 ± 2.31^b	27.89 ± 0.25^b	38.83 ± 2.51^b

Open in a new tab

Note: Different superscript lowercase letters indicate significant differences (p < 0.05).

The levels of ZO-1 and occludin-a mRNA in intestinal canal of B68 group and DI in B51 group were significantly decreased (p < 0.05) (Figure 9).

Effects of soybean meal substitution for fishmeal on the intestinal tight junction‐associated mRNA expression levels in *Rlynchocypris lagowskii* Dybowski under BF’Isystem. (a): ZO‐1; (b): Occludin‐a. Different lowercase letters above the bars show significant differences (p < 0.05).

3.8. Intestinal Microbiota

According to statistics, a total of 1,199,905 sequenced reads were obtained from 15 samples. After clustering OTUs with 97% consistency, a total of 979 OUTs were obtained. The sparse curve shows that the sampling depth of this test meets the requirements, and the sequencing results can truly reflect the dominant flora in the sample (Figure 10a). The β‐diversity analysis showed that the distance between the replacement group and the control group was relatively close but clearly separated, indicating that there was a significant difference in the composition of the intestinal microbiota between the replacement group and the control group. The replacement groups clustered adjacently in a gradient‐like pattern, indicating that the effect of SBM substitution for fishmeal on the intestinal microbiota of Rhynchocypris lagowskii Dybowski larvae changed gradually with the substitution ratio (Figure 10b–d).

Effects of soybean meal substitution for fishmeal on the analysis of α diversity in intestinal flora in *Rhynchocypris lagowskii* Dybowski under BFT system. (a) Venn map of OUT by high‐throughput sequencing, (b) dilution curve of intestinal flora (c) NMDS analysis of intestinal flora, and (d) PCoA analysis of intestinal flora.

The α‐diversity analysis showed that Simpson in B51 group were significantly decreased (p < 0.05), Shannon in B68 group were significantly increased (p < 0.05), however, the replacement of fish meal by SBM had no significant effect on ACE and Chao1 (p > 0.05) (Table 7).

Table 7.

The α‐diversity of intestinal microflora in Rhynchocypris lagowskii Dybowski.

Groups	Indexes
Groups	OTUs	ACE indexes	Chao1 indexes	Simpson indexes	Shannon indexes
CK	372.00 ± 48.78^ab	501.74 ± 131.16^a	484.33 ± 105.45^ab	0.87 ± 0.12^ab	4.83 ± 0.63^ab
B17	442.00 ± 38.97^bc	677.99 ± 159.06^a	577.33 ± 50.74^b	0.84 ± 0.16^abc	4.93 ± 1.09^ab
B34	375.33 ± 8.39^ab	548.69 ± 133.47^a	489.12 ± 30.62^ab	0.73 ± 0.07^bc	3.70 ± 0.27^a
B51	322.00 ± 29.46^a	482.59 ± 82.56^a	430.42 ± 31.26^a	0.65 ± 0.11^c	2.88 ± 0.93^a
B68	463.67 ± 68.13^c	693.47 ± 91.93^a	597.67 ± 60.29^b	0.96 ± 0.05^a	6.55 ± 1.84^b

Open in a new tab

Note: Different superscript lowercase letters indicate significant differences (p < 0.05).

At the phylum level, the dominant phylum was Proteobacteria, Firmicutes, Bacteroidetes, Actinobacteria, and Cyanobacteria. Proteobacteria dominated in the intestinal flora of fish. The abundance of Proteobacteria in B68 group was significantly lower than control group (p < 0.05). At the genus level, the top five species with relative abundance were Roseobacter clade CHAB‐1–5 lineage, uncultured‐bacterium f Rhodobacteraceae, Aeromonas, Lactococcus, and uncultured bacterium f Enterobacteriaceae. Gemmobacter and uncultured bacterium f Rhizobiales Incertae Sedis were dominant in the intestinal flora of fish. The abundance of Gemmobacter and uncultured bacterium f Rhizobiales Incertae Sedis of B68 group were significantly lower than control group (p < 0.05) (Figure 11).

Effects of soybean meal replacing fish meal on composition and abundance of intestinal flora of *Rhynchocypris lagowskii* Dybowski under BFT system. (a, b) Phylum level. (c, d) Genus level.

4. Discussion

Fish growth, achieved through feed ingestion and metabolic conversion into somatic tissue [28, 33], is impaired in BFT systems when SBM replaces more than 51% of fish meal. This impairment results from the high replacement level combined with SBM‐related challenges, including ANFs and an imbalanced amino acid profile, which ultimately compromise growth performance [34]. Evidence from diverse species—Japanese seabass (Lateolabrax japonicus) [11], cobia (Rachycentron canadum) [4], amberjack (Seriola dumerili) [35], spotted rose snapper (Lutjanus guttatus) [36], and tilapia (Oreochromis niloticus) [37]—confirms that elevated SBM inclusion consistently suppresses the growth of aquatic animals. Compared with conventional systems, BFT markedly increases the suitable SBM substitution level for fish meal in feed for Rhynchocypris lagowskii [29]. This enhancement presumably results from biofloc ingestion under optimized carbon‐nitrogen ratios in BFT, which robustly stimulates growth and maximizes production outcomes [24, 38, 39]. Concurrently, fish body composition provides critical insights into the nutritional status and physiological health [40]. In the BFT system, the significant decrease in muscle crude protein content observed in the B68 group compared to the CK group suggests that high‐level SBM substitution inhibits protein deposition in fish. This effect may stem from an amino acid imbalance and structural alterations in the digestive tract induced by SBM, ultimately impairing protein synthesis [41]. Consistent with this, studies on Japanese seabass [11], amberjack [35], tin foil barb [42], and rainbow trout [8] have reported reduced muscle crude protein following high SBM inclusion in compound feed. Notably, in the present BFT system, bioflocs—rich in nutrients and probiotics—could partially compensate for nutritional requirements and mitigate ANF‐related damage [43], though this did not fully counteract the negative impact of excessive SBM replacement on protein deposition.

The activities of core digestive enzymes—AMS, PRS, and LPS—govern nutrient digestion in aquatic animals, profoundly shaping their digestive efficiency [11, 44]. PRS, essential for dietary protein hydrolysis, is a recognized biomarker of protein utilization ability in fish [45]. In this BFT‐based study, significant declines in hepatopancreatic and intestinal PRS activity were recorded in B51 and B68 groups compared to controls. This response may be linked to ANFs in SBM, which, at high inclusion levels, can disrupt digestive processes and suppress enzyme function [46]. Some studies have shown that increasing SBM in feed can reduce the PRS activity in hepatopancreas, as described by the results obtained in tilapia (Oreochromis niloticus × O. aureus) [47], red seabream (Pagrus major) [48], gibel carp (Carassius auratus gibelio) [49], and Amur Sturgeon (Acipenser schrenckii) [50]. However, under the BFT system, SBM instead of fish meal has no significant effect on activities of AMS and LPS. Similar results were found in amberjack [35] and abalone (Haliotis discus hannaino) [51]. The consistent starch and lipid profiles in all diets likely explain the unaltered LPS and AMS activities observed after SBM replacement in the BFT system since these enzymes respond primarily to their specific substrates. Alternatively, the modulations in fish intestinal digestive enzyme activity noted in this study may be linked to biofloc inclusion, given its recognized constituents—polysaccharides and extracellular enzymes—that enhance digestive enzyme function in farmed animals [29, 51–54]. As biomarkers of protein metabolism, GPT and GOT activities reflect an organism’s capacity for protein turnover [28]. We observed significantly raised serum levels and reduced hepatopancreatic activities of both enzymes in the B68 group versus CK, indicative of SBM‐related hepatopancreatic injury that disrupts normal transaminase distribution [55]. These results align with reports in tilapia [37], obscure puffer [56], Japanese seabass [57], and abalone [51], collectively highlighting a common physiological response to high SBM diets in aquatic species. These findings likely reflect biofloc‐mediated effects, attributable to the presence of PHB‐synthesizing bacteria in bioflocs. When ingested, these bacteria improve intestinal peristalsis and upregulate proteolytic enzyme activity, facilitating nutrient assimilation and metabolism [58]. Meanwhile, the mTOR pathway coordinates cellular growth in response to nutritional cues by activating anabolic processes (e.g., protein and nucleic acid synthesis) and inhibiting autophagy [30]. Under BFT conditions, the B68 group exhibited markedly reduced mRNA expression of mTOR, IGF-1, and S6K, together with elevated 4E-BP levels in the DI compared to the control. This pattern is consistent with the expression pattern of genes related to protein metabolism inhibition, suggesting that there may be a molecular basis for protein synthesis downregulation. An imbalanced amino acid composition resulting from high SBM substitution likely underlies the impaired protein utilization and synthesis efficiency [59]. Consistent with this, hepatopancreatic IGF‐1 expression was reduced in multiple aquatic species fed high plant‐protein diets [60]. While S6K1 was upregulated and 4E‐BP1 downregulated in Chinese mitten crab hepatopancreas [53], biofloc‐derived nutrients and beneficial microbes in the present system may help mitigate such disruptions, thereby enhancing protein turnover in Rhynchocypris lagowskii Dybowski [61].

Fish rely predominantly on nonspecific immunity due to their incomplete specific immune mechanisms compared to those of mammals [62, 63]. In this BFT study, the B68 group showed suppressed C3, C4, and LSZ but elevated IgM versus controls, indicating that SBM substitution within an appropriate range enhances immunity, whereas excessive replacement causes intestinal impairment and immune dysregulation. Immune suppression in fish fed high SBM diets is likely attributable to ANFs and suboptimal amino acid profiles, which collectively undermine nutritional adequacy [5]. Similar findings have been reported in diverse species such as Pacific white shrimp [64] and various finfish [65]. These results corroborate earlier work in Rhynchocypris lagowskii Dybowski, confirming that excessive SBM inclusion compromises immunity [29]. The results demonstrate that a suitable carbon‐nitrogen ratio strengthens immune responses in aquatic organisms. This enhancement may be driven by biofloc components—including diverse microorganisms, extracellular enzymes, and probiotics—that upregulate immune enzyme activity and produce bioactive secondary metabolites [66]. In parallel, plant protein‐induced regulation of intestinal inflammatory cytokines is widely recognized to involve the transcription factor NF‐κB [67]. These cytokines are functionally divided into pro‐inflammatory and anti‐inflammatory groups according to their specific roles in immune responses. Relative to controls in the BFT system, the B68 group displayed upregulated NF‐κB, IL‐1β, IL‐8, and downregulated TGF‐β mRNA throughout the hepatopancreas and intestinal tract, while the B51 group showed elevated NF‐κB, IL‐1β, IL‐8, and TNF‐α with reduced TGF‐β limited to the DI. These gene expression changes suggest that SBM‐associated ANFs can induce immune dysfunction, ultimately hindering normal growth in fish [28]. These gene expression changes suggest that SBM‐associated ANFs may induce immune dysfunction and ultimately impede normal fish growth [28]. SBM substitution in Japanese seabass diets enhanced pro‐inflammatory mediators (TNF‐α, IL‐1β, and IL‐8) and reduced anti‐inflammatory gene expression [11]. Parallel observations in rainbow trout indicated that high SBM intake provoked intestinal inflammation and significantly raised IL‐1β, IL‐10, and IL‐17 transcript levels [68]. These results are consistent with our data. The mitigation of inflammation in the current study could be due to high C/N bioflocs, which harbor beneficial microorganisms, probiotics, and bioactive agents that potentiate immune function and inflammatory control in aquatic species [24, 69, 70].

