Enhanced miR-214 in Vascular Endothelial Cells Retards Renal Inflammation and Glomerular Sclerosis in Five-Sixths Nephrectomy Mice

Lingxiao Tan; Xinwen Fan; Xiaolu Zhang; Shanshan Li; Bingyu Yang; Yue Zhang; Songming Huang; Zhanjun Jia; Wei Gong; Aihua Zhang; Shuzhen Li

doi:10.1159/000552823

. 2026 May 30;12(1):600–621. doi: 10.1159/000552823

Enhanced miR-214 in Vascular Endothelial Cells Retards Renal Inflammation and Glomerular Sclerosis in Five-Sixths Nephrectomy Mice

Lingxiao Tan ^a,^b,^c, Xinwen Fan ^a,^b,^c, Xiaolu Zhang ^a,^b,^c,^d,^✉, Shanshan Li ^a,^b,^c,^✉, Bingyu Yang ^a,^b,^c, Yue Zhang ^a,^b,^c,^✉, Songming Huang ^a,^b,^c, Zhanjun Jia ^a,^b,^c, Wei Gong ^a,^b,^c,^✉, Aihua Zhang ^a,^b,^c,^e,^✉, Shuzhen Li ^a,^b,^c,^✉

PMCID: PMC13412255 PMID: 42524519

Abstract

Introduction

Vascular endothelial injury is a critical driver of renal dysfunction and glomerulosclerosis in chronic kidney disease (CKD). While endothelial damage-induced inflammation contributes to sclerosis, the underlying mechanisms remain unclear. Although miR-214 has been implicated in renal fibrosis, its role in vascular endothelial cells during glomerulosclerosis is undefined.

Methods

In this study, we investigated miR-214 expression and function in renal endothelial cells using five-sixths nephrectomy (5/6Nx) mice, endothelial-specific and smooth muscle-specific miR-214 knockout models, CD31-enriched primary renal endothelial cells, and mouse aortic endothelial cells. Transcriptome analysis, bioinformatic prediction, luciferase reporter assays, cytokine profiling, and pro-inflammatory stimulation experiments were performed to evaluate the regulatory relationship between miR-214 and RELA-associated inflammatory signaling.

Results

We observed significant miR-214 upregulation in renal endothelial cells of 5/6Nx mice. Endothelial-specific knockout of miR-214 aggravated glomerulosclerosis and endothelial dysfunction, whereas smooth muscle-specific knockout showed no significant effect. Transcriptome analysis revealed that miR-214 inhibition altered the NF-κB pathway, specifically upregulating RELA. Bioinformatic prediction and luciferase reporter assays supported a direct interaction between miR-214 and the RELA 3′-UTR in vitro. In CD31-enriched primary renal endothelial cells, modulation of miR-214 levels inversely regulated RELA expression. Cytokine profiling showed that miR-214 suppression enhanced pro-inflammatory secretion. Furthermore, pro-inflammatory stimulation experiments demonstrated that inhibition of miR-214 amplified RELA-associated endothelial inflammatory activation, while miR-214 overexpression attenuated it.

Conclusion

Collectively, these results suggest that endothelial miR-214 protects against glomerulosclerosis by restraining RELA-associated inflammatory signaling, highlighting endothelial-targeted modulation of miR-214 as a potential therapeutic strategy for CKD-related glomerular injury.

Keywords: miR-214, RELA, Glomerulosclerosis, Inflammation, Endothelial injury

Plain Language Summary

Chronic kidney disease is a long-term condition in which the kidneys gradually lose their ability to work properly. Damage to small blood vessels in the kidney can contribute to worsening kidney function and scarring. In this study, we examined the role of a small RNA molecule called microRNA-214, or miR-214, in kidney blood vessel cells. Small RNA molecules can help control how much of certain proteins are made in cells. Using a mouse model of chronic kidney disease, we found that miR-214 increased in kidney blood vessel cells after kidney injury. When miR-214 was removed specifically from these blood vessel cells, kidney damage became worse. The mice showed more kidney scarring, more inflammation, and greater injury to the filtering units of the kidney. In cell experiments, reducing miR-214 increased inflammatory signals, whereas increasing miR-214 reduced these signals. We further found that miR-214 was linked to RELA, a protein that helps switch on inflammation-related genes. These findings suggest that miR-214 in kidney blood vessel cells helps limit inflammation and protects against kidney scarring during chronic kidney disease. The study also shows that the effects of miR-214 may depend on the specific kidney cell type in which it acts.

Introduction

Chronic kidney disease (CKD), a progressive and irreversible condition driven by diverse etiologies, represents a major public health burden worldwide and can advance to end-stage renal disease [1, 2]. Epidemiological studies estimate that CKD affects approximately 9.1% of the global population, corresponding to about 697.5 million individuals, with China accounting for nearly one-fifth of these cases [3]. Identifying early intervention targets for CKD is therefore of great clinical importance. Vascular endothelial cells play a crucial role in CKD progression, particularly in glomerulosclerosis. Endothelial injury triggers the release of growth factors and inflammatory mediators that drive sclerotic changes [2, 4, 5], while increased vascular permeability further accelerates this process [6]. Consequently, therapeutic strategies targeting endothelial cells are expected to improve glomerulosclerosis in CKD [7, 8].

MicroRNAs (miRNAs) are short noncoding RNAs that regulate gene expression at the posttranscriptional level [9, 10]. Among them, miR-214 has emerged as a stress-responsive miRNA involved in various pathological processes. Although initially studied in oncology [11–13], miR-214 is also implicated in cardiac fibrosis [14–17], angiogenesis [18–20], myocardial damage [21–24], and kidney diseases. Upregulation of miR-214 has been observed across hypoxic renal tubular cells, animal models of CKD, and patient tissues [25–29]. It promotes epithelial-to-mesenchymal transition by targeting Twist and suppressing E-cadherin and drives fibrosis independently of TGF-β signaling [27, 30]. Our previous study demonstrated that conditional knockout of miR-214 in proximal tubules attenuates kidney injury by preserving mitochondrial function and reducing fibroblast activation [29], consistent with reports that pharmacological inhibition of miR-214 ameliorates renal fibrosis [30]. These studies confirm the important role of tubular miR-214 in CKD. However, given the tissue-specific nature of miRNA function, the role of vascular endothelial miR-214 in CKD remains to be elucidated.

Inflammation plays a critical role in glomerulosclerosis through an “injury-inflammation-fibrosis” cascade, in which activated endothelial cells recruit inflammatory cells and establish a pro-inflammatory microenvironment. This process promotes podocyte injury through cytokines such as TNF-α and interleukin-1β (IL-1β), while TGF-β stimulates extracellular matrix accumulation, ultimately leading to capillary occlusion and sclerosis [31–34]. Interestingly, miR-214 acts as a context-dependent inflammatory regulator, displaying anti-inflammatory effects in cardiovascular diseases but potentially promoting inflammation in renal diseases and autoimmune conditions [34–37]. This functional duality, along with its tissue-specific expression, underscores the need to clarify the role of vascular endothelial miR-214 in CKD, particularly its potential regulation of inflammatory pathways in glomerulosclerosis.

Here, we identified that miR-214 is upregulated in CD31-enriched primary renal endothelial cells following five-sixths nephrectomy (5/6Nx). Using a conditional knockout mouse model, we provided functional evidence that endothelial miR-214 exerts a protective effect by acting on RELA, thereby suppressing the downstream inflammatory cascade, mitigating glomerulosclerosis, and ultimately retarding renal fibrosis.

Methods

Animals

To generate tissue-specific miR-214 knockout mice, miR-214 floxed mice (miR-214^flox/flox) were crossed with either Tek-Cre or Transgelin-Cre recombinase (Tagln-Cre) driver lines. This breeding strategy produced endothelial cell-specific knockout mice (miR-214^flox/flox; Tek-Cre, referred to as miR-214-cKO) and smooth muscle cell-specific knockout mice (miR-214^flox/flox; Tagln-Cre), respectively, following the methods described in our previous study [29, 38]. All experimental animals were housed under specific pathogen-free conditions in the experimental animal barrier facility of Nanjing Medical University’s Experimental Animal Center. All mice had free access to food and water. The housing environment was maintained at 19–21°C with 50% humidity, and subjected to a 12-h light-dark cycle. All surgical procedures in the experiment were performed under inhalation anesthesia with isoflurane (induced at 3–5% and maintained at 1–3%; Shenzhen RWD Life Science Co., Ltd.) [39]. At the end of the experiment, the mice were euthanized via carbon dioxide (CO₂) inhalation using the slow displacement method (fill rate at 30–70% of the chamber volume per minute) followed by a confirmatory secondary method [40].

5/6Nx Animal Model

Male mice aged 8–10 weeks and weighing about 25–30 g were selected from both the experimental and control groups. Experimental group mice were anesthetized using isoflurane, and the superior and inferior poles of the left kidney were resected through an incision in the left flank. One week following this procedure, the entire right kidney was excised via an incision made in the right flank [41]. The blood pressure and 24-h urine protein levels were measured at 4, 8, and 12 weeks after 5/6Nx surgery, respectively. After 12 weeks of modeling, the mice were euthanized, and serum and kidney tissues were collected for subsequent measurement.

Histological Analysis

Kidney tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 4-µm thickness. Kidney tissue sections were subjected to periodic acid-Schiff (PAS), Masson’s trichrome, hematoxylin-eosin, immunofluorescence (IF), immunohistochemistry (IHC), and Sirius Red staining following established protocols [42–44]. A KFBIO KF-PRO-020 digital slide scanner (KFBIO, Ningbo, China) or an Olympus BX51 microscope (Olympus, Center Valley, PA, USA) was used to make morphological observations of hematoxylin-eosin-, PAS-, Masson’s trichrome-, IHC-, and Sirius Red-stained sections. A Leica STELLARIS 5 laser-scanning confocal microscope (Leica Microsystems CMS GmbH, Wetzlar, Germany) was used to identify the signals from IF staining. For each kidney tissue sample, at least five fields of view under ×400 magnification were examined microscopically, and the intensity of immunostaining was quantified using ImageJ software.

Fibrosis severity was assessed employing a modified scoring system ranging from grade 0 to 5, with the grading criteria defined as follows: grade 0: no fibrosis; grade 1: fibrosis affecting 5–10% of the tissue area; grade 2: fibrosis involving 10–25% of the area; grade 3, fibrosis covering 25–50% of the area; grade 4, fibrosis occupying 50–75% of the area; grade 5, fibrosis encompassing 75–100% of the area [45].

A semi-quantitative glomerulosclerosis score ranging from 0 to 4 (0: no sclerosis; 1: sclerosis of <25% of glomeruli; 2: sclerosis from 25% to 50% of glomeruli; 3: sclerosis from 50% to 75% of glomeruli; and 4: sclerosis of >75% of glomeruli on PAS-stained sections) was employed to assess glomerulosclerosis severity. A semi-quantitative tubulointerstitial lesion score ranging from 0 to 4 (0: no change; 1: <25% of areas injured; 2: 25%–50% of areas injured; 3: 50%–75% of areas injured; and 4: >75% of areas injured) was used to assess tubulointerstitial injury on PAS-stained sections [46]. A semi-quantitative score ranging from 0 to 3 was used to grade capillary narrowing or disruption in glomeruli on PAS-stained sections (0: none; 1: mild, <25% of glomeruli affected; 2: moderate, 25–50% of glomeruli involved; and 3: severe, >50% of glomeruli involved) [47].

Noninvasive Blood Pressure Analysis

Without anesthesia, mice were secured on a heated platform at 37°C using a magnetic holder. Blood pressure was measured using the BP-2000 blood pressure measurement system (Visitech, USA). Mice were placed in the holder with their tails passing through a sleeve, and a rubber cuff was affixed to the base of the tail and secured with tape. Mice were acclimated on the platform for 5 min to stabilize blood pressure before measurement. Measurements were taken continuously over 3 days, with the average value used as the final result.

Urine Collection and Analysis

Mice were placed in clean metabolic cages with free access to water and food. Urine was collected over 24 h into Eppendorf (EP) tubes. The collected urine was centrifuged at 3,000 rpm for 10 min, and the supernatant was transferred to new EP tubes. Urine microalbumin was measured using an ELISA kit (Bethyl, USA, E99-134).

RNA Extraction and Quantitative Reverse Transcription Polymerase Chain Reaction

Trizol reagent (Takara, Japan, 9109) was used to extract total RNA from kidney tissues and cells. cDNA was synthesized using PrimeScript RT Master Mix (Takara, Japan, RR036A). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was conducted with AceQ qPCR SYBR Green Master Mix (Vazyme, China, Q131-02) to quantify mRNA expression levels under the following conditions: pre-denaturation at 95°C for 10 min, followed by 40 cycles consisting of 95°C for 15 s, 60°C for 1 min, 95°C for 10 s, 65°C for 1 min, 97°C for 1 s, and 37°C for 30 s. The relative expression of the target gene mRNA was normalized to the housekeeping gene and calculated using the ΔΔCt method. Primers were designed using Primer 5.0 software (available at https://www.premierbiosoft.com/primerdesign/), and all primer sequences are presented in Table 1.

Table 1.

Primer sequences for quantitative real-time PCR (qRT-PCR) (mouse-derived)

Gene name	Primer sequence (5′→3′)
GAPDH	F: AGGTCGGTGTGAACGGATTTG
GAPDH	R: TGTAGACCATGTAGTTGAGGTCA
miR-214	F: GATTCATGGTCTCACCCTGCTTG
miR-214	R: CAAGACCTCTGCATCTCTTAATAGTG
IL-6	F: GCTTAGGCATAACGCACT
IL-6	R: GGAAATCGTGGAAATGAG
IL-1β	F: GCAACTGTTCCTGAACTCAACT
IL-1β	R: ATCTTTTGGGGTCCGTCAACT
18s	F: CGTTGATTAAGTCCCTGCCCTT
18s	R: TCAAGTTCGACCGTCTTCTCAG
U6	F: CTCGCTTCGGCAGCACA
U6	R: AACGCTTCACGAATTTGCCT
CD31	F: ATCATTTCTAGCGCATGGCCTGGT
CD31	R: ATTTGTGGAGGGCGAGGTCATAGA
ZO-1	F: GCGCGGAGAGAGACAAGA
ZO-1	R: CTGGCCCTCCTTTTAACACA
RELA	F: TCCTGTTCGAGTCTCCATGCAG
RELA	R: GGTCTCATAGGTCCTTTTGCGC

Open in a new tab

Western Blot Analysis

Target cells and renal tissue samples underwent lysis in RIPA buffer (Beyotime Biotechnology, China, P0013K) supplemented with a protease inhibitor cocktail (Roche, Switzerland, 0469313200). Protein concentration was detected by the BCA protein assay kit (Beyotime Biotechnology, China, P0012). Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis based on molecular weight and transferred to polyvinylidene fluoride membranes. After blocking the membranes with 5% nonfat milk, the membranes were incubated with primary and secondary antibodies (Table 2). Image Lab Software (Bio-Rad, USA) was used to identify, visualize, and quantitatively evaluate protein bands.

Table 2.

Antibody information for Western blot analysis

Reagent name (antibody)	Supplier (company, country)
Fibronectin polyclonal antibody	Abcam, USA
GAPDH monoclonal antibody	Proteintech, China
Collagen I polyclonal antibody	Biosynthesis Biotechnology, China
Nephrin antibody	Proteintech, China
BAX antibody	Biosynthesis Biotechnology, China
Cleaved caspase-3 antibody	Proteintech, China
CD31 antibody	Cell Signaling Technology (CST), USA
P65 antibody	Cell Signaling Technology (CST), USA
p-P65 antibody	Cell Signaling Technology (CST), USA
ICAM1 antibody	Abclonal, China
VCAM1 antibody	Abclonal, China
ZO-1 antibody	Abclonal, China

Open in a new tab

Cell Culture and Transfection

We purchased mouse aortic endothelial cells (MAECs) from Jennio Biotech Co., Ltd. in Guangdong, China. MAECs were cultivated at 37°C in a 5% CO₂ incubator using DMEM medium (Gibco, USA) supplemented with 10% FBS (PAN, Germany). Short tandem repeat analysis was used to identify the cell lines. As directed by the manufacturer, MAECs were transfected with miRNA negative controls, inhibitors, or mimics using Lipofectamine 2000 (Thermo Fisher Scientific, USA, 11668019). To mimic the inflammatory microenvironment, cells in the stimulation group were treated for 12 h with a cytokine cocktail containing interferon-γ, TNF-α, interferon-α, and IL-1β, each at a final concentration of 10 ng/mL. After transfection and, where applicable, cytokine stimulation, cell-culture supernatants, total RNA, and total protein were collected for ELISA, qRT-PCR, and Western blot analyses.