Inflammation and oxidative stress are fundamentally interconnected [71]. Biological organisms require oxygen‐free radicals for normal physiological functions but rely on both enzymatic and non‐enzymatic antioxidant systems to maintain redox balance. A shift of this dynamic equilibrium toward oxidation results in oxidative stress damage [72]. Under BFT conditions, the B68 group showed markedly decreased SOD, CAT, T‐AOC, and GSH‐PX activities and increased MDA levels in the hepatopancreas and entire intestinal tract, with the B51 group exhibiting similar trends specifically in the DI. Consistent with observations in numerous aquatic animals [73], soybean‐derived materials reduced antioxidant potential. In this study, the increase of MDA in the B68 group was accompanied by the decrease of SOD, CAT, and GSH‐PX activities, forming a coupled model of oxidative stress markers, which confirmed that excessive replacement of SBM destroyed the dynamic balance between antioxidant defense and reactive oxygen species (ROS) production. This state of oxidative stress may result from ANFs‐induced inflammation in SBM that produces excess ROS that impair immune pathways and impair antioxidant function [74]. The present results align with previous findings from clear‐water culture systems, wherein an increased substitution of fish meal by SBM was implemented [29]. This consistency may be attributed to the ability of BFT to enhance the antioxidant status of aquatic organisms, attenuating their sensitivity to oxidative stress and thereby strengthening their antioxidant capacity [75]. Notably, the Nrf2‐Keap1/ARE signaling pathway represents a canonical regulatory axis for modulating the antioxidant defense system. It can be activated under exogenous oxidative stress, helping maintain intracellular redox homeostasis and reducing cellular susceptibility to apoptotic signals [76, 77]. In the BFT system, the B68 group exhibited suppressed mRNA expression of Nrf2, Maf, and downstream antioxidant genes (CAT, HO‐1, and GSH‐PX) in the hepatopancreas and entire intestinal tract, along with elevated Keap1 transcript levels; similar alterations occurred in the DI of the B51 group. These results suggest that SBM impairs antioxidant capacity in fish via the Keap1‐Nrf2‐ARE signaling axis, which may be initiated by ANFs in SBM, which promote inflammatory response and excessive production of ROS, leading to oxidative cell damage and gene expression disorder in the Keap1‐Nrf2‐ARE cascade, ultimately impairing antioxidant response [78]. Consistent observations have been documented in multiple aquatic species, including Rhynchocypris lagowskii Dybowski [79], pearl gentian groupers (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) [80], and Channa argus [81]. In the present study, BFT effectively mitigated the adverse effects induced by SBM [29]. This protective role may be attributed to the diverse microbial communities in BFT systems, where both the microorganisms and their metabolites serve as immunostimulatory agents that enhance the antioxidant capacity in aquatic organisms [82, 83].

As the primary site for nutrient digestion and absorption, intestinal structural integrity is crucial for the healthy development of aquatic animals [28]. Under BFT conditions, the B68 group exhibited significantly reduced fold heights and muscular layer thickness in the PI, MI, and DI, along with increased lamina propria width in these segments. The B51 group showed similar alterations, though confined to the DI. These morphological changes suggest that ANFs in SBM—including β‐conglycinin, lectin, and soybean antigens—induce intestinal inflammation, impair normal intestinal development, and cause histopathological damage in Rhynchocypris lagowskii Dybowski [11]. Consistent results have been reported in Lateolabrax japonicus [11] and Rhynchocypris lagowskii Dybowski. Multiple ANFs in SBM may damage the gut through synergistic effects: trypsin inhibitors reduce protein digestibility, resulting in fermentation of undigested proteins in the hindgut to produce harmful substances; soy antigenic proteins (β‐conglycinin/glycinin) activate intestinal immune response and disrupt TJs; and phytic acid chelates minerals and affects enzyme activity [84]. The decrease in PRS activity in this study (group B68) suggests that trypsin inhibitors may play a major role, while the extensive upregulation of inflammatory factors suggests that the immune activation effect of antigenic proteins is significant. The mitigation of such damage in BFT systems may be attributed to growth‐promoting and bioactive compounds in bioflocs, which under suitable C/N ratios allow higher SBM inclusion while maintaining optimal growth performance [85]. The increased intestinal permeability in Rhynchocypris lagowskii Dybowski likely results from the disruption of intestinal TJ structures by ANFs—including trypsin inhibitors, phytic acid, soybean lectin, oligosaccharides, antigenic proteins, and urease—present in SBM used to replace fish meal. TJs, composed of proteins such as occludin and claudins, play a critical role in regulating paracellular permeability [86]. Consistent with this, the B68 group exhibited significantly elevated serum levels of ET‐1, D‐LA, 5‐HT, and DAO activity, while the B51 group showed increased DAO activity. Concurrently, mRNA expression of ZO‐1 and occludin‐a was markedly downregulated in the intestinal tract of the B68 group and in the DI of the B51 group. This may be because the gastrointestinal tract is the main target of SBM‐induced alterations in Rhynchocypris lagowskii Dybowski. Pathological changes are primarily driven by ANFs (soybean globulin, β‐conglycinin, etc.). that impair digestive function and initiate detrimental physiological cascades, ultimately affecting growth and gut health [6]. The biofloc system supports higher SBM substitution compared to conventional aquaculture by serving as a source of supplemental nutrition, probiotics, and bioactive substances, with optimal C/N ratios further enhancing intestinal well‐being [87].

Under the biofloc culture model, the substitution of fishmeal with SBM significantly altered the gut microbiota structure and diversity in Phoxinus lagowskii [28]. Specific manifestations included a marked reduction in the abundance of Proteobacteria in the B68 group, a decrease in the Simpson index in the B51 group, and an increase in the Shannon index in the B68 group. Beta‐diversity analysis further confirmed a clear separation between the substitution groups and the control group, with gradient shifts indicating a dose‐dependent restructuring of the gut microbiota. These findings suggest that SBM substitution may drive microbial restructuring by modifying the intestinal microenvironment. Multiple studies indicate that the impact of SBM on the fish microbiota is species‐ and condition‐dependent. Research by Tan et al. [88] collectively reports that SBM can increase microbial diversity and alter phylum‐level composition. In contrast, the results of Reveco, Desai, and Bruce show inconsistencies, highlighting the complexity of SBM’s effects on the gut microbiota [89–91]. This divergence may stem from interactions among variables such as the inclusion level of SBM, trial duration, and rearing environment. Notably, although the biofloc system can support higher substitution ratios of SBM, its mitigating effect may have an upper limit [87]. The unique ANFs and nutritional composition of SBM are likely to reshape the metabolic landscape of the gut microbiota, promoting the proliferation of specific bacterial taxa and thereby breaking the pre‐existing ecological balance [28]. Thus, the observed structural shifts in the microbiota are not merely a direct outcome of SBM substitution but also a potential mechanism underlying its impact on the host health.

5. Conclusion

In the BFT system, in order to guarantee growth performance and intestinal health, the proportion of SBM replacing fishmeal should be controlled below 34%, the maximum tolerable replacement ratio should be 51%, replacing ≥51% of fish meal protein with SBM significantly suppressed the growth performance of juvenile R. lagowskii, impaired intestinal morphology and barrier function, induced oxidative stress and inflammation, and caused intestinal dysbiosis. Therefore, the substitution level should be kept below 51%.

Author Contributions

Zhi-Yong Yang: writing – original draft, validation, methodology. Deng-Lai Li: methodology, investigation, formal analysis. Ke-xin Wang: validation, methodology. Rui Zhu: validation, investigation. Li-Fang Wu: supervision, resources, project administration. Qiong Wu: supervision, conceptualization.

Funding

The work was supported by the Jilin Provincial Scientific and Technological Development Program (Grant 20200402038NC).

Disclosure

This manuscript was approved for publication by all authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting Information

Additional supporting information can be found online in the Supporting Information section.

Supporting information

Supporting Information The supporting information associated with this manuscript provides detailed information about the commercial kits used in the enzyme activity assays described in Section 2.4.3. Specifically, it includes the manufacturer, catalog numbers, and the detection principles for each kit employed to measure the target enzyme activities. This supporting information is intended to support the reproducibility of the experimental procedures. Please refer to the supporting information document for full details.

ANU-2026-5561983-s001.docx^{(18.2KB, docx)}

Acknowledgments

The work was supported by the Department of Science and Technology of Jilin Province (Grant 20200402038NC).

Yang, Zhi‐Yong , Li, Deng‐Lai , Wang, Ke‐xin , Wu, Li‐Fang , Zhu, Rui , Wu, Qiong , A Maximum 34% Substitution of Fish Meal by Soybean Meal Is Recommended for Rhynchocypris lagowskii Dybowski Cultured in Biofloc Systems: Evidence From Growth and Intestinal Barrier Function, Aquaculture Nutrition, 2026, 5561983, 18 pages, 2026. 10.1155/anu/5561983

Guest Editor: Ioannis T. Karapanagiotidis

Contributor Information

Li-Fang Wu, Email: wulifang4074@163.com.

Rui Zhu, Email: zhurui1738158380@163.com.

Qiong Wu, Email: wuqiong20051221@126.com.

Ioannis T. Karapanagiotidis, Email: ikarapan@uth.gr

Data Availability Statement

Data will be provided upon request.