Isolation of Primary Mouse Renal Endothelial Cells

Mice were euthanized via cervical dislocation, and subsequent sterilization was performed by immersion in 75% ethanol for 5 min. Kidneys were then excised and rinsed twice with prechilled PBS supplemented with 1% antibiotics. The kidneys were longitudinally sectioned, and the medulla was removed. The renal cortex was minced into 1- to 3-mm fragments and transferred into EP tubes containing 1 mg/mL of collagenase II (supplemented with DNase I; Solarbio, China, C8150) and 1.2 U/mL of dispase II (Roche, Switzerland, 65558200). The tissue fragments were subjected to digestion at 37°C on a shaker for 1.5 h. The digested tissue suspension was centrifuged for 2 min at 1,000 rpm after being filtered through a 40-μm cell strainer. After discarding the supernatant, 3–5 mL of lysis buffer (Beyotime, China, C3702) was used to lyse the red blood cells. Following lysis and centrifugation, primary renal endothelial cells were enriched using CD31-conjugated MicroBeads (Miltenyi Biotec, Germany, 130-097-418) in compliance with the manufacturer’s instructions, yielding a CD31-enriched primary renal endothelial population. For experiments using CD31-enriched primary mouse renal vascular endothelial cells (mRVECs), each biological replicate was generated by pooling renal endothelial cells from 2 mice because of the low cell yield. To assess endothelial enrichment, total RNA was extracted from both the endothelial and residual fractions, and CD31 mRNA expression was measured by qPCR. Relative expression was calculated using the 2^(−ΔΔCt) method.

Transmission Electron Microscopy

Kidney tissues harvested from mice were initially immersed and fixed in electron microscopy fixative (Servicebio, China, G1124). Subsequently, the tissues were fixed again in a solution of 1% osmium tetroxide (OsO4) with 0.1 mol/L phosphate buffer. Ultrathin sections (around 60 nm in thickness) were prepared by cutting with an ultramicrotome and mounted on copper grids. The prepared sections were subsequently stained with uranyl acetate and lead citrate, and observed under an electron microscope (JEOL JEM-1010, Tokyo, Japan) following the previously reported protocol [48].

Terminal Deoxynucleotidyl Transferase Staining

The terminal deoxynucleotidyl transferase (TUNEL) BrightGreen Apoptosis Detection Kit (Vazyme, China, A112) was applied to perform TUNEL staining on paraffin sections of kidney tissues according to the manufacturer’s instructions. The Leica STELLARIS 5 laser scanning confocal microscope (Leica Microsystems CMS GmbH, Wetzlar, Germany) was employed for the detection of fluorescence signals. Five random visual fields of samples were assessed, and the number of apoptotic cells was counted.

Dual-Luciferase Reporter Assay

MAECs were seeded in 24-well plates (5 × 10⁴–1 × 10⁵ cells/well) and transfected at 70–80% confluence using Lipofectamine 2000 (Thermo Fisher Scientific, USA, 11668019). Each well was transfected with a reporter plasmid (Rela-wild-type [WT]-pmirGLO or Rela-MUT-pmirGLO, Nanjing Qifan Biotechnology Co., Ltd.), miR-214 mimic or miR-214 negative control. MAECs were lysed after 24 h of transfection. Firefly and Renilla luciferase activities were measured sequentially using the Dual-Luciferase^® Assay System (Promega, E1960) on a Promega GloMax 96 Microplate Luminometer (Promega, Madison, WI, USA). Relative luciferase activity was calculated as the firefly/Renilla luminescence ratio.

RNA-Sequencing Transcriptome Analysis

RNA-sequencing (RNA-seq)-based transcriptome analysis was conducted in accordance with previously published protocols [49]. Raw RNA-seq datasets were submitted to the Sequence Read Archive database (https://www.ncbi.nlm.nih.gov/sra/) under the accession number PRJNA1355189 [50].

Inflammation Array

The supernatant of MAECs transfected with miR-214 negative control or miR-214 inhibitor was collected and processed as recommended. The GSM-CYT-5 chips (Raybiotech, China) were blocked with Sample Diluent (Raybiotech, China) for 30 min at room temperature. After blocking, the chips were incubated with the supernatant on a horizontal shaker (55 rpm) at 4°C overnight and subjected to a series of wash steps. Subsequently, the chips were incubated with biotin-conjugated detection antibodies (Raybiotech, China) for 2 h at room temperature, washed again, and then incubated with Cy3-conjugated streptavidin (Raybiotech, China) for 1 h in the dark. After a final wash cycle, the chips were spin-dried and scanned using a GenePix 4000B microarray scanner (Axon Instruments, USA). The data were read and analyzed using GenePix Pro 6.0 software (Axon Instruments, USA).

Statistical Analysis

GraphPad Prism 9.0 (San Diego, CA) was used to analyze all experimental data. The data are displayed as mean ± SEM (standard error of the mean). The two-tailed t test was used to compare two groups, and one-way analysis of variance was used to compare several groups. Statistical significance was defined as p < 0.05.

Results

Endothelial Cell-Specific Knockout of miR-214 Aggravates 5/6Nx-Induced Renal Dysfunction

Through an online database (https://dianalab.e-ce.uth.gr/mited/#/topExpressed) [51], we identified the presence of miR-214 in healthy human aortic endothelial cells (Fig. 1a). To validate endothelial enrichment of the isolated primary cell population, qRT-PCR analysis showed markedly higher CD31 expression in the CD31-enriched primary renal endothelial-cell fraction than in the residual cell fraction (Fig. 1b). To investigate the role of endothelial miR-214 in CKD, we detected miR-214 expression in renal endothelial cells of a 5/6Nx model. qRT-PCR analysis revealed a marked upregulation of miR-214 in CD31-enriched primary mRVECs isolated from 5/6Nx mice relative to the sham-operated group (Fig. 1c). These findings suggest that endothelial cell-derived miR-214 may play an important role in the progression of CKD. Toconfirm the role of endothelial miR-214 in CKD, we generated endothelial-specific miR-214 conditional knockout (miR-214 cKO) mice using the Cre/LoxP system [52]. qRT-PCR confirmed that miR-214 expression in CD31-enriched primary mRVECs from cKO mice was reduced by approximately 70% compared with controls (Fig. 1d).

Fig. 1 description. This figure shows that endothelial cell-specific deletion of miR-214 worsens renal dysfunction after 5/6 nephrectomy. miR-214 is expressed in endothelial cells, and its loss is associated with reduced residual kidney mass, increased BUN and serum creatinine, elevated blood pressure, and greater urinary albumin excretion. — Endothelial cell-specific knockout of miR-214 aggravates 5/6Nx-induced renal dysfunction. a Expression of miR-214 in human aortic endothelial cells, as indicated by an online database (https://dianalab.e-ce.uth.gr/mited/#/topExpressed). b qRT-PCR analysis of CD31 in isolated primary mouse renal vascular endothelial cells (mRVECs) (n = 3). c miR-214 levels in CD31-enriched primary renal endothelial cells from 5/6Nx mouse models (n = 3). d qRT-PCR detected miR-214 levels in CD31-enriched primary mRVECs extracted from miR-214 cKO mice (n = 3). e Schematic illustration of the 5/6Nx model in miR-214 cKO mice. f Measurement of residual kidney weight/body weight at 12 weeks post surgery (n = 10). g, h Analysis of blood urea nitrogen (BUN) and serum creatinine (Cr) (n = 9–13). i Systolic blood pressure at 4 weeks, 8 weeks, and 12 weeks post surgery detected by tail-cuff (n = 6–12). j ELISA of urinary microalbumin at 4 weeks, 8 weeks, and 12 weeks post surgery (n = 5–9). p < 0.05 was considered statistically significant.

We then constructed a 5/6Nx model using the miR-214 cKO mice and collected kidney tissue and other samples for further analysis after 12 weeks (Fig. 1e). As shown in Figure 1f, the residual kidney weight/body weight ratio was significantly increased in miR-214 cKO mice subjected to 5/6Nx compared to WT 5/6Nx mice. Serum biochemistry analysis revealed that both blood urea nitrogen and Cr levels were markedly elevated in 5/6Nx mice, which were further increased in the miR-214 cKO group (Fig. 1g, h). Serial measurements of systolic blood pressure showed a progressive increase in 5/6Nx mice. Notably, this hypertensive progression was markedly exacerbated in miR-214 cKO mice subjected to 5/6Nx (Fig. 1i). Time-course ELISA analysis showed that urinary protein levels were consistently higher in miR-214 cKO 5/6Nx mice than in WT 5/6Nx controls (Fig. 1j). Collectively, these findings indicate that endothelial-specific deletion of miR-214 aggravated renal injury and proteinuria in the 5/6Nx model.

Endothelial Cell-Specific Knockout of miR-214 Aggravates 5/6Nx-Induced Glomerulosclerosis

Masson’s trichrome staining (Fig. 2a, b) and Sirius Red staining (Fig. 2e and f) showed collagen fiber deposition in renal tissues of 5/6Nx mice, which was further aggravated by endothelial-specific deletion of miR-214, as reflected by exacerbated glomerulosclerosis. Consistently, PAS staining showed typical glomerulosclerotic features, including glomerular basement membrane thickening, mesangial cell and matrix proliferation, and knockout of miR-214 in endothelial cells further exacerbated the pathological changes of glomerulosclerosis (Fig. 2c, d). IHC staining further confirmed that endothelial-specific miR-214 deficiency amplified the upregulation of α-SMA induced by 5/6Nx (Fig. 2g, h). Moreover, Western blot analyses showed that the expression of fibrotic markers, such as fibronectin and collagen I, was significantly elevated in 5/6Nx mice, while the absence of endothelial cell miR-214 further increased these fibrosis-related markers (Fig. 2i–k). These results collectively demonstrate that endothelial cell-specific deletion of miR-214 substantially exacerbates glomerulosclerosis in 5/6Nx mice.

Fig. 2 description. This figure demonstrates that endothelial miR-214 deficiency aggravates renal fibrosis and glomerulosclerosis after 5/6 nephrectomy. Histological staining and fibrosis-related protein analyses show more severe collagen deposition, glomerular injury, and extracellular matrix accumulation in miR-214 cKO mice. — Endothelial cell-specific knockout of miR-214 aggravates 5/6Nx-induced glomerulosclerosis. a Masson’s trichrome staining of WT and miR-214 cKO mice after 5/6Nx (n = 8–10, scale bar: 20 μm). b Quantification of Masson’s trichrome staining from (a) (n = 8–10). c PAS staining of WT and miR-214 cKO mice after 5/6Nx (n = 7–9, scale bar: 20 μm), black dashed boxes and yellow arrows indicate pathological changes of glomerulosclerosis. d Glomerulosclerosis score (GSI) of PAS staining. e Sirius Red staining (n = 5, scale bar: 50 μm). f Quantification of Sirius Red staining from (e) (n = 5). g IHC staining of α-SMA (n = 6, scale bar: 50 μm). h IHC semi-quantitative IOD analysis of α-SMA (n = 6). i Western blot analysis of fibronectin and collagen I, GAPDH was used as a control (n = 6–8). Quantification of fibronectin (j) and collagen I (k) expression from (i) (n = 6–8). p < 0.05 was considered statistically significant.

Endothelial Cell-Specific Knockout of miR-214 Aggravates 5/6Nx-Induced Renal Inflammation

Given the critical link between inflammation and fibrosis in kidney pathology, we examined inflammatory cytokine levels in both renal tissues and the circulation. ELISA showed that the serum level of interleukin-6 (IL-6) was significantly elevated in 5/6Nx mice compared with controls, and further increased following endothelial cell-specific miR-214 deletion, indicating an amplified inflammatory response (Fig. 3a). qRT-PCR analysis showed that 5/6Nx-induced renal injury significantly upregulated the expression of IL-6 and IL-1β in kidney tissues, an effect that was further enhanced by endothelial-specific knockout of miR-214 (Fig. 3b, c). IF staining further demonstrated that the expression of F4/80, a marker of macrophage maturation and infiltration, was significantly increased in kidneys of miR-214 cKO 5/6Nx mice compared with those in WT 5/6Nx mice (Fig. 3d, e). Western blot analysis showed that protein levels of the inflammatory markers ICAM1 and VCAM1 were elevated in kidneys of 5/6Nx mice, and further increased upon endothelial-specific miR-214 deletion (Fig. 3f–h). These results demonstrate that endothelial miR-214 deficiency aggravates renal inflammation in the 5/6Nx model.

Fig. 3 description. This figure shows that endothelial miR-214 knockout enhances renal inflammation in the 5/6 nephrectomy model. miR-214-deficient mice display higher inflammatory cytokine levels, increased macrophage infiltration, and elevated endothelial adhesion molecule expression. — Endothelial cell-specific knockout of miR-214 aggravates 5/6Nx-induced renal inflammation. a ELISA detection of serum IL-6 levels (n = 10). qRT-PCR analysis of IL-6 (b) and IL-1β (c) (n = 6) in kidney tissues. d IF staining of F4/80 (n = 6, scale bar: 20 μm). e Relative fluorescence intensity statistics of IF staining of F4/80 (n = 6). f Western blot analysis of ICAM1 and VCAM1 in kidney tissues; GAPDH was used as a control (n = 6–8). Quantification of ICAM1 (g) and VCAM1 (h) expression from (f) (n = 6–8). p < 0.05 was considered statistically significant.

Knockout of Endothelial miR-214 Aggravates 5/6Nx-Induced Renal Apoptosis

Persistent inflammatory stress promotes apoptosis, while insufficient clearance of apoptotic cells may lead to their engulfment by neighboring cells and contribute to fibrosis. To explore this process in our model, we examined apoptosis markers in renal tissues. TUNEL staining showed a significant increase in TUNEL-positive cells in kidneys of 5/6Nx mice, which was further elevated by endothelial-specific miR-214 deletion (Fig. 4a, b). Consistently, Western blot analysis showed significantly higher levels of the apoptotic markers BAX and cleaved caspase-3 in 5/6Nx mice than those in controls, and these levels were further enhanced following endothelial miR-214 knockout (Fig. 4c-e). These results suggest that endothelial miR-214 deficiency exacerbates 5/6Nx-induced renal apoptosis, highlighting a protective role for endothelial miR-214 in attenuating the progression of CKD.

Fig. 4 description. This figure indicates that loss of endothelial miR-214 increases renal cell apoptosis after 5/6 nephrectomy. TUNEL staining and apoptosis marker analysis show more extensive apoptotic signaling in kidneys from miR-214 cKO mice. — Knockout of endothelial miR-214 aggravates 5/6Nx-induced renal apoptosis. a Representative micrographs with IF staining of TUNEL (n = 6, scale bar: 20 μm). b Quantification of TUNEL fluorescence ratio (n = 6). c Western blot analysis of apoptosis markers BAX and cleaved caspase-3, GAPDH was used as a control (n = 6–8). Quantification of BAX (d) and cleaved caspase-3 (e) expression from (c) (n = 6–8). p < 0.05 was considered statistically significant.

Knockout of Endothelial miR-214 Aggravates Endothelial Cell and Podocyte Damage in the 5/6Nx Model

Vascular endothelial damage, a consequence of inflammatory activation, contributes to renal dysfunction and fibrosis. To determine the role of endothelial miR-214 in this process, we first assessed glomerular capillary injury via PAS staining, which showed aggravated damage after endothelial-specific miR-214 knockout in 5/6Nx mice (Fig. 5a). At both mRNA and protein levels, the expression of the endothelial marker CD31 and the tight junction protein ZO-1 was significantly downregulated in 5/6Nx kidneys and further reduced by endothelial miR-214 deletion (Fig. 5b–f), indicating exacerbated endothelial barrier disruption. We next examined podocyte integrity, given its essential role in glomerular filtration. Transmission electron microscopy revealed more severe foot process effacement in endothelial miR-214-deficient 5/6Nx mice (Fig. 5g, h). IF and Western blot analyses consistently showed decreased expression of the podocyte markers WT1 and nephrin in 5/6Nx kidneys, with further reduction upon endothelial miR-214 knockout (Fig. 5i–l). These results demonstrate that endothelial-specific miR-214 deletion not only intensifies endothelial barrier damage but also exacerbates podocyte injury, collectively aggravating glomerulosclerosis.

Fig. 5 description. This figure shows that endothelial miR-214 knockout exacerbates endothelial and podocyte injury in the 5/6 nephrectomy model. The affected kidneys show greater glomerular capillary damage, reduced endothelial and podocyte marker expression, and more severe podocyte foot process fusion. — Knockout of endothelial miR-214 aggravates endothelial cell and podocyte damage in the 5/6Nx model. a Glomerular capillary injury score of PAS staining (n = 7–9). b qRT-PCR analysis of CD31 expression in kidney tissues (n = 6). c qRT-PCR analysis of ZO-1 in kidney tissues (n = 5–6). d Western blot analysis of CD31 and ZO-1, GAPDH was used as a control (n = 6–8). Quantification of CD31 (e) and ZO-1 (f) from (d) (n = 6-8). g Representative TEM images of renal tissues in different groups (n = 3, scale bar: 1 μm). h Analysis of the percentage of podocyte foot process fusion (n = 3) from (g). i IF staining of WT1 (n = 6, scale bar: 20 μm). j Relative fluorescence intensity statistics of IF staining of WT1 (n = 6). k Western blot analysis of nephrin, GAPDH was used as a control (n = 6–8). Quantification of nephrin (l) from (k) (n = 6–8). p < 0.05 was considered statistically significant.