References

1. Zhou Z., Yao W., Ye B., Wu X., Li X., and Dong Y., Effects of Replacing Fishmeal Protein with Poultry By-Product Meal Protein and Soybean Meal Protein on Growth, Feed Intake, Feed Utilization, Gut and Liver Histology of Hybrid Grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) Juveniles, Aquaculture. (2020) 516, 10.1016/j.aquaculture.2019.734503, 734503. [DOI] [Google Scholar]
2. Li C., Tian Y., Wang L., Zhang B., and Ma Q., Effects of Replacing Fishmeal by Raw or Lactobacillus Acidophilus-Fermented Soybean Meal on Growth, Intestinal Digestive and Immune-Related Enzyme Activities, Morphology, and Microbiota in Turbot (Scophthalmus maximus l.), Aquaculture Nutrition. (2022) 2022, 10.1155/2022/2643235, 2643235. [DOI] [Google Scholar]
3. Zhu R., Duan J., and Li L., et al.Effects of Substituting Fish Meal with Two Types of Soybean Meal on Growth, Enzyme Activities, and Intestinal Morphology in Juvenile rhynchocypris lagowskii , North American Journal of Aquaculture. (2021) 83, no. 4, 267–282, 10.1002/naaq.10190. [DOI] [Google Scholar]
4. Chou R. L., Her B. Y., Su M. S., Hwang G., Wu Y. H., and Chen H. Y., Substituting Fish Meal With Soybean Meal in Diets of Juvenile Cobia rachycentron canadum , Aquaculture. (2004) 229, no. 1–4, 325–333, 10.1016/S0044-8486(03)00395-8. [DOI] [Google Scholar]
5. Gu M., Bai N., Xu B., Xu X., Jia Q., and Zhang Z., Protective Effect of Glutamine and Arginine Against Soybean Meal-Induced Enteritis in the Juvenile Turbot (scophthalmus maximus), Fish & Shellfish Immunology. (2017) 70, 95–105, 10.1016/j.fsi.2017.08.048. [DOI] [PubMed] [Google Scholar]
6. Obirikorang K. A., Gyamfi S., and Goode M. E., et al.Effect of Soybean Meal Diets on the Growth Performance, Ammonia Excretion Rates, Gut Histology and Feed Cost of Nile Tilapia (Oreochromis niloticus) Fry, Aquaculture Research. (2020) 51, no. 9, 3520–3532, 10.1111/are.14689. [DOI] [Google Scholar]
7. Zhu R., Li L., and Li M., et al.Effects of Dietary Glycinin on the Growth Performance, Immunity, Hepatopancreas and Intestinal Health of Juvenile Rhynchocypris lagowskii Dybowski, Aquaculture. (2021) 544, 10.1016/j.aquaculture.2021.737030, 737030. [DOI] [Google Scholar]
8. Yang Y., Wang Y., Lu Y., and Li Q., Effect of Replacing Fish Meal with Soybean Meal on Growth, Feed Utilization and Nitrogen and Phosphorus Excretion on Rainbow Trout (oncorhynchus mykiss), Aquaculture International. (2011) 19, no. 3, 405–419, 10.1007/s10499-010-9359-y. [DOI] [Google Scholar]
9. Wang Y., Wang L., Zhang C., and Song K., Effects of Substituting Fishmeal with Soybean Meal on Growth Performance and Intestinal Morphology in Orange-Spotted Grouper (Epinephelus coioides), Aquaculture Reports. (2017) 5, 52–57, 10.1016/j.aqrep.2016.12.005. [DOI] [Google Scholar]
10. Yu D. H., Gong S. Y., Yuan Y. C., and Lin Y. C., Effects of Replacing Fish Meal with Soybean Meal on Growth, Body Composition and Digestive Enzyme Activities of Juvenile Chinese Sucker,myxocyprinus asiaticus , Aquaculture Nutrition. (2013) 19, no. 1, 84–90, 10.1111/j.1365-2095.2012.00945.x. [DOI] [Google Scholar]
11. Zhang C., Rahimnejad S., and Wang Y., et al.Substituting Fish Meal with Soybean Meal in Diets for japanese Seabass (lateolabrax japonicus): Effects on Growth, Digestive Enzymes Activity, Gut Histology, and Expression of Gut Inflammatory and Transporter Genes, Aquaculture. (2018) 483, 173–182, 10.1016/j.aquaculture.2017.10.029. [DOI] [Google Scholar]
12. Ma Z., Hassan M. M., and Allais L., et al.Comparison of Partial Replacement of Fishmeal With Soybean Meal and Enzomeal on Growth Performance of Asian Seabass lates calcarifer , Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology. (2019) 216, 29–37, 10.1016/j.cbpc.2018.10.006. [DOI] [PubMed] [Google Scholar]
13. Liu Q., Wen B., Man D., Jiang Y., Li X., and Zuo R., Substitution of Fish Meal with Soybean Meal for Juvenile Chinese Mitten Crab (Eriocheir sinensis) Reared at Three Salinities: Effects on Survival, Growth, Antioxidant Capacity and Body Composition, Aquaculture Research. (2021) 52, no. 8, 3723–3735, 10.1111/are.15217. [DOI] [Google Scholar]
14. Liu T., Han T., and Wang J., et al.Effects of Replacing Fish Meal with Soybean Meal on Growth Performance, Feed Utilization and Physiological Status of Juvenile Redlip Mullet Liza Haematocheila, Aquaculture Reports. (2021) 20, 10.1016/j.aqrep.2021.100756, 100756. [DOI] [Google Scholar]
15. Zhang J., Zhong L., Chi S., Chu W., Liu Y., and Hu Y., Sodium Butyrate Supplementation in High-Soybean Meal Diets for Juvenile Rice Field Eel (monopterus albus): Effects on Growth, Immune Response and Intestinal Health, Aquaculture. (2020) 520, 10.1016/j.aquaculture.2020.734952, 734952. [DOI] [Google Scholar]
16. Liu Y., Chen Z., and Dai J., et al.The Protective Role of Glutamine on Enteropathy Induced by High Dose of Soybean Meal in Turbot, Scophthalmus maximus l, Aquaculture. (2018) 497, 510–519, 10.1016/j.aquaculture.2018.08.021. [DOI] [Google Scholar]
17. Magalhães R., Lopes T., and Martins N., et al.Carbohydrases Supplementation Increased Nutrient Utilization in White Seabream (diplodus sargus) Juveniles Fed High Soybean Meal Diets, Aquaculture. (2016) 463, 43–50, 10.1016/j.aquaculture.2016.05.019. [DOI] [Google Scholar]
18. Wu Y., Ma H., Wang X., and Ren X., Taurine Supplementation Increases the Potential of Fishmeal Replacement by Soybean Meal in Diets for Largemouth Bassmicropterus salmoides , Aquaculture Nutrition. (2021) 27, no. 3, 691–699, 10.1111/anu.13215. [DOI] [Google Scholar]
19. Fuentes Quesada J. P., Cornejo Granados F., and Mata Sotres J. A., et al.Prebiotic Agavin in Juvenile Totoaba, Totoaba macdonaldi Diets, to Relieve Soybean Meal-Induced Enteritis: Growth Performance, Gut Histology and Microbiota, Aquaculture Nutrition. (2020) 26, no. 6, 2115–2134, 10.1111/anu.13151. [DOI] [Google Scholar]
20. Asaduzzaman M., Rahman M. M., and Azim M. E., et al.Effects of c/n Ratio and Substrate Addition on Natural Food Communities in Freshwater Prawn Monoculture Ponds, Aquaculture. (2010) 306, no. 1–4, 127–136, 10.1016/j.aquaculture.2010.05.035. [DOI] [Google Scholar]
21. Ray A. J., Seaborn G., Leffler J. W., Wilde S. B., Lawson A., and Browdy C. L., Characterization of Microbial Communities in Minimal-Exchange, Intensive Aquaculture Systems and the Effects of Suspended Solids Management, Aquaculture. (2010) 310, no. 1-2, 130–138, 10.1016/j.aquaculture.2010.10.019. [DOI] [Google Scholar]
22. De Schryver P., Crab R., Defoirdt T., Boon N., and Verstraete W., The Basics of Bio-Flocs Technology: The Added Value for Aquaculture, Aquaculture. (2008) 277, no. 3-4, 125–137, 10.1016/j.aquaculture.2008.02.019. [DOI] [Google Scholar]
23. Schrader K. K., Green B. W., and Perschbacher P. W., Development of Phytoplankton Communities and Common Off-Flavors in a Biofloc Technology System Used for the Culture of Channel Catfish (ictalurus Punctatus), Aquacultural Engineering. (2011) 45, no. 3, 118–126, 10.1016/j.aquaeng.2011.08.004. [DOI] [Google Scholar]
24. Bakhshi F., Najdegerami E. H., Manaffar R., Tukmechi A., and Farah K. R., Use of Different Carbon Sources for the Biofloc System During the Grow-Out Culture of Common Carp (cyprinus carpio l.) Fingerlings, Aquaculture. (2018) 484, 259–267, 10.1016/j.aquaculture.2017.11.036. [DOI] [Google Scholar]
25. Putra I., Rusliadi R., Fauzi M., Tang U. M., and Muchlisin Z. A., Growth Performance and Feed Utilization of african Catfish clarias gariepinus Fed a Commercial Diet and Reared in the Biofloc System Enhanced with Probiotic [version 1;, 2017, Peer review: 2 approved]. F1000 Research 6, 1545. [DOI] [PMC free article] [PubMed]
26. Ekasari J., Rivandi D. R., and Firdausi A. P., et al.Biofloc Technology Positively Affects Nile Tilapia (Oreochromis niloticus) Larvae Performance, Aquaculture. (2015) 441, 72–77, 10.1016/j.aquaculture.2015.02.019. [DOI] [Google Scholar]
27. Poli M. A., Schveitzer R., and de Oliveira Nuñer A. P., The use of Biofloc Technology in a South american Catfish (rhamdia quelen) Hatchery: Effect of Suspended Solids in the Performance of Larvae, Aquacultural Engineering. (2015) 66, 17–21, 10.1016/j.aquaeng.2015.01.004. [DOI] [Google Scholar]
28. Li L., Yang Z., and Qu Z., et al.Alleviative Effect of Biofloc Technology (bft) on Extruded Soybean Meal (esbm)-Induced Growth Inhibition and Intestinal Barrier Dysfunction in Rhynchocypris lagowskii , Aquaculture. (2022) 561, 10.1016/j.aquaculture.2022.738677, 738677. [DOI] [Google Scholar]
29. Yu Z., Huang Z-Qi, Du H-Lin, Li H-Jin, and Wu L-Fang, Influence of Differential Protein Levels of Feed on Growth, Copper-Induced Immune Response and Oxidative Stress Ofrhynchocypris Lagowski in a Biofloc-Based System, Aquaculture Nutrition. (2020) 26, no. 6, 2211–2224, 10.1111/anu.13158. [DOI] [Google Scholar]
30. Zhu R., Wu X., and Zhao X., et al.Taurine Can Improve Intestinal Function and Integrity in Juvenile rhynchocypris lagowskii Dybowski Fed High-Dose Glycinin, Fish & Shellfish Immunology. (2022) 129, 127–136, 10.1016/j.fsi.2022.08.063. [DOI] [PubMed] [Google Scholar]
31. Li L., Zhu R., Yu Z., Liu J., Qu Z., and Wu L., Effects of β-Conglycinin on Intestinal Structure and Intestinal Permeability Inrhynchocypris Lagowski Dybowski, Aquaculture Nutrition. (2021) 27, no. 6, 1946–1958, 10.1111/anu.13331. [DOI] [Google Scholar]
32. Livak K. J. and Schmittgen T. D., Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−94;94;CT Method, Methods. (2001) 25, no. 4, 402–408, 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
33. Chutia A., Xavier K. A. M., Shamna N., and Rani A. M. B., Application of Bioflocculating Agent in Inoculum Enhances Quality of Biofloc and Influences Growth, Feed Utilization and Stress Responses of Gift Tilapia Reared in-Situ, Aquaculture. (2022) 553, 10.1016/j.aquaculture.2022.738050, 738050. [DOI] [Google Scholar]
34. Hernández M. D., Martínez F. J., Jover M., and García García B., Effects of Partial Replacement of Fish Meal by Soybean Meal in Sharpsnout Seabream (Diplodus puntazzo) Diet, Aquaculture. (2007) 263, no. 1–4, 159–167, 10.1016/j.aquaculture.2006.07.040. [DOI] [Google Scholar]
35. Hossain S., Koshio S., and Ishikawa M., et al.Substitution of Dietary Fishmeal by Soybean Meal With Inosine Administration Influences Growth, Digestibility, Immunity, Stress Resistance and Gut Morphology of Juvenile Amberjack Seriola dumerili , Aquaculture. (2018) 488, 174–188, 10.1016/j.aquaculture.2018.01.037. [DOI] [Google Scholar]
36. Silva-Carrillo Y., Hernández C., Hardy R. W., González-Rodríguez B., and Castillo-Vargasmachuca S., The Effect of Substituting Fish Meal with Soybean Meal on Growth, Feed Efficiency, Body Composition and Blood Chemistry in Juvenile Spotted Rose Snapper lutjanus guttatus (steindachner, 1869), Aquaculture. (2012) 364-365, 180–185, 10.1016/j.aquaculture.2012.08.007. [DOI] [Google Scholar]
37. Lin S. and Luo L., Effects of Different Levels of Soybean Meal Inclusion in Replacement for Fish Meal on Growth, Digestive Enzymes and Transaminase Activities in Practical Diets for Juvenile Tilapia, oreochromis niloticus×o.aureus, Animal Feed Science and Technology. (2011) 168, no. 1-2, 80–87, 10.1016/j.anifeedsci.2011.03.012. [DOI] [Google Scholar]
38. Wang G., Yu E., and Xie J., et al.Effect of c/n Ratio on Water Quality in Zero-Water Exchange Tanks and the Biofloc Supplementation in Feed on the Growth Performance of Crucian Carp, carassius auratus , Aquaculture. (2015) 443, 98–104, 10.1016/j.aquaculture.2015.03.015. [DOI] [Google Scholar]
39. Zhao Z., Xu Q., Luo L., Wang C., Li J., and Wang L., Effect of Feed c/n Ratio Promoted Bioflocs on Water Quality and Production Performance of Bottom and Filter Feeder Carp in Minimum-Water Exchanged Pond Polyculture System, Aquaculture. (2014) 434, 442–448, 10.1016/j.aquaculture.2014.09.006. [DOI] [Google Scholar]
40. Friesen E. N., Higgs D. A., and Devlin R. H., Flesh Nutritional Content of Growth Hormone Transgenic and Non-Transgenic Coho Salmon Compared to Various Species of Farmed and Wild Salmon, Aquaculture. (2015) 437, 318–326, 10.1016/j.aquaculture.2014.11.035. [DOI] [Google Scholar]
41. Lin J., Zhang C., Lu K., Song K., and Wang L., Effect of Guanidinoacetic Acid and Betaine Supplementation in Soybean Meal-Based Diets on Growth Performance, Muscle Energy Metabolism and Methionine Utilization in the Bullfrog Lithobates Catesbeianus, Aquaculture. (2021) 533, 10.1016/j.aquaculture.2020.736167, 736167. [DOI] [Google Scholar]
42. Elangovan A. and Shim K. F., The Influence of Replacing Fish Meal Partially in the Diet With Soybean Meal on Growth and Body Composition of Juvenile Tin Foil Barb (barbodes Altus), Aquaculture. (2000) 189, no. 1-2, 133–144, 10.1016/S0044-8486(00)00365-3. [DOI] [Google Scholar]
43. Ridha M. T., Hossain M. A., Azad I. S., and Saburova M., Effects of Three Carbohydrate Sources on Water Quality, Water Consumption, Bacterial Count, Growth and Muscle Quality of Nile Tilapia (oreochromis niloticus) in a Biofloc System, Aquaculture Research. (2020) 51, no. 10, 4225–4237, 10.1111/are.14764. [DOI] [Google Scholar]
44. Li X., Liu S., and Fan K., et al.Effects of Illumination Intensities on Growth, Digestive and Metabolic Enzyme Activities and Antioxidant Capacities of Juvenile Takifugu Rubripes, Aquaculture. (2022) 548, 10.1016/j.aquaculture.2021.737594, 737594. [DOI] [Google Scholar]
45. Ning L., Zhang X., Zhang D., Hu Y., and Li Y., The Benefits of Blend Essential Oil for Gift Tilapia on the Digestion, Antioxidant, and Muscle Quality During Cold Storage, Aquaculture. (2021) 533, 10.1016/j.aquaculture.2020.736097, 736097. [DOI] [Google Scholar]
46. Arriaga-Hernández D., Hernández C., and Martínez-Montaño E., et al.Fish Meal Replacement by Soybean Products in Aquaculture Feeds for White Snook, Centropomus Viridis: Effect on Growth, Diet Digestibility, and Digestive Capacity, Aquaculture. (2021) 530, 10.1016/j.aquaculture.2020.735823, 735823. [DOI] [Google Scholar]