Endothelial miR-214 Interacts with the RELA 3′-UTR and Regulates RELA Expression

In vitro, qRT-PCR confirmed efficient knockdown of miR-214 in MAECs following inhibitor treatment, validating its suitability for transcriptomic analysis (Fig. 6a). Transcriptomic profiling identified 253 differentially expressed genes upon miR-214 knockdown (Fig. 6b), with significant enrichment in inflammatory pathways, particularly the NF-κB signaling pathway (Fig. 6c). Analysis of the three core NF-κB transcription factor-encoding genes RELA (P65), NF-κB1 (P50/P105), and REL (c-REL) revealed that only RELA expression was significantly increased after miR-214 inhibition (Fig. 6d–f). Bioinformatic prediction using TargetScan indicated conserved miR-214 binding sites within the 3′-UTR of RELA (Fig. 6g). Luciferase reporter assays further demonstrated that co-transfection of miR-214 mimic with WT RELA 3′-UTR significantly reduced reporter activity, whereas mutation of the predicted binding sites abolished this effect (Fig. 6h). Collectively, these findings support RELA as a functionally validated downstream target of miR-214 in endothelial cells, while the luciferase assay establishes an interaction between miR-214 and the RELA 3′-UTR in vitro.

Fig. 6 description. This figure identifies RELA as a downstream target regulated by endothelial miR-214. Inhibition of miR-214 alters inflammatory signaling pathways, increases RELA-related expression, and luciferase assays support a direct interaction between miR-214 and the RELA 3′-UTR. — Endothelial miR-214 interacts with the RELA 3′-UTR and regulates RELA expression. a qRT-PCR analysis of miR-214 levels in MAECs transfected with miR-214 inhibitor compared to the negative control (n = 3). b Transcriptomic analysis of differential genes in MAECs transfected with miR-214 inhibitor (n = 4). c Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway changes following inhibition of miR-214 expression. d–f Transcripts Per Kilobase per Million mapped reads values (TPM) of RELA (d), NF-κB1 (e), and REL (f) in MAECs following inhibition of miR-214 expression. g Online database prediction of binding sites between miR-214 and the 3′-UTR of RELA. h Luciferase activity measurement after co-transfection with pmirGLO-RELA-3′-UTR-WT or pmirGLO-RELA-3′-UTR-Mut along with miR-214 mimic or negative control in MAECs (n = 4). p < 0.05 was considered statistically significant.

Endothelial miR-214 Regulates RELA-Associated Signaling in vivo

We next examined whether miR-214 modulates RELA-related signaling in vivo. To assess the in vivo effect of miR-214 on RELA, mRVECs were isolated from C57 WT mice 48 h following intraperitoneal injection of miR-214 antagonist (AntagomiR-214) or miR-214 agonist (AgomiR-214). AntagomiR-214 treatment significantly reduced miR-214 expression (Fig. 7a) and increased RELA expression at both mRNA and protein levels (Fig. 7b–d). Conversely, AgomiR-214 treatment elevated miR-214 (Fig. 7e) and decreased RELA expression (Fig. 7f–h). Consistent with these results, endothelial-specific knockout of miR-214 was associated with increased P65 and p-P65 levels in whole-kidney lysates from 5/6Nx mice (Fig. 7i–k). Using a cytokine array, we found that miR-214 inhibition in cultured MAECs markedly upregulated multiple pro-inflammatory factors, including IL-1β, IL-2, IL-5, IL-7, IL-21, ICAM1, CXCL1, and leptin (Fig. 7l). Together, these data indicate that endothelial miR-214 regulates inflammatory responses through RELA-associated signaling, thereby contributing to the regulation of renal inflammation and glomerulosclerosis in CKD.

Fig. 7 description. This figure shows that endothelial miR-214 regulates RELA/P65-associated signaling in vivo. Reducing miR-214 increases RELA/P65 activity and inflammatory factor expression, whereas increasing miR-214 suppresses this signaling pathway. — Endothelial miR-214 regulates RELA-associated signaling in vivo. qRT-PCR analysis of miR-214 (a) and RELA (b) levels in CD31-enriched primary mRVECs from mice treated with AntagomiR-214 (n = 3). c Western blot analysis of P65 in CD31-enriched primary mRVECs from mice treated with AntagomiR-214; GAPDH was used as a control (n = 3). d Quantification of P65 expression from (c) (n = 3). qRT-PCR analysis of miR-214 (e) and RELA (f) levels in CD31-enriched primary mRVECs from mice treated with AgomiR-214 (n = 3). g Western blot analysis of P65 in CD31-enriched primary mRVECs from mice treated with AgomiR-214; GAPDH was used as a control (n = 3). h Quantification of P65 expression from (g) (n = 3). i Western blot analysis of P65 and p-P65 in whole-kidney lysates from miR-214 cKO mice after 5/6Nx; GAPDH was used as a control (n = 4). Quantification of P65 (j) and p-P65 (k) expression from (i) (n = 4). l Heatmap of upregulated inflammatory factors between the anti-control and anti-miR-214 groups. p < 0.05 was considered statistically significant.

miR-214 Attenuates RELA-Associated Inflammation in Endothelial Cells under Pro-Inflammatory Stimulation

To further assess whether miR-214 regulates endothelial inflammatory activation in a disease-relevant context, MAECs were transfected with a miR-214 inhibitor or mimic and then exposed to pro-inflammatory stimulation. In inhibitor-transfected cells, pro-inflammatory stimulation significantly increased miR-214 expression, upregulated the mRNA levels of RELA, VCAM1, ICAM1, and CXCL1, enhanced IL-6 secretion, and elevated the protein levels of p-P65, VCAM1, and ICAM1. Inhibition of miR-214 further potentiated these inflammatory responses (Fig. 8a–j). Conversely, in mimic-transfected cells, while pro-inflammatory stimulation increased miR-214 expression in control cells, miR-214 overexpression restored its level and significantly attenuated the stimulation-induced inflammatory activation, as evidenced by reduced mRNA levels of RELA, VCAM1, ICAM1, and CXCL1, decreased IL-6 secretion, and lower protein levels of p-P65, VCAM1, and ICAM1 (Fig. 9a–j). Collectively, these findings demonstrate that miR-214 suppresses RELA-associated inflammatory activation in endothelial cells under pro-inflammatory conditions.

Fig. 8 description. This figure demonstrates that inhibition of miR-214 intensifies RELA-associated inflammatory responses in endothelial cells under pro-inflammatory stimulation. miR-214 suppression increases RELA, P65 activation, adhesion molecule expression, and inflammatory cytokine production. — Inhibition of miR-214 aggravates RELA-associated inflammatory responses in endothelial cells under pro-inflammatory stimulation. MAECs were transfected with miR-214 inhibitor or the corresponding negative control, followed by pro-inflammatory stimulation. qRT-PCR analysis of miR-214 (a), RELA (b), VCAM1 (c), ICAM1 (d), and CXCL1 (e) expression in MAECs under the indicated conditions (n = 3). f ELISA analysis of IL-6 levels in the culture supernatant under the indicated conditions (n = 3). g Western blot analysis of p-P65, P65, VCAM1, and ICAM1 in MAECs under the indicated conditions, with GAPDH used as a loading control (n = 3). Quantification of p-P65 (h), VCAM1 (i), and ICAM1 (j) from (g) (n = 3). p < 0.05 was considered statistically significant.

Fig. 9 description. This figure shows that miR-214 overexpression attenuates RELA-associated inflammatory activation in endothelial cells. Increasing miR-214 reduces RELA-related signaling, adhesion molecule expression, and inflammatory cytokine release under pro-inflammatory conditions. — Overexpression of miR-214 attenuates RELA-associated inflammatory responses in endothelial cells under pro-inflammatory stimulation. MAECs were transfected with miR-214 mimic or the corresponding negative control, followed by pro-inflammatory stimulation. qRT-PCR analysis of miR-214 (a), RELA (b), VCAM1 (c), ICAM1 (d), and CXCL1 (e) expression in MAECs under the indicated conditions (n = 3). f ELISA analysis of IL-6 levels in the culture supernatant under the indicated conditions (n = 3). g Western blot analysis of p-P65, P65, VCAM1, and ICAM1 in MAECs under the indicated conditions, with GAPDH used as a loading control (n = 3). Quantification of p-P65 (h), VCAM1 (i), and ICAM1 (j) from (g) (n = 3). p < 0.05 was considered statistically significant.

miR-214 Deficiency in Vascular Smooth Muscle Cells Does Not Affect 5/6Nx-Induced Glomerulosclerosis

Vascular smooth muscle cells (VSMCs) are key regulators of renal hemodynamics through their contractile function. Under pathological conditions, VSMC dysfunction contributes to vascular remodeling and impaired renal perfusion. To determine whether VSMC-specific deletion of miR-214 influences renal outcomes in the 5/6Nx model, we generated smooth muscle cell-specific miR-214 conditional knockout mice (miR-214 ^flox/flox; Tagln-Cre) using Cre/LoxP technology [38]. After 12 weeks of 5/6Nx surgery, no significant differences were observed between miR-214 ^flox/flox; Tagln-Cre and miR-214 ^flox/flox 5/6Nx mice in residual kidney weight/body weight ratio (online suppl. Fig. 1a; for all online suppl. material, see https://doi.org/10.1159/000552823), serum blood urea nitrogen and Cr levels (online suppl. Fig. 1b, c), urine volume, water intake, and systolic blood pressure (online suppl. Fig. 1d–f). These results indicate that VSMC-specific deletion of miR-214 does not exacerbate renal dysfunction in the 5/6Nx model.

Discussion

Glomerulosclerosis, a hallmark of end-stage CKD, arises from a complex interplay between inflammatory and resident renal cells. Among these, renal vascular endothelial cells play a pivotal role in the initiation and progression of glomerulosclerosis [53]. Endothelial injury initiates glomerulosclerosis by triggering an inflammatory cascade that recruits circulating cells and damages glomerular architecture. Such injury may further affect adjacent podocytes, highly specialized cells with limited regenerative ability. Podocyte injury leads to foot process effacement and detachment, resulting in proteinuria and the release of pro-fibrotic signals that amplify local damage [54]. Sustained injury to both cell types activates mesangial cells, prompting their transition into matrix-producing myofibroblasts. This drives pathological extracellular matrix deposition and sclerosis [55]. Although studies in CKD mouse models have implicated endothelial injury and endothelial-to-mesenchymal transition in glomerulosclerosis [53, 54], the precise mechanistic contributions of vascular endothelial cells remain incompletely defined. This study provides evidence that endothelial miR-214 deficiency exacerbates renal inflammation and glomerulosclerosis through RELA-associated inflammatory signaling, unveiling a mechanism for its protective role in CKD progression.

miRNAs serve as critical regulators of gene expression and play an essential role in the progression of various diseases, including kidney disease [56–58]. miR-214 is significantly upregulated in rat glomerular mesangial cells upon TGF-β1 stimulation [59]. Furthermore, inhibition of miR-214 has been shown to attenuate renal fibrosis induced by unilateral ureteral obstruction [30]. Our previous studies demonstrated that miR-214 promotes renal fibrosis in CKD by targeting the mitochondrial genes mitochondrial NADH dehydrogenase 6 (mt-Nd6) and mitochondrial NADH dehydrogenase 4l (mt-Nd4l), thereby disrupting oxidative phosphorylation. Consistently, pharmacological inhibition of miR-214 ameliorated fibrosis in the albumin overload model of CKD [29], validating its therapeutic potential for anti-fibrotic treatment [30]. These findings highlight miR-214 as a promising therapeutic target and diagnostic biomarker for CKD [29]. Nevertheless, given the tissue-specific functions of miR-214, its role in vascular endothelial cells during the progression of glomerulosclerosis remains to be elucidated.

Our preliminary bioinformatic analysis detected miR-214 expression in human aortic endothelial cells, and subsequent experimental validation confirmed its significant upregulation in the renal vascular endothelial cells of 5/6Nx mice. To further investigate the functional role of miR-214, we employed vascular endothelial-specific miR-214 knockout mice [38], and subjected them to 5/6Nx. Clinically, CKD is characterized by proteinuria, chronic damage to renal tubules, interstitium, and glomeruli, along with a progressive decline in renal function, where glomerulosclerosis and interstitial fibrosis represent key pathological hallmarks [55, 60, 61]. The 5/6Nx model mimics this condition by imposing a heightened functional load on the remnant renal tissue, leading to hyperfiltration, elevated glomerular pressure, and enhanced tubular metabolism [62, 63]. Our results showed that endothelial-specific miR-214 knockout led to more severe renal dysfunction, proteinuria, and a time-dependent increase in blood pressure. This hypertensive response is likely secondary to renal injury, which is mechanistically distinct from our previous observations in the Ang II-induced systemic hypertension model [38]. Once established, this renogenic hypertension further exacerbates renal structural and functional damage, creating a vicious cycle. Histological analysis confirmed that miR-214 deletion markedly exacerbated glomerulosclerosis and interstitial fibrosis, with glomerular lesions being particularly prominent. Consistent with these findings, upregulation of fibrosis-related markers further supported the involvement of vascular endothelial miR-214 in the progression of glomerulosclerosis in CKD.

However, the discrepancy between our results and published literature may be attributed to two reasons. First, the function of miR-214 exhibits cell-type specificity: conditional knockout of this gene in renal tubular epithelial cells primarily induces tubular injury and subsequent interstitial fibrosis, whereas its knockout in vascular endothelial cells mainly leads to endothelial damage and consequent glomerulosclerosis. Second, the disease models employed have distinct primary injury foci: both the UUO and albumin overload models predominantly target the renal tubules, hence their phenotypes are characterized mainly by interstitial fibrosis. In contrast, the core mechanism of the 5/6Nx model is “glomerular hyperfiltration, hypertension, and hyperpermeability,” initiating with glomerular compensatory dysfunction, which results in a phenotype dominated by glomerulosclerosis [30].

The pathogenesis of glomerulosclerosis involves both inflammatory responses and resident renal cells injury [64, 65]. We observed that homozygous knockout of miR-214 in vascular endothelial cells significantly exacerbated nephrectomy-induced renal inflammation and apoptosis at both protein and mRNA levels. Additional assays evaluating vascular endothelial damage and integrity further suggested that miR-214 deletion amplifies endothelial injury. During the progression of CKD, endothelial damage not only disrupts the cytoskeleton of podocytes but also promotes widespread renal inflammation and fibrosis, ultimately accelerating glomerulosclerosis [53, 54, 66, 67]. Transmission electron microscopy revealed podocyte foot process effacement and detachment in 5/6Nx mice, which were markedly aggravated by endothelial miR-214 loss. These injuries were markedly aggravated by the loss of endothelial miR-214, as evidenced by pronounced morphological changes and dysregulation of injury markers. Although both inflammatory factors and resident renal cells participate in 5/6Nx-induced glomerulosclerosis in CKD, the specific gene targeted by miR-214 in this process remained unclear.

Transcriptomic data suggested that miR-214 modulates the NF-κB signaling pathway in vascular endothelial cells. Among the key subunits of the canonical NF-κB pathway (RELA/P65, NF-κB1/P50, and REL/c-REL), miR-214 inhibition selectively increased RELA expression, with no notable changes in NF-κB1 or REL. TargetScan predicted potential miR-214 binding sites within the RELA 3′-UTR, and dual-luciferase reporter assays suggested a direct interaction in vitro. In CD31-enriched primary renal endothelial cells, miR-214 inversely regulated RELA expression, supporting RELA as a plausible downstream target. In the classical NF-κB pathway, the P50-RELA heterodimer is a key transcriptional regulator, with the RELA C-terminal transactivation domain driving downstream gene expression [68]. As a central inflammatory regulator, NF-κB activation via the canonical pathway promotes the transcription of pro-inflammatory genes and establishes a self-amplifying inflammatory circuit [69, 70].

Under pro-inflammatory stimulation in cultured MAECs, we observed increased IL-6 secretion, upregulation of ICAM1, VCAM1, CXCL1, and RELA, and enhanced p-P65 activation. miR-214 inhibition appeared to amplify these responses, whereas miR-214 overexpression attenuated them, suggesting that miR-214 restrains RELA-associated endothelial inflammatory activation under disease-relevant conditions.