47. Lin S. and Luo L., Effects of Different Levels of Soybean Meal Inclusion in Replacement for Fish Meal on Growth, Digestive Enzymes and Transaminase Activities in Practical Diets for Juvenile Tilapia, oreochromis niloticus×o, Animal Feed Science and Technology. (2011) 168, no. 1-2, 80–87. [Google Scholar]
48. Murashita K., Matsunari H., Furuita H., Rønnestad I., Oku H., and Yamamoto T., Effects of Dietary Soybean Meal on the Digestive Physiology of Red Seabream Pagrus Major, Aquaculture. (2018) 493, 219–228, 10.1016/j.aquaculture.2018.05.005. [DOI] [Google Scholar]
49. Liu H., Jin J., Zhu X., Han D., Yang Y., and Xie S., Effect of Substitution of Dietary Fish Meal by Soybean Meal on Different Sizes of Gibel Carp (Carassius auratus Gibelio): Digestive Enzyme Gene Expressions and Activities, and Intestinal and Hepatic Histology, Aquaculture Nutrition. (2017) 23, no. 1, 129–147, 10.1111/anu.12375. [DOI] [Google Scholar]
50. Xu Q. Y., Wang C. A., Zhao Z. G., and Luo L., Effects of Replacement of Fish Meal by Soy Protein Isolate on the Growth, Digestive Enzyme Activity and Serum Biochemical Parameters for Juvenile Amur Sturgeon (acipenser schrenckii), Asian-Australasian Journal of Animal Sciences. (2012) 25, no. 11, 1588–1594, 10.5713/ajas.2012.12192. [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Yu X., Wu Z., and Guo J., et al.Replacement of Dietary Fish Meal by Soybean Meal on Growth Performance, Immunity, Anti-Oxidative Capacity and Mtor Pathways in Juvenile Abalone haliotis discus Hannai Ino, Aquaculture. (2022) 551, 10.1016/j.aquaculture.2022.737914, 737914. [DOI] [Google Scholar]
52. Amriawati E., Budiardi T., Setiawati M., Rohmana D., and Ekasari J., Digestive System and Growth Performance of Giant Gourami (osphronemus Goramy Lacepede) Juveniles in Biofloc Systems Fed With Different Feed Types, Aquaculture Research. (2021) 52, no. 10, 4661–4669, 10.1111/are.15300. [DOI] [Google Scholar]
53. Xu C., Liu W., and Zhang D., et al.Effects of Partial Fish Meal Replacement with Two Fermented Soybean Meals on the Growth of and Protein Metabolism in the Chinese Mitten Crab (eriocheir Sinensis), Aquaculture Reports. (2020) 17, 10.1016/j.aqrep.2020.100328, 100328. [DOI] [Google Scholar]
54. Yu Z., Li L., Zhu R., Li M., Duan J., Wang J.-Y., Liu Y.-H., and Wu L.-F., Monitoring of Growth, Digestive Enzyme Activity, Immune Response and Water Quality Parameters of Golden Crucian Carp (carassius auratus) in Zero-Water Exchange Tanks of Biofloc Systems, Aquaculture Reports. (2020) 16, 10.1016/j.aqrep.2020.100283, 100283. [DOI] [Google Scholar]
55. Novriadi R., Salze G., Abebe A., Hanson T., and Davis D. A., Partial or Total Replacement of Fish Meal in the Diets of Florida Pompanotrachinotus carolinus , Aquaculture Research. (2019) 50, no. 5, 1527–1538, 10.1111/are.14029. [DOI] [Google Scholar]
56. Ye H., Xu M., and Liu Q., et al.Effects of Replacing Fish Meal with Soybean Meal on Growth Performance, Feed Utilization and Physiological Status of Juvenile Obscure Puffer, Takifugu Obscurus, Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology. (2019) 216, 75–81, 10.1016/j.cbpc.2018.11.006. [DOI] [PubMed] [Google Scholar]
57. Li Y., Ai Q., Mai K., Xu W., Deng J., and Cheng Z., Comparison of High-Protein Soybean Meal and Commercial Soybean Meal Partly Replacing Fish Meal on the Activities of Digestive Enzymes and Aminotransferases in Juvenile japanese Seabass,lateolabrax japonicus (Cuvier, 1828), Aquaculture Research. (2014) 45, no. 6, 1051–1060, 10.1111/are.12042. [DOI] [Google Scholar]
58. Yu Z., Li L., Zhu R., Li M., and Wu L. F., Effects of Bioflocs with Different c/n Ratios on Growth, Immunological Parameters, Antioxidants and Culture Water Quality inopsariichthys kaopingensis Dybowski, Aquaculture Research. (2019) 51, no. 2, 805–815, 10.1111/are.14430. [DOI] [Google Scholar]
59. Meng F., Li B., Xie Y., Li M., and Wang R., Substituting Fishmeal with Extruded Soybean Meal in Diets Did Not Affect the Growth Performance, Hepatic Enzyme Activities, but Hypoxia Tolerance of Dolly Varden (salvelinus malma) Juveniles, Aquaculture Research. (2019) 51, no. 1, 379–388, 10.1111/are.14385. [DOI] [Google Scholar]
60. Gómez-Requeni P., Mingarro M., and Calduch-Giner J. A., et al.Protein Growth Performance, Amino Acid Utilisation and Somatotropic Axis Responsiveness to Fish Meal Replacement by Plant Protein Sources in Gilthead Sea Bream (Sparus aurata), Aquaculture. (2004) 232, no. 1–4, 493–510, 10.1016/S0044-8486(03)00532-5. [DOI] [Google Scholar]
61. Shao J., Liu M., Wang B., Jiang K., Wang M., and Wang L., Evaluation of Biofloc Meal as an Ingredient in Diets for White Shrimp Litopenaeus Vannamei under Practical Conditions: Effect on Growth Performance, Digestive Enzymes and Tor Signaling Pathway, Aquaculture. (2017) 479, 516–521, 10.1016/j.aquaculture.2017.06.034. [DOI] [Google Scholar]
62. Neuls L., Souza V. J. D., and Romão S., et al.Immunomodulatory Effects of Yarrowia Lipolytica as a Food Additive in the Diet of Nile Tilapia, Fish & Shellfish Immunology. (2021) 119, 272–279, 10.1016/j.fsi.2021.10.011. [DOI] [PubMed] [Google Scholar]
63. Zhu M., Zhang Y., and Pan J., et al.Grass Carp Reovirus Triggers Autophagy Enhancing Virus Replication via the Akt/Mtor Pathway, Fish Shellfish Immunol. (2022) 128, 148–156, 10.1016/j.fsi.2022.07.069. [DOI] [PubMed] [Google Scholar]
64. Xie S.-W., Liu Y.-J., Zeng S., Niu J., and Tian L.-X., Partial Replacement of Fish-Meal by Soy Protein Concentrate and Soybean Meal Based Protein Blend for Juvenile Pacific White Shrimp, Litopenaeus Vannamei, Aquaculture. (2016) 464, 296–302, 10.1016/j.aquaculture.2016.07.002. [DOI] [Google Scholar]
65. Ding Z., Zhang Y., Ye J., Du Z., and Kong Y., An Evaluation of Replacing Fish Meal with Fermented Soybean Meal in the Diet of Macrobrachium Nipponense: Growth, Nonspecific Immunity, and Resistance to Aeromonas, Fish & Shellfish Immunology. (2015) 44, no. 1, 295–301, 10.1016/j.fsi.2015.02.024. [DOI] [PubMed] [Google Scholar]
66. Defoirdt T., Boon N., Sorgeloos P., Verstraete W., and Bossier P., Alternatives to Antibiotics to Control Bacterial Infections: Luminescent Vibriosis in Aquaculture as an Example, Trends in Biotechnology. (2007) 25, no. 10, 472–479, 10.1016/j.tibtech.2007.08.001. [DOI] [PubMed] [Google Scholar]
67. Sahlmann C., Sutherland B. J. G., Kortner T. M., Koop B. F., Krogdahl Å., and Bakke A. M., Early Response of Gene Expression in the Distal Intestine of Atlantic Salmon (salmo Salar l.) During the Development of Soybean Meal Induced Enteritis, Fish & Shellfish Immunology. (2013) 34, no. 2, 599–609, 10.1016/j.fsi.2012.11.031. [DOI] [PubMed] [Google Scholar]
68. Miao S., Zhao C., Zhu J., Hu J., Dong X., and Sun L., Dietary Soybean Meal Affects Intestinal Homoeostasis by Altering the Microbiota, Morphology and Inflammatory Cytokine Gene Expression in Northern Snakehead, Scientific Reports. (2018) 8, no. 1, 10.1038/s41598-017-18430-7, 113. [DOI] [PMC free article] [PubMed] [Google Scholar]
69. Men K., Ai Q., Mai K., Xu W., Zhang Y., and Zhou H., Effects of Dietary Corn Gluten Meal on Growth, Digestion and Protein Metabolism in Relation to Igf-i Gene Expression of japanese Seabass, lateolabrax japonicus , Aquaculture. (2014) 428-429, 303–309, 10.1016/j.aquaculture.2014.03.028. [DOI] [Google Scholar]
70. Xu W., Xu Y., and Su H., et al.Effects of Feeding Frequency on Growth, Feed Utilization, Digestive Enzyme Activity and Body Composition of Litopenaeus Vannamei in Biofloc-Based Zero-Exchange Intensive Systems, Aquaculture. (2020) 522, 10.1016/j.aquaculture.2020.735079, 735079. [DOI] [Google Scholar]
71. West X. Z., Malinin N. L., and Merkulova A. A., et al.Oxidative Stress Induces Angiogenesis by Activating tlr2 With Novel Endogenous Ligands, Nature. (2010) 467, no. 7318, 972–976, 10.1038/nature09421. [DOI] [PMC free article] [PubMed] [Google Scholar]
72. Bai S. C. and Lee K.-J., Different Levels of Dietary Dl- α-Tocopheryl Acetate Affect the Vitamin e Status of Juvenile korean Rockfish, Sebastes Schlegeli, Aquaculture. (1998) 161, no. 1–4, 405–414, 10.1016/S0044-8486(97)00288-3. [DOI] [Google Scholar]
73. Song X., Ye H., and Jin F., et al.Effects of Fermented Soybean Meal and Guanosine 5^′-Monophosphate on Growth, Intestinal Health and Anti-Stress Capability of Penaeus Vannamei in Low Fish Meal Diet, Aquaculture. (2022) 548, 10.1016/j.aquaculture.2021.737591, 737591. [DOI] [Google Scholar]
74. Dong G. F., Yang Y. O., and Song X. M., et al.Comparative Effects of Dietary Supplementation with Maggot Meal and Soybean Meal in Gibel Carp (Carassius auratus Gibelio) and Darkbarbel Catfish (pelteobagrus Vachelli): Growth Performance and Antioxidant Responses, Aquaculture Nutrition. (2013) 19, no. 4, 543–554, 10.1111/anu.12006. [DOI] [Google Scholar]
75. Zhao P., Huang J., and Wang X., et al.The Application of Bioflocs Technology in High-Intensive, Zero Exchange Farming Systems of Marsupenaeus Japonicus, Aquaculture. (2012) 354-355, 97–106, 10.1016/j.aquaculture.2012.03.034. [DOI] [Google Scholar]
76. Wang Y., Wang D., and Yin K., et al.Lycopene Attenuates Oxidative Stress, Inflammation, and Apoptosis by Modulating nrf2/Nf-κb Balance in Sulfamethoxazole-Induced Neurotoxicity in Grass Carp (ctenopharyngodon Idella), Fish Shellfish Immunol. (2022) 121, 322–331, 10.1016/j.fsi.2022.01.012. [DOI] [PubMed] [Google Scholar]
77. Wang X. J., Li Y., and Luo L., et al.Oxaliplatin Activates the keap1/nrf2 Antioxidant System Conferring Protection Against the Cytotoxicity of Anticancer Drugs, Free Radical Biology & Medicine. (2014) 70, 68–77, 10.1016/j.freeradbiomed.2014.02.010. [DOI] [PubMed] [Google Scholar]
78. Pervin M. A., Jahan H., Akter R., Omri A., and Hossain Z., Appraisal of Different Levels of Soybean Meal in Diets on Growth, Digestive Enzyme Activity, Antioxidation, and Gut Histology of Tilapia (Oreochromis niloticus), Fish Physiology and Biochemistry. (2020) 46, no. 4, 1397–1407, 10.1007/s10695-020-00798-5. [DOI] [PubMed] [Google Scholar]
79. Li L., Zhu R., and Li M., et al.Effects of β-Conglycinin on Growth Performance, Antioxidant Capacity and Immunity Inrhynchocypris Lagowski Dybowski, Aquaculture Nutrition. (2020) 26, no. 6, 2059–2073, 10.1111/anu.13147. [DOI] [Google Scholar]
80. He Y., Liang J., and Dong X., et al.Soybean β-Conglycinin and Glycinin Reduced Growth Performance and the Intestinal Immune Defense and Altered Microbiome in Juvenile Pearl Gentian Groupers Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂, Animal Nutrition. (2022) 9, 193–203, 10.1016/j.aninu.2021.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
81. Yu Z., Zhao Y.-Y., Jiang N., Zhang A.-Z., and Li M.-Y., Bioflocs Attenuates Lipopolysaccharide-Induced Inflammation, Immunosuppression and Oxidative Stress in channa argus , Fish & Shellfish Immunology. (2021) 114, 218–228, 10.1016/j.fsi.2021.05.006. [DOI] [PubMed] [Google Scholar]
82. Tong R., Chen W., Pan L., and Zhang K., Effects of Feeding Level and c/n Ratio on Water Quality, Growth Performance, Immune and Antioxidant Status of Litopenaeus Vannamei in Zero –water Exchange Bioflocs-Based Outdoor Soil Culture Ponds, Fish & Shellfish Immunology. (2020) 101, 126–134, 10.1016/j.fsi.2020.03.051. [DOI] [PubMed] [Google Scholar]
83. Liu X., Han B., and Xu J., et al.Replacement of Fishmeal with Soybean Meal Affects the Growth Performance, Digestive Enzymes, Intestinal Microbiota and Immunity of Carassius auratus Gibelio♀ × Cyprinus carpio , Aquaculture Reports. (2020) 18, 10.1016/j.aqrep.2020.100472, 100472. [DOI] [Google Scholar]
84. Zhao X., Wang Y., Wang X., and Ye J., Growth Performance, Plasma Components, and Intestinal Barrier in Grouper (epinephelus coioides) Are Altered by Dietary Fish Meal Replacement with Extruded Soybean Meal, Aquaculture Reports. (2021) 21, 10.1016/j.aqrep.2021.100863, 100863. [DOI] [Google Scholar]
85. Azimi A., Shekarabi S. P. H., and Paknejad H., et al.Various Carbon/Nitrogen Ratios in a Biofloc-Based Rearing System of Common Carp (cyprinus carpio) Fingerlings: Effect on Growth Performance, Immune Response, and Serum Biochemistry, Aquaculture. (2022) 548, 10.1016/j.aquaculture.2021.737622, 737622. [DOI] [Google Scholar]
86. Wu P., Liu Y., and Jiang W., et al.Intestinal Immune Responses of Jian Carp against Aeromonas Hydrophila Depressed by Choline Deficiency: Varied Change Patterns of Mrna Levels of Cytokines, Tight Junction Proteins and Related Signaling Molecules among Three Intestinal Segments, Fish & Shellfish Immunology. (2017) 65, 34–41, 10.1016/j.fsi.2017.03.053. [DOI] [PubMed] [Google Scholar]
87. Chen J., Ren Y., Li Y., and Xia B., Regulation of Growth, Intestinal Microbiota, Non-Specific Immune Response and Disease Resistance of Sea Cucumber Apostichopus Japonicus (selenka) in Biofloc Systems, Fish & Shellfish Immunology. (2018) 77, 175–186, 10.1016/j.fsi.2018.03.053. [DOI] [PubMed] [Google Scholar]
88. Tan P., Wu X., Zhu W., Lou B., Chen R., and Wang L., Effect of Tributyrin Supplementation in High-Soya Bean Meal Diet on Growth Performance, Body Composition, Intestine Morphology and Microbiota of Juvenile Yellow Drum (nibea albiflora), Aquaculture Research. (2020) 51, no. 5, 2004–2019, 10.1111/are.14552. [DOI] [Google Scholar]
89. Reveco F. E., Øverland M., Romarheim O. H., and Mydland L. T., Intestinal Bacterial Community Structure Differs between Healthy and Inflamed Intestines in Atlantic Salmon (salmo Salar l.), Aquaculture. (2014) 420-421, 262–269, 10.1016/j.aquaculture.2013.11.007. [DOI] [Google Scholar]
90. Desai A. R., Links M. G., and Collins S. A., et al.Effects of Plant-Based Diets on the Distal Gut Microbiome of Rainbow Trout (Oncorhynchus mykiss), Aquaculture. (2012) 350–353, 134–142, 10.1016/j.aquaculture.2012.04.005. [DOI] [Google Scholar]
91. Bruce T. J., Neiger R. D., and Brown M. L., Gut Histology, Immunology and the Intestinal Microbiota of Rainbow Trout,oncorhynchus mykiss (walbaum), Fed Process Variants of Soybean Mea, Aquaculture Research. (2018) 49, no. 1, 492–504, 10.1111/are.13480. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ANU-2026-5561983-s001.docx^{(18.2KB, docx)}

Data Availability Statement

Data will be provided upon request.

[bib-0001] 1. Zhou Z., Yao W., Ye B., Wu X., Li X., and Dong Y., Effects of Replacing Fishmeal Protein with Poultry By-Product Meal Protein and Soybean Meal Protein on Growth, Feed Intake, Feed Utilization, Gut and Liver Histology of Hybrid Grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) Juveniles, Aquaculture. (2020) 516, 10.1016/j.aquaculture.2019.734503, 734503. [DOI] [Google Scholar]

[bib-0002] 2. Li C., Tian Y., Wang L., Zhang B., and Ma Q., Effects of Replacing Fishmeal by Raw or Lactobacillus Acidophilus-Fermented Soybean Meal on Growth, Intestinal Digestive and Immune-Related Enzyme Activities, Morphology, and Microbiota in Turbot (Scophthalmus maximus l.), Aquaculture Nutrition. (2022) 2022, 10.1155/2022/2643235, 2643235. [DOI] [Google Scholar]

[bib-0003] 3. Zhu R., Duan J., and Li L., et al.Effects of Substituting Fish Meal with Two Types of Soybean Meal on Growth, Enzyme Activities, and Intestinal Morphology in Juvenile rhynchocypris lagowskii , North American Journal of Aquaculture. (2021) 83, no. 4, 267–282, 10.1002/naaq.10190. [DOI] [Google Scholar]

[bib-0004] 4. Chou R. L., Her B. Y., Su M. S., Hwang G., Wu Y. H., and Chen H. Y., Substituting Fish Meal With Soybean Meal in Diets of Juvenile Cobia rachycentron canadum , Aquaculture. (2004) 229, no. 1–4, 325–333, 10.1016/S0044-8486(03)00395-8. [DOI] [Google Scholar]

[bib-0005] 5. Gu M., Bai N., Xu B., Xu X., Jia Q., and Zhang Z., Protective Effect of Glutamine and Arginine Against Soybean Meal-Induced Enteritis in the Juvenile Turbot (scophthalmus maximus), Fish & Shellfish Immunology. (2017) 70, 95–105, 10.1016/j.fsi.2017.08.048. [DOI] [PubMed] [Google Scholar]

[bib-0006] 6. Obirikorang K. A., Gyamfi S., and Goode M. E., et al.Effect of Soybean Meal Diets on the Growth Performance, Ammonia Excretion Rates, Gut Histology and Feed Cost of Nile Tilapia (Oreochromis niloticus) Fry, Aquaculture Research. (2020) 51, no. 9, 3520–3532, 10.1111/are.14689. [DOI] [Google Scholar]

[bib-0007] 7. Zhu R., Li L., and Li M., et al.Effects of Dietary Glycinin on the Growth Performance, Immunity, Hepatopancreas and Intestinal Health of Juvenile Rhynchocypris lagowskii Dybowski, Aquaculture. (2021) 544, 10.1016/j.aquaculture.2021.737030, 737030. [DOI] [Google Scholar]