Inflammatory cytokine profiling further indicated that miR-214 suppression may enhance recruitment and activation of inflammatory cells, thereby amplifying the renal inflammatory cascade. Notably, CXCL1, which promotes neutrophil recruitment and angiogenesis via CXCR2 signaling [71], was significantly elevated. Leptin expression also increased following miR-214 inhibition; beyond its metabolic role, leptin acts as a pro-inflammatory cofactor, often synergizing with interleukin-driven pathways, and its expression correlates with the severity of renal injury [72, 73]. Notably, while the interaction between miR-214 and RELA has been documented in other contexts [74], the present study provides its functional delineation within the glomerular endothelium in CKD. In contrast to tubular cells, where miR-214 targets Nd6 and Nd4l to promote fibrosis [29], endothelial miR-214 suppresses NF-κB activation and glomerulosclerosis in the 5/6Nx model through RELA-associated NF-κB signaling. These findings define miR-214 as a compartment-specific regulator that is pathogenic in tubules yet protective in glomeruli, and caution that global inhibition may exacerbate glomerular injury. Extending our previous work on tubular epithelial miR-214 [29], the present study indicates that endothelial miR-214 deletion aggravates 5/6Nx-induced glomerulosclerosis by targeting RELA and promoting NF-κB-driven inflammation. Thus, miR-214 exerts distinct, cell type-specific roles in CKD.

However, several limitations should be acknowledged. First, crosstalk between inflammatory cells and resident renal cells in mediating the protective effect of endothelial miR-214 remains unclear. Second, we did not examine miR-214 and RELA expression in human kidney tissues, and endothelial miR-214 validation relied solely on qRT-PCR of CD31-enriched primary cells without in situ spatial confirmation (e.g., FISH with endothelial co-staining). Third, Tie2-Cre-mediated deletion achieved only ∼70% reduction of miR-214 in primary mRVECs, not complete knockout, likely due to limited Cre recombination efficiency and non-endothelial cell contamination; nevertheless, this reduction was statistically sufficient for the observed phenotypes. Future use of an alternative endothelial-specific Cre driver, such as Cdh5-Cre, may achieve more complete deletion. Fourth, in vivo NF-κB activation was assessed in whole-kidney lysates rather than directly in sorted endothelial cells, limiting cell-specific interpretation. Fifth, only male mice were used; future studies should validate findings in female mice with endothelial-targeted approaches to minimize off-target effects.

Despite these limitations, this study is the first to demonstrate that endothelial miR-214 mitigates CKD-associated glomerulosclerosis by modulating inflammatory signaling. Endogenous upregulation of miR-214 in CKD appears compensatory but insufficient to prevent disease progression, suggesting that further enhancing its expression is a rational therapeutic strategy. Potential approaches include miR-214 agomirs or AAV-based gene therapy with an endothelium-specific promoter. Key challenges include off-target effects (requiring optimized design and transcriptomic evaluation), cell-type-specific delivery (e.g., anti-CD31 or RGD peptides on nanoparticles), and long-term safety of sustained miR-214 overexpression. Addressing these challenges will be critical for translating miR-214-based therapy into clinical practice.

Conclusion

This study suggests that miR-214 is capable of binding to the RELA 3′-UTR in vitro and inversely regulates RELA expression in renal endothelial cells. This regulation may contribute to reducing inflammation-related factors, alleviating endothelial cell injury, and potentially ameliorating glomerulosclerosis. These findings offer a potential rationale for considering endothelial-targeted modulation of miR-214 as a possible therapeutic direction for CKD-associated glomerulosclerosis.

Statement of Ethics

All animal experimental protocols were performed in strict accordance with the ARRIVE reporting guidelines and approved in advance by the Laboratory Animal Ethics Committee of Nanjing Medical University, with ethics approval No. [2310085-1].

Conflict of Interest Statement

Aihua Zhang was a member of the journal’s Editorial Board at the time of submission. The remaining authors have no conflicts of interest to declare.

Funding Sources

This study was supported by the National Key Research and Development Program [Grant Nos. 2022YFC2705100, 2022YFC2705105, and 2022YFC2705102]; the National Natural Science Foundation of China [Grant Nos. U25A20653, W2411073, 82090022, 82070702, and 81770740]; the Nanjing Medical Science and Technique Development Foundation [Grant Nos. ZKX20040 and ZKX24036]. The funders had no role in the study design, data collection, analysis, interpretation of data, manuscript preparation, or the decision to publish.

Author Contributions

Lingxiao Tan conceived the study, designed the methodology, performed the investigations, and drafted the manuscript. Xinwen Fan conceived the study, performed the investigations, curated the data, and drafted the manuscript. Xiaolu Zhang performed the investigations, conducted the validation, created the visualizations, provided supervision, and designed the methodology. Shanshan Li performed the investigations and curated the data. Bingyu Yang conducted the validation and performed formal analysis. Yue Zhang acquired funding and curated the data. Songming Huang and Zhanjun Jia provided supervision and reviewed and edited the manuscript. Wei Gong provided supervision and designed the methodology. Aihua Zhang provided supervision, administered the project, acquired funding, and reviewed and edited the manuscript. Shuzhen Li conceived the study, provided supervision, acquired funding, reviewed and edited the manuscript, and handled correspondence.

Funding Statement

Data Availability Statement

The public database used to analyze miR-214 expression in human aortic endothelial cells is available at https://dianalab.e-ce.uth.gr/mited/#/topExpressed [51]. Raw RNA-seq datasets were submitted to the Sequence Read Archive (SRA) database (https://www.ncbi.nlm.nih.gov/sra/) under the accession number PRJNA1355189 [50]. All other relevant data supporting the findings of this study are available from the corresponding author upon reasonable request.

Supplementary Material.

Supplementary_material-Suppl.1-s1.tif^{(8.9MB, tif)}

Supplementary Material.