[bib-0008] 8. Yang Y., Wang Y., Lu Y., and Li Q., Effect of Replacing Fish Meal with Soybean Meal on Growth, Feed Utilization and Nitrogen and Phosphorus Excretion on Rainbow Trout (oncorhynchus mykiss), Aquaculture International. (2011) 19, no. 3, 405–419, 10.1007/s10499-010-9359-y. [DOI] [Google Scholar]

[bib-0009] 9. Wang Y., Wang L., Zhang C., and Song K., Effects of Substituting Fishmeal with Soybean Meal on Growth Performance and Intestinal Morphology in Orange-Spotted Grouper (Epinephelus coioides), Aquaculture Reports. (2017) 5, 52–57, 10.1016/j.aqrep.2016.12.005. [DOI] [Google Scholar]

[bib-0010] 10. Yu D. H., Gong S. Y., Yuan Y. C., and Lin Y. C., Effects of Replacing Fish Meal with Soybean Meal on Growth, Body Composition and Digestive Enzyme Activities of Juvenile Chinese Sucker,myxocyprinus asiaticus , Aquaculture Nutrition. (2013) 19, no. 1, 84–90, 10.1111/j.1365-2095.2012.00945.x. [DOI] [Google Scholar]

[bib-0011] 11. Zhang C., Rahimnejad S., and Wang Y., et al.Substituting Fish Meal with Soybean Meal in Diets for japanese Seabass (lateolabrax japonicus): Effects on Growth, Digestive Enzymes Activity, Gut Histology, and Expression of Gut Inflammatory and Transporter Genes, Aquaculture. (2018) 483, 173–182, 10.1016/j.aquaculture.2017.10.029. [DOI] [Google Scholar]

[bib-0012] 12. Ma Z., Hassan M. M., and Allais L., et al.Comparison of Partial Replacement of Fishmeal With Soybean Meal and Enzomeal on Growth Performance of Asian Seabass lates calcarifer , Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology. (2019) 216, 29–37, 10.1016/j.cbpc.2018.10.006. [DOI] [PubMed] [Google Scholar]

[bib-0013] 13. Liu Q., Wen B., Man D., Jiang Y., Li X., and Zuo R., Substitution of Fish Meal with Soybean Meal for Juvenile Chinese Mitten Crab (Eriocheir sinensis) Reared at Three Salinities: Effects on Survival, Growth, Antioxidant Capacity and Body Composition, Aquaculture Research. (2021) 52, no. 8, 3723–3735, 10.1111/are.15217. [DOI] [Google Scholar]

[bib-0014] 14. Liu T., Han T., and Wang J., et al.Effects of Replacing Fish Meal with Soybean Meal on Growth Performance, Feed Utilization and Physiological Status of Juvenile Redlip Mullet Liza Haematocheila, Aquaculture Reports. (2021) 20, 10.1016/j.aqrep.2021.100756, 100756. [DOI] [Google Scholar]

[bib-0015] 15. Zhang J., Zhong L., Chi S., Chu W., Liu Y., and Hu Y., Sodium Butyrate Supplementation in High-Soybean Meal Diets for Juvenile Rice Field Eel (monopterus albus): Effects on Growth, Immune Response and Intestinal Health, Aquaculture. (2020) 520, 10.1016/j.aquaculture.2020.734952, 734952. [DOI] [Google Scholar]

[bib-0016] 16. Liu Y., Chen Z., and Dai J., et al.The Protective Role of Glutamine on Enteropathy Induced by High Dose of Soybean Meal in Turbot, Scophthalmus maximus l, Aquaculture. (2018) 497, 510–519, 10.1016/j.aquaculture.2018.08.021. [DOI] [Google Scholar]

[bib-0017] 17. Magalhães R., Lopes T., and Martins N., et al.Carbohydrases Supplementation Increased Nutrient Utilization in White Seabream (diplodus sargus) Juveniles Fed High Soybean Meal Diets, Aquaculture. (2016) 463, 43–50, 10.1016/j.aquaculture.2016.05.019. [DOI] [Google Scholar]

[bib-0018] 18. Wu Y., Ma H., Wang X., and Ren X., Taurine Supplementation Increases the Potential of Fishmeal Replacement by Soybean Meal in Diets for Largemouth Bassmicropterus salmoides , Aquaculture Nutrition. (2021) 27, no. 3, 691–699, 10.1111/anu.13215. [DOI] [Google Scholar]

[bib-0019] 19. Fuentes Quesada J. P., Cornejo Granados F., and Mata Sotres J. A., et al.Prebiotic Agavin in Juvenile Totoaba, Totoaba macdonaldi Diets, to Relieve Soybean Meal-Induced Enteritis: Growth Performance, Gut Histology and Microbiota, Aquaculture Nutrition. (2020) 26, no. 6, 2115–2134, 10.1111/anu.13151. [DOI] [Google Scholar]

[bib-0020] 20. Asaduzzaman M., Rahman M. M., and Azim M. E., et al.Effects of c/n Ratio and Substrate Addition on Natural Food Communities in Freshwater Prawn Monoculture Ponds, Aquaculture. (2010) 306, no. 1–4, 127–136, 10.1016/j.aquaculture.2010.05.035. [DOI] [Google Scholar]

[bib-0021] 21. Ray A. J., Seaborn G., Leffler J. W., Wilde S. B., Lawson A., and Browdy C. L., Characterization of Microbial Communities in Minimal-Exchange, Intensive Aquaculture Systems and the Effects of Suspended Solids Management, Aquaculture. (2010) 310, no. 1-2, 130–138, 10.1016/j.aquaculture.2010.10.019. [DOI] [Google Scholar]

[bib-0022] 22. De Schryver P., Crab R., Defoirdt T., Boon N., and Verstraete W., The Basics of Bio-Flocs Technology: The Added Value for Aquaculture, Aquaculture. (2008) 277, no. 3-4, 125–137, 10.1016/j.aquaculture.2008.02.019. [DOI] [Google Scholar]

[bib-0023] 23. Schrader K. K., Green B. W., and Perschbacher P. W., Development of Phytoplankton Communities and Common Off-Flavors in a Biofloc Technology System Used for the Culture of Channel Catfish (ictalurus Punctatus), Aquacultural Engineering. (2011) 45, no. 3, 118–126, 10.1016/j.aquaeng.2011.08.004. [DOI] [Google Scholar]

[bib-0024] 24. Bakhshi F., Najdegerami E. H., Manaffar R., Tukmechi A., and Farah K. R., Use of Different Carbon Sources for the Biofloc System During the Grow-Out Culture of Common Carp (cyprinus carpio l.) Fingerlings, Aquaculture. (2018) 484, 259–267, 10.1016/j.aquaculture.2017.11.036. [DOI] [Google Scholar]

[bib-0025] 25. Putra I., Rusliadi R., Fauzi M., Tang U. M., and Muchlisin Z. A., Growth Performance and Feed Utilization of african Catfish clarias gariepinus Fed a Commercial Diet and Reared in the Biofloc System Enhanced with Probiotic [version 1;, 2017, Peer review: 2 approved]. F1000 Research 6, 1545. [DOI] [PMC free article] [PubMed]

[bib-0026] 26. Ekasari J., Rivandi D. R., and Firdausi A. P., et al.Biofloc Technology Positively Affects Nile Tilapia (Oreochromis niloticus) Larvae Performance, Aquaculture. (2015) 441, 72–77, 10.1016/j.aquaculture.2015.02.019. [DOI] [Google Scholar]

[bib-0027] 27. Poli M. A., Schveitzer R., and de Oliveira Nuñer A. P., The use of Biofloc Technology in a South american Catfish (rhamdia quelen) Hatchery: Effect of Suspended Solids in the Performance of Larvae, Aquacultural Engineering. (2015) 66, 17–21, 10.1016/j.aquaeng.2015.01.004. [DOI] [Google Scholar]

[bib-0028] 28. Li L., Yang Z., and Qu Z., et al.Alleviative Effect of Biofloc Technology (bft) on Extruded Soybean Meal (esbm)-Induced Growth Inhibition and Intestinal Barrier Dysfunction in Rhynchocypris lagowskii , Aquaculture. (2022) 561, 10.1016/j.aquaculture.2022.738677, 738677. [DOI] [Google Scholar]

[bib-0029] 29. Yu Z., Huang Z-Qi, Du H-Lin, Li H-Jin, and Wu L-Fang, Influence of Differential Protein Levels of Feed on Growth, Copper-Induced Immune Response and Oxidative Stress Ofrhynchocypris Lagowski in a Biofloc-Based System, Aquaculture Nutrition. (2020) 26, no. 6, 2211–2224, 10.1111/anu.13158. [DOI] [Google Scholar]

[bib-0030] 30. Zhu R., Wu X., and Zhao X., et al.Taurine Can Improve Intestinal Function and Integrity in Juvenile rhynchocypris lagowskii Dybowski Fed High-Dose Glycinin, Fish & Shellfish Immunology. (2022) 129, 127–136, 10.1016/j.fsi.2022.08.063. [DOI] [PubMed] [Google Scholar]

[bib-0031] 31. Li L., Zhu R., Yu Z., Liu J., Qu Z., and Wu L., Effects of β-Conglycinin on Intestinal Structure and Intestinal Permeability Inrhynchocypris Lagowski Dybowski, Aquaculture Nutrition. (2021) 27, no. 6, 1946–1958, 10.1111/anu.13331. [DOI] [Google Scholar]

[bib-0032] 32. Livak K. J. and Schmittgen T. D., Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−94;94;CT Method, Methods. (2001) 25, no. 4, 402–408, 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

[bib-0033] 33. Chutia A., Xavier K. A. M., Shamna N., and Rani A. M. B., Application of Bioflocculating Agent in Inoculum Enhances Quality of Biofloc and Influences Growth, Feed Utilization and Stress Responses of Gift Tilapia Reared in-Situ, Aquaculture. (2022) 553, 10.1016/j.aquaculture.2022.738050, 738050. [DOI] [Google Scholar]

[bib-0034] 34. Hernández M. D., Martínez F. J., Jover M., and García García B., Effects of Partial Replacement of Fish Meal by Soybean Meal in Sharpsnout Seabream (Diplodus puntazzo) Diet, Aquaculture. (2007) 263, no. 1–4, 159–167, 10.1016/j.aquaculture.2006.07.040. [DOI] [Google Scholar]

[bib-0035] 35. Hossain S., Koshio S., and Ishikawa M., et al.Substitution of Dietary Fishmeal by Soybean Meal With Inosine Administration Influences Growth, Digestibility, Immunity, Stress Resistance and Gut Morphology of Juvenile Amberjack Seriola dumerili , Aquaculture. (2018) 488, 174–188, 10.1016/j.aquaculture.2018.01.037. [DOI] [Google Scholar]

[bib-0036] 36. Silva-Carrillo Y., Hernández C., Hardy R. W., González-Rodríguez B., and Castillo-Vargasmachuca S., The Effect of Substituting Fish Meal with Soybean Meal on Growth, Feed Efficiency, Body Composition and Blood Chemistry in Juvenile Spotted Rose Snapper lutjanus guttatus (steindachner, 1869), Aquaculture. (2012) 364-365, 180–185, 10.1016/j.aquaculture.2012.08.007. [DOI] [Google Scholar]

[bib-0037] 37. Lin S. and Luo L., Effects of Different Levels of Soybean Meal Inclusion in Replacement for Fish Meal on Growth, Digestive Enzymes and Transaminase Activities in Practical Diets for Juvenile Tilapia, oreochromis niloticus×o.aureus, Animal Feed Science and Technology. (2011) 168, no. 1-2, 80–87, 10.1016/j.anifeedsci.2011.03.012. [DOI] [Google Scholar]

[bib-0038] 38. Wang G., Yu E., and Xie J., et al.Effect of c/n Ratio on Water Quality in Zero-Water Exchange Tanks and the Biofloc Supplementation in Feed on the Growth Performance of Crucian Carp, carassius auratus , Aquaculture. (2015) 443, 98–104, 10.1016/j.aquaculture.2015.03.015. [DOI] [Google Scholar]

[bib-0039] 39. Zhao Z., Xu Q., Luo L., Wang C., Li J., and Wang L., Effect of Feed c/n Ratio Promoted Bioflocs on Water Quality and Production Performance of Bottom and Filter Feeder Carp in Minimum-Water Exchanged Pond Polyculture System, Aquaculture. (2014) 434, 442–448, 10.1016/j.aquaculture.2014.09.006. [DOI] [Google Scholar]

[bib-0040] 40. Friesen E. N., Higgs D. A., and Devlin R. H., Flesh Nutritional Content of Growth Hormone Transgenic and Non-Transgenic Coho Salmon Compared to Various Species of Farmed and Wild Salmon, Aquaculture. (2015) 437, 318–326, 10.1016/j.aquaculture.2014.11.035. [DOI] [Google Scholar]

[bib-0041] 41. Lin J., Zhang C., Lu K., Song K., and Wang L., Effect of Guanidinoacetic Acid and Betaine Supplementation in Soybean Meal-Based Diets on Growth Performance, Muscle Energy Metabolism and Methionine Utilization in the Bullfrog Lithobates Catesbeianus, Aquaculture. (2021) 533, 10.1016/j.aquaculture.2020.736167, 736167. [DOI] [Google Scholar]

[bib-0042] 42. Elangovan A. and Shim K. F., The Influence of Replacing Fish Meal Partially in the Diet With Soybean Meal on Growth and Body Composition of Juvenile Tin Foil Barb (barbodes Altus), Aquaculture. (2000) 189, no. 1-2, 133–144, 10.1016/S0044-8486(00)00365-3. [DOI] [Google Scholar]

[bib-0043] 43. Ridha M. T., Hossain M. A., Azad I. S., and Saburova M., Effects of Three Carbohydrate Sources on Water Quality, Water Consumption, Bacterial Count, Growth and Muscle Quality of Nile Tilapia (oreochromis niloticus) in a Biofloc System, Aquaculture Research. (2020) 51, no. 10, 4225–4237, 10.1111/are.14764. [DOI] [Google Scholar]

[bib-0044] 44. Li X., Liu S., and Fan K., et al.Effects of Illumination Intensities on Growth, Digestive and Metabolic Enzyme Activities and Antioxidant Capacities of Juvenile Takifugu Rubripes, Aquaculture. (2022) 548, 10.1016/j.aquaculture.2021.737594, 737594. [DOI] [Google Scholar]

[bib-0045] 45. Ning L., Zhang X., Zhang D., Hu Y., and Li Y., The Benefits of Blend Essential Oil for Gift Tilapia on the Digestion, Antioxidant, and Muscle Quality During Cold Storage, Aquaculture. (2021) 533, 10.1016/j.aquaculture.2020.736097, 736097. [DOI] [Google Scholar]

[bib-0046] 46. Arriaga-Hernández D., Hernández C., and Martínez-Montaño E., et al.Fish Meal Replacement by Soybean Products in Aquaculture Feeds for White Snook, Centropomus Viridis: Effect on Growth, Diet Digestibility, and Digestive Capacity, Aquaculture. (2021) 530, 10.1016/j.aquaculture.2020.735823, 735823. [DOI] [Google Scholar]

[bib-0047] 47. Lin S. and Luo L., Effects of Different Levels of Soybean Meal Inclusion in Replacement for Fish Meal on Growth, Digestive Enzymes and Transaminase Activities in Practical Diets for Juvenile Tilapia, oreochromis niloticus×o, Animal Feed Science and Technology. (2011) 168, no. 1-2, 80–87. [Google Scholar]

[bib-0048] 48. Murashita K., Matsunari H., Furuita H., Rønnestad I., Oku H., and Yamamoto T., Effects of Dietary Soybean Meal on the Digestive Physiology of Red Seabream Pagrus Major, Aquaculture. (2018) 493, 219–228, 10.1016/j.aquaculture.2018.05.005. [DOI] [Google Scholar]

[bib-0049] 49. Liu H., Jin J., Zhu X., Han D., Yang Y., and Xie S., Effect of Substitution of Dietary Fish Meal by Soybean Meal on Different Sizes of Gibel Carp (Carassius auratus Gibelio): Digestive Enzyme Gene Expressions and Activities, and Intestinal and Hepatic Histology, Aquaculture Nutrition. (2017) 23, no. 1, 129–147, 10.1111/anu.12375. [DOI] [Google Scholar]

[bib-0050] 50. Xu Q. Y., Wang C. A., Zhao Z. G., and Luo L., Effects of Replacement of Fish Meal by Soy Protein Isolate on the Growth, Digestive Enzyme Activity and Serum Biochemical Parameters for Juvenile Amur Sturgeon (acipenser schrenckii), Asian-Australasian Journal of Animal Sciences. (2012) 25, no. 11, 1588–1594, 10.5713/ajas.2012.12192. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0051] 51. Yu X., Wu Z., and Guo J., et al.Replacement of Dietary Fish Meal by Soybean Meal on Growth Performance, Immunity, Anti-Oxidative Capacity and Mtor Pathways in Juvenile Abalone haliotis discus Hannai Ino, Aquaculture. (2022) 551, 10.1016/j.aquaculture.2022.737914, 737914. [DOI] [Google Scholar]

[bib-0052] 52. Amriawati E., Budiardi T., Setiawati M., Rohmana D., and Ekasari J., Digestive System and Growth Performance of Giant Gourami (osphronemus Goramy Lacepede) Juveniles in Biofloc Systems Fed With Different Feed Types, Aquaculture Research. (2021) 52, no. 10, 4661–4669, 10.1111/are.15300. [DOI] [Google Scholar]

[bib-0053] 53. Xu C., Liu W., and Zhang D., et al.Effects of Partial Fish Meal Replacement with Two Fermented Soybean Meals on the Growth of and Protein Metabolism in the Chinese Mitten Crab (eriocheir Sinensis), Aquaculture Reports. (2020) 17, 10.1016/j.aqrep.2020.100328, 100328. [DOI] [Google Scholar]

[bib-0054] 54. Yu Z., Li L., Zhu R., Li M., Duan J., Wang J.-Y., Liu Y.-H., and Wu L.-F., Monitoring of Growth, Digestive Enzyme Activity, Immune Response and Water Quality Parameters of Golden Crucian Carp (carassius auratus) in Zero-Water Exchange Tanks of Biofloc Systems, Aquaculture Reports. (2020) 16, 10.1016/j.aqrep.2020.100283, 100283. [DOI] [Google Scholar]

[bib-0055] 55. Novriadi R., Salze G., Abebe A., Hanson T., and Davis D. A., Partial or Total Replacement of Fish Meal in the Diets of Florida Pompanotrachinotus carolinus , Aquaculture Research. (2019) 50, no. 5, 1527–1538, 10.1111/are.14029. [DOI] [Google Scholar]

[bib-0056] 56. Ye H., Xu M., and Liu Q., et al.Effects of Replacing Fish Meal with Soybean Meal on Growth Performance, Feed Utilization and Physiological Status of Juvenile Obscure Puffer, Takifugu Obscurus, Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology. (2019) 216, 75–81, 10.1016/j.cbpc.2018.11.006. [DOI] [PubMed] [Google Scholar]

[bib-0057] 57. Li Y., Ai Q., Mai K., Xu W., Deng J., and Cheng Z., Comparison of High-Protein Soybean Meal and Commercial Soybean Meal Partly Replacing Fish Meal on the Activities of Digestive Enzymes and Aminotransferases in Juvenile japanese Seabass,lateolabrax japonicus (Cuvier, 1828), Aquaculture Research. (2014) 45, no. 6, 1051–1060, 10.1111/are.12042. [DOI] [Google Scholar]

[bib-0058] 58. Yu Z., Li L., Zhu R., Li M., and Wu L. F., Effects of Bioflocs with Different c/n Ratios on Growth, Immunological Parameters, Antioxidants and Culture Water Quality inopsariichthys kaopingensis Dybowski, Aquaculture Research. (2019) 51, no. 2, 805–815, 10.1111/are.14430. [DOI] [Google Scholar]

[bib-0059] 59. Meng F., Li B., Xie Y., Li M., and Wang R., Substituting Fishmeal with Extruded Soybean Meal in Diets Did Not Affect the Growth Performance, Hepatic Enzyme Activities, but Hypoxia Tolerance of Dolly Varden (salvelinus malma) Juveniles, Aquaculture Research. (2019) 51, no. 1, 379–388, 10.1111/are.14385. [DOI] [Google Scholar]

[bib-0060] 60. Gómez-Requeni P., Mingarro M., and Calduch-Giner J. A., et al.Protein Growth Performance, Amino Acid Utilisation and Somatotropic Axis Responsiveness to Fish Meal Replacement by Plant Protein Sources in Gilthead Sea Bream (Sparus aurata), Aquaculture. (2004) 232, no. 1–4, 493–510, 10.1016/S0044-8486(03)00532-5. [DOI] [Google Scholar]

[bib-0061] 61. Shao J., Liu M., Wang B., Jiang K., Wang M., and Wang L., Evaluation of Biofloc Meal as an Ingredient in Diets for White Shrimp Litopenaeus Vannamei under Practical Conditions: Effect on Growth Performance, Digestive Enzymes and Tor Signaling Pathway, Aquaculture. (2017) 479, 516–521, 10.1016/j.aquaculture.2017.06.034. [DOI] [Google Scholar]

[bib-0062] 62. Neuls L., Souza V. J. D., and Romão S., et al.Immunomodulatory Effects of Yarrowia Lipolytica as a Food Additive in the Diet of Nile Tilapia, Fish & Shellfish Immunology. (2021) 119, 272–279, 10.1016/j.fsi.2021.10.011. [DOI] [PubMed] [Google Scholar]

[bib-0063] 63. Zhu M., Zhang Y., and Pan J., et al.Grass Carp Reovirus Triggers Autophagy Enhancing Virus Replication via the Akt/Mtor Pathway, Fish Shellfish Immunol. (2022) 128, 148–156, 10.1016/j.fsi.2022.07.069. [DOI] [PubMed] [Google Scholar]

[bib-0064] 64. Xie S.-W., Liu Y.-J., Zeng S., Niu J., and Tian L.-X., Partial Replacement of Fish-Meal by Soy Protein Concentrate and Soybean Meal Based Protein Blend for Juvenile Pacific White Shrimp, Litopenaeus Vannamei, Aquaculture. (2016) 464, 296–302, 10.1016/j.aquaculture.2016.07.002. [DOI] [Google Scholar]

[bib-0065] 65. Ding Z., Zhang Y., Ye J., Du Z., and Kong Y., An Evaluation of Replacing Fish Meal with Fermented Soybean Meal in the Diet of Macrobrachium Nipponense: Growth, Nonspecific Immunity, and Resistance to Aeromonas, Fish & Shellfish Immunology. (2015) 44, no. 1, 295–301, 10.1016/j.fsi.2015.02.024. [DOI] [PubMed] [Google Scholar]

[bib-0066] 66. Defoirdt T., Boon N., Sorgeloos P., Verstraete W., and Bossier P., Alternatives to Antibiotics to Control Bacterial Infections: Luminescent Vibriosis in Aquaculture as an Example, Trends in Biotechnology. (2007) 25, no. 10, 472–479, 10.1016/j.tibtech.2007.08.001. [DOI] [PubMed] [Google Scholar]