Supplementary_material-Suppl.2-s2.docx^{(16.2KB, docx)}

References

1. Rudnick MR, Wahba IM, Leonberg-Yoo AK, Miskulin DLitt HI. Risks and options with gadolinium-based contrast agents in patients with CKD: a review. Am J Kidney Dis. 2021;77(4);517–28. [DOI] [PubMed] [Google Scholar]
2. Wang B, Li ZL, Zhang YL, Wen Y, Gao YM, Liu BC. Hypoxia and chronic kidney disease. EBioMedicine. 2022;77:103942. [DOI] [PMC free article] [PubMed] [Google Scholar]
3. GBD Chronic Kidney Disease Collaboration . Global, regional, and national burden of chronic kidney disease, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2020;395:709–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Pietilä R, Marks-Hultström A, He L, Nanavazadeh S, Quaggin SE, Betsholtz C, et al. TIE2 activation by antibody-clustered endogenous angiopoietin-2 prevents capillary loss and fibrosis in experimental kidney disease. J Clin Investig. 2025;135(21):e190286. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Ortiz Segura MDC, Del Río Navarro BE, Rodríguez Espino BA, Marchat LA, Muñoz FS, Villafaña S, et al. Abnormality of adipokines and endothelial dysfunction in Mexican obese adolescents with insulin resistance. Endocr Res. 2017;42:1–8. [DOI] [PubMed] [Google Scholar]
6. Saha D, Annadorai RK, Thannimangalath S, Shroff NP, Kataria S, Dam B, et al. Angiopoietin-like protein 2 mediates vasculopathy-driven fibrogenesis in a mouse model of systemic sclerosis. J Clin Investig. 2025;135(15):e177123. [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Li L, Liao J, Zhang Y, Yao Z, Huang J, Wu K, et al. Single cell and spatial transcriptomics define a proinflammatory and profibrotic niche after Kidney Injury. Adv Sci. 2025;13(2):e03691. [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Jiang L, Zhang X, Wu X. Hypoxia-Induced metabolic reprogramming in the renal tubules of patients with diabetic kidney disease and the associated traditional Chinese medicine intervention strategies. Integr Med Nephrol Androl. 2025;12(4):e25–00019. [Google Scholar]
9. Pawluczyk IZA, Bhachu JS, Brown JR, Lacey M, Mbadugha C, Straatman K, et al. B cell-derived exosomal miR-483-5p and its potential role in promoting kidney function loss in IgA nephropathy. Kidney Int. 2025;108(1):119–35. [DOI] [PubMed] [Google Scholar]
10. Yang W, Yu T, Yang H, Yao S, Ma R, Steinert EM, et al. Intrinsic MicroRNA-10a restricts regulatory T cell suppressive function and intestinal repair by coordinating transcriptional, metabolic, and epithelial repair pathways. Adv Sci. 2025;13(4):e09953. [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Wang R, Sun Y, Yu W, Yan Y, Qiao M, Jiang R, et al. Downregulation of miRNA-214 in cancer-associated fibroblasts contributes to migration and invasion of gastric cancer cells through targeting FGF9 and inducing EMT. J Exp Clin Cancer Res. 2019;38(1):20. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Peng R, Cheng X, Zhang Y, Lu X, Hu Z. miR-214 down-regulates MKK3 and suppresses malignant phenotypes of cervical cancer cells. Gene. 2020;724:144146. [DOI] [PubMed] [Google Scholar]
13. Liu Y, Li Y, Wu Y, Zhao Y, Hu X, Sun C. The long non-coding RNA NEAT1 promotes the progression of human ovarian cancer through targeting miR-214-3p and regulating angiogenesis. J Ovarian Res. 2023;16(1):219. [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Huang X, Zheng D, Liu C, Huang J, Chen X, Zhong J, et al. miR-214 could promote myocardial fibrosis and cardiac mesenchymal transition in VMC mice through regulation of the p53 or PTEN-PI3K-Akt signali pathway, promoting CF proliferation and inhibiting its ng pathway. Int Immunopharmacol. 2023;124:110765. [DOI] [PubMed] [Google Scholar]
15. Trevelyan CJ, MacCannell ADV, Stewart L, Tarousa T, Taylor HA, Murray M, et al. MiR-214-3p regulates Piezo1, lysyl oxidases and mitochondrial function in human cardiac fibroblasts. Matrix Biol. 2024;132:34–46. [DOI] [PubMed] [Google Scholar]
16. Trevelin SC, Zampetaki A, Sawyer G, Ivetic A, Brewer AC, Smyth LA, et al. Nox2-deficient Tregs improve heart transplant outcomes via their increased graft recruitment and enhanced potency. JCI Insight. 2021;6(18):e149301. [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Du Y, Wang X, Li L, Hao W, Zhang H, Li Y, et al. miRNA-Mediated suppression of a cardioprotective cardiokine as a novel mechanism exacerbating Post-MI remodeling by sleep breathing disorders. Circ Res. 2020;126(2):212–28. [DOI] [PubMed] [Google Scholar]
18. Lan X, Yu R, Xu J, Jiang X. Exosomes from chondrocytes overexpressing miR-214-3p facilitate M2 macrophage polarization and angiogenesis to relieve Legg Calve-Perthes disease. Cytokine. 2023;168:156233. [DOI] [PubMed] [Google Scholar]
19. Jo HR, Hwang J, Jeong JH. MicroRNA miR-214-5p induces senescence of microvascular endothelial cells by targeting the JAG1/Notch signaling pathway. Noncoding RNA Res. 2023;8(3):385–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Wang X, Li X, Li J, Zhai L, Liu D, Abdurahman A, et al. Mechanical loading stimulates bone angiogenesis through enhancing type H vessel formation and downregulating exosomal miR-214-3p from bone marrow-derived mesenchymal stem cells. FASEB J. 2021;35(1):e21150. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Liu F, Jiang LJ, Zhang YX, Xu ST, Liu SL, Ye JT, et al. Inhibition of miR-214-3p attenuates ferroptosis in myocardial infarction via regulating ME2. Biochem biophysical Res Commun. 2023;661:64–74. [DOI] [PubMed] [Google Scholar]
22. Wugeng S, Zan S, Liu Y, Bai Y, Hu A, Wei X, et al. MicroRNA-214-3p protects against myocardial ischemia-reperfusion injury by targeting demethylase lysine demethylase 3A. Regen Ther. 2023;23:17–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Ryabov VV, Maslov LN, Vyshlov EV, Mukhomedzyanov AV, Kilin M, Gusakova SV, et al. Ferroptosis, a regulated form of cell death, as a target for the development of novel drugs preventing ischemia/reperfusion of cardiac injury, cardiomyopathy and stress-induced cardiac injury. Int J Mol Sci. 2024;25(2):897. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Chi B, Zou A, Mao L, Cai D, Xiao T, Wang Y, et al. Empagliflozin-Pretreated mesenchymal stem cell-derived small extracellular vesicles attenuated heart injury. Oxidative Med Cell longevity. 2023;2023:1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Sang Z, Dong S, Zhang P, Wei Y. miR-214 ameliorates sepsis-induced acute kidney injury via PTEN/AKT/mTOR-regulated autophagy. Mol Med Rep. 2021;24(4):683. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Ye W, Miao Q, Xu G, Jin K, Li X, Wu W, et al. CircRNA itchy E3 ubiquitin protein ligase improves mitochondrial dysfunction in sepsis-induced acute kidney injury by targeting microRNA-214-3p/ATP-binding cassette A1 axis. Ren Fail. 2023;45(2):2261552. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Liu M, Liu L, Bai M, Zhang L, Ma F, Yang X, et al. Hypoxia-induced activation of Twist/miR-214/E-cadherin axis promotes renal tubular epithelial cell mesenchymal transition and renal fibrosis. Biochem biophysical Res Commun. 2018;495(3):2324–30. [DOI] [PubMed] [Google Scholar]
28. Hu Q, Zhao M, Wang H, Li X, Wang F, Zhang H, et al. Niao-Du-Kang granules regulate autophagy of diabetic nephropathy via the miR-214-3p/SIRT1 signaling pathway. J Ethnopharmacol. 2025;352:120175. [DOI] [PubMed] [Google Scholar]
29. Bai M, Chen H, Ding D, Song R, Lin J, Zhang Y, et al. MicroRNA-214 promotes chronic kidney disease by disrupting mitochondrial oxidative phosphorylation. Kidney Int. 2019;95(6):1389–404. [DOI] [PubMed] [Google Scholar]
30. Denby L, Ramdas V, Lu R, Conway BR, Grant JS, Dickinson B, et al. MicroRNA-214 antagonism protects against renal fibrosis. J Am Soc Nephrol. 2014;25(1):65–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Hack CE, Zeerleder S. The endothelium in sepsis: source of and a target for inflammation. Crit Care Med. 2001;29:S21–7. [DOI] [PubMed] [Google Scholar]
32. Hasegawa K, Kawashima N, Kawabata A, Sakakura M, Onoda N, Sano T, et al. Inflammation-associated molecules in the glomerular-endothelium in mild IgA-nephropathy patients identified by single-cell and spatial transcriptome. Commun Biol. 2025;8(1):915. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Groten SA, Smit ER, Janssen EFJ, van den Eshof BL, van Alphen FPJ, van der Zwaan C, et al. Multi-omics delineation of cytokine-induced endothelial inflammatory states. Commun Biol. 2023;6(1):525. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Nosalski R, Siedlinski M, Denby L, McGinnigle E, Nowak M, Cat AND, et al. T-Cell-Derived miRNA-214 mediates perivascular fibrosis in hypertension. Circ Res. 2020;126(8):988–1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Guo C, Ye FX, Jian YH, Liu CH, Tu ZH, Yang DP, MicroRNA-214-5p aggravates sepsis-related acute kidney injury in mice. Drug Dev Res. 2022;83(2):339–50. [DOI] [PubMed] [Google Scholar]
36. Hou D, Wu Q, Wang S, Pang S, Liang H, Lyu H, et al. Knockdown of miR-214 alleviates renal interstitial fibrosis by targeting the regulation of the PTEN/PI3K/AKT signalling pathway. Oxid Med Cell Longev. 2022;2022(1):7553928. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Aurora AB, Mahmoud AI, Luo X, Johnson BA, van Rooij E, Matsuzaki S, et al. MicroRNA-214 protects the mouse heart from ischemic injury by controlling Ca²⁺ overload and cell death. J Clin Investig. 2012;122(4):1222–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Li S, Liu B, Kang S, Yang B, Zhang Y, Huang S, et al. Endothelial MicroRNA-214 confers angiotensin II hypertension by targeting eNOS in mice. Kidney Blood Press Res. 2025;50(1):442–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Mokady D, Charish J, Barretto-Burns P, Grisé KN, Coles BLK, Raab S, et al. Small-molecule-directed endogenous regeneration of visual function in a Mammalian retinal degeneration model. Int J Mol Sci. 2024;25(3):1521. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Yang CJ, Wang JT, Yang JL, Chuang YC. Comparative efficacy of high-dose daptomycin monotherapy versus combination therapy for daptomycin-resistant enterococcus faecium endocarditis in a rat model. Infect Drug Resist. 2025;18:6865–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Souza AC, Tsuji T, Baranova IN, Bocharov AV, Wilkins KJ, Street JM, et al. TLR4 mutant mice are protected from renal fibrosis and chronic kidney disease progression. Physiol Rep. 2015;3(9):e12558. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Bai M, Wu M, Jiang M, He J, Deng