[bib-0067] 67. Sahlmann C., Sutherland B. J. G., Kortner T. M., Koop B. F., Krogdahl Å., and Bakke A. M., Early Response of Gene Expression in the Distal Intestine of Atlantic Salmon (salmo Salar l.) During the Development of Soybean Meal Induced Enteritis, Fish & Shellfish Immunology. (2013) 34, no. 2, 599–609, 10.1016/j.fsi.2012.11.031. [DOI] [PubMed] [Google Scholar]

[bib-0068] 68. Miao S., Zhao C., Zhu J., Hu J., Dong X., and Sun L., Dietary Soybean Meal Affects Intestinal Homoeostasis by Altering the Microbiota, Morphology and Inflammatory Cytokine Gene Expression in Northern Snakehead, Scientific Reports. (2018) 8, no. 1, 10.1038/s41598-017-18430-7, 113. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0069] 69. Men K., Ai Q., Mai K., Xu W., Zhang Y., and Zhou H., Effects of Dietary Corn Gluten Meal on Growth, Digestion and Protein Metabolism in Relation to Igf-i Gene Expression of japanese Seabass, lateolabrax japonicus , Aquaculture. (2014) 428-429, 303–309, 10.1016/j.aquaculture.2014.03.028. [DOI] [Google Scholar]

[bib-0070] 70. Xu W., Xu Y., and Su H., et al.Effects of Feeding Frequency on Growth, Feed Utilization, Digestive Enzyme Activity and Body Composition of Litopenaeus Vannamei in Biofloc-Based Zero-Exchange Intensive Systems, Aquaculture. (2020) 522, 10.1016/j.aquaculture.2020.735079, 735079. [DOI] [Google Scholar]

[bib-0071] 71. West X. Z., Malinin N. L., and Merkulova A. A., et al.Oxidative Stress Induces Angiogenesis by Activating tlr2 With Novel Endogenous Ligands, Nature. (2010) 467, no. 7318, 972–976, 10.1038/nature09421. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0072] 72. Bai S. C. and Lee K.-J., Different Levels of Dietary Dl- α-Tocopheryl Acetate Affect the Vitamin e Status of Juvenile korean Rockfish, Sebastes Schlegeli, Aquaculture. (1998) 161, no. 1–4, 405–414, 10.1016/S0044-8486(97)00288-3. [DOI] [Google Scholar]

[bib-0073] 73. Song X., Ye H., and Jin F., et al.Effects of Fermented Soybean Meal and Guanosine 5^′-Monophosphate on Growth, Intestinal Health and Anti-Stress Capability of Penaeus Vannamei in Low Fish Meal Diet, Aquaculture. (2022) 548, 10.1016/j.aquaculture.2021.737591, 737591. [DOI] [Google Scholar]

[bib-0074] 74. Dong G. F., Yang Y. O., and Song X. M., et al.Comparative Effects of Dietary Supplementation with Maggot Meal and Soybean Meal in Gibel Carp (Carassius auratus Gibelio) and Darkbarbel Catfish (pelteobagrus Vachelli): Growth Performance and Antioxidant Responses, Aquaculture Nutrition. (2013) 19, no. 4, 543–554, 10.1111/anu.12006. [DOI] [Google Scholar]

[bib-0075] 75. Zhao P., Huang J., and Wang X., et al.The Application of Bioflocs Technology in High-Intensive, Zero Exchange Farming Systems of Marsupenaeus Japonicus, Aquaculture. (2012) 354-355, 97–106, 10.1016/j.aquaculture.2012.03.034. [DOI] [Google Scholar]

[bib-0076] 76. Wang Y., Wang D., and Yin K., et al.Lycopene Attenuates Oxidative Stress, Inflammation, and Apoptosis by Modulating nrf2/Nf-κb Balance in Sulfamethoxazole-Induced Neurotoxicity in Grass Carp (ctenopharyngodon Idella), Fish Shellfish Immunol. (2022) 121, 322–331, 10.1016/j.fsi.2022.01.012. [DOI] [PubMed] [Google Scholar]

[bib-0077] 77. Wang X. J., Li Y., and Luo L., et al.Oxaliplatin Activates the keap1/nrf2 Antioxidant System Conferring Protection Against the Cytotoxicity of Anticancer Drugs, Free Radical Biology & Medicine. (2014) 70, 68–77, 10.1016/j.freeradbiomed.2014.02.010. [DOI] [PubMed] [Google Scholar]

[bib-0078] 78. Pervin M. A., Jahan H., Akter R., Omri A., and Hossain Z., Appraisal of Different Levels of Soybean Meal in Diets on Growth, Digestive Enzyme Activity, Antioxidation, and Gut Histology of Tilapia (Oreochromis niloticus), Fish Physiology and Biochemistry. (2020) 46, no. 4, 1397–1407, 10.1007/s10695-020-00798-5. [DOI] [PubMed] [Google Scholar]

[bib-0079] 79. Li L., Zhu R., and Li M., et al.Effects of β-Conglycinin on Growth Performance, Antioxidant Capacity and Immunity Inrhynchocypris Lagowski Dybowski, Aquaculture Nutrition. (2020) 26, no. 6, 2059–2073, 10.1111/anu.13147. [DOI] [Google Scholar]

[bib-0080] 80. He Y., Liang J., and Dong X., et al.Soybean β-Conglycinin and Glycinin Reduced Growth Performance and the Intestinal Immune Defense and Altered Microbiome in Juvenile Pearl Gentian Groupers Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂, Animal Nutrition. (2022) 9, 193–203, 10.1016/j.aninu.2021.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0081] 81. Yu Z., Zhao Y.-Y., Jiang N., Zhang A.-Z., and Li M.-Y., Bioflocs Attenuates Lipopolysaccharide-Induced Inflammation, Immunosuppression and Oxidative Stress in channa argus , Fish & Shellfish Immunology. (2021) 114, 218–228, 10.1016/j.fsi.2021.05.006. [DOI] [PubMed] [Google Scholar]

[bib-0082] 82. Tong R., Chen W., Pan L., and Zhang K., Effects of Feeding Level and c/n Ratio on Water Quality, Growth Performance, Immune and Antioxidant Status of Litopenaeus Vannamei in Zero –water Exchange Bioflocs-Based Outdoor Soil Culture Ponds, Fish & Shellfish Immunology. (2020) 101, 126–134, 10.1016/j.fsi.2020.03.051. [DOI] [PubMed] [Google Scholar]

[bib-0083] 83. Liu X., Han B., and Xu J., et al.Replacement of Fishmeal with Soybean Meal Affects the Growth Performance, Digestive Enzymes, Intestinal Microbiota and Immunity of Carassius auratus Gibelio♀ × Cyprinus carpio , Aquaculture Reports. (2020) 18, 10.1016/j.aqrep.2020.100472, 100472. [DOI] [Google Scholar]

[bib-0084] 84. Zhao X., Wang Y., Wang X., and Ye J., Growth Performance, Plasma Components, and Intestinal Barrier in Grouper (epinephelus coioides) Are Altered by Dietary Fish Meal Replacement with Extruded Soybean Meal, Aquaculture Reports. (2021) 21, 10.1016/j.aqrep.2021.100863, 100863. [DOI] [Google Scholar]

[bib-0085] 85. Azimi A., Shekarabi S. P. H., and Paknejad H., et al.Various Carbon/Nitrogen Ratios in a Biofloc-Based Rearing System of Common Carp (cyprinus carpio) Fingerlings: Effect on Growth Performance, Immune Response, and Serum Biochemistry, Aquaculture. (2022) 548, 10.1016/j.aquaculture.2021.737622, 737622. [DOI] [Google Scholar]

[bib-0086] 86. Wu P., Liu Y., and Jiang W., et al.Intestinal Immune Responses of Jian Carp against Aeromonas Hydrophila Depressed by Choline Deficiency: Varied Change Patterns of Mrna Levels of Cytokines, Tight Junction Proteins and Related Signaling Molecules among Three Intestinal Segments, Fish & Shellfish Immunology. (2017) 65, 34–41, 10.1016/j.fsi.2017.03.053. [DOI] [PubMed] [Google Scholar]

[bib-0087] 87. Chen J., Ren Y., Li Y., and Xia B., Regulation of Growth, Intestinal Microbiota, Non-Specific Immune Response and Disease Resistance of Sea Cucumber Apostichopus Japonicus (selenka) in Biofloc Systems, Fish & Shellfish Immunology. (2018) 77, 175–186, 10.1016/j.fsi.2018.03.053. [DOI] [PubMed] [Google Scholar]

[bib-0088] 88. Tan P., Wu X., Zhu W., Lou B., Chen R., and Wang L., Effect of Tributyrin Supplementation in High-Soya Bean Meal Diet on Growth Performance, Body Composition, Intestine Morphology and Microbiota of Juvenile Yellow Drum (nibea albiflora), Aquaculture Research. (2020) 51, no. 5, 2004–2019, 10.1111/are.14552. [DOI] [Google Scholar]

[bib-0089] 89. Reveco F. E., Øverland M., Romarheim O. H., and Mydland L. T., Intestinal Bacterial Community Structure Differs between Healthy and Inflamed Intestines in Atlantic Salmon (salmo Salar l.), Aquaculture. (2014) 420-421, 262–269, 10.1016/j.aquaculture.2013.11.007. [DOI] [Google Scholar]

[bib-0090] 90. Desai A. R., Links M. G., and Collins S. A., et al.Effects of Plant-Based Diets on the Distal Gut Microbiome of Rainbow Trout (Oncorhynchus mykiss), Aquaculture. (2012) 350–353, 134–142, 10.1016/j.aquaculture.2012.04.005. [DOI] [Google Scholar]

[bib-0091] 91. Bruce T. J., Neiger R. D., and Brown M. L., Gut Histology, Immunology and the Intestinal Microbiota of Rainbow Trout,oncorhynchus mykiss (walbaum), Fed Process Variants of Soybean Mea, Aquaculture Research. (2018) 49, no. 1, 492–504, 10.1111/are.13480. [DOI] [Google Scholar]

PERMALINK

A Maximum 34% Substitution of Fish Meal by Soybean Meal Is Recommended for Rhynchocypris lagowskii Dybowski Cultured in Biofloc Systems: Evidence From Growth and Intestinal Barrier Function

Zhi-Yong Yang

Deng-Lai Li

Ke-xin Wang

Li-Fang Wu

Rui Zhu

Qiong Wu

Abstract

1. Introduction

2. Materials and Methods

2.1. Experimental Diets

Table 1.

2.2. Experimental Conditions

2.3. Fish Sampling

2.4. Sample Analysis

2.4.1. Calculations Analysis

2.4.2. Determination of Muscle Nutrient Composition

2.4.3. Determination of Levels of Enzymes

2.4.4. Determination of mRNA Expressions

Table 2.

2.5. Statistical Analysis

3. Results

3.1. Growth and Muscle Nutrient Composition

Table 3.

3.2. Muscle Nutrients

Table 4.

3.3. Digestive Enzyme Activities

Figure 1.

3.4. Protein Metabolism

Figure 2.

Figure 3.

3.5. Immune Function and Inflammation

Figure 4.

Figure 5.

3.6. Antioxidant Capacity

Figure 6.

Figure 7.

3.7. Intestinal Physical Barrier

Figure 8.

Table 5.

Table 6.

Figure 9.

3.8. Intestinal Microbiota

Figure 10.

Table 7.

Figure 11.

4. Discussion

5. Conclusion

Author Contributions

Funding

Disclosure

Conflicts of Interest

Supporting Information

Supporting information

Acknowledgments

Contributor Information

Data Availability Statement

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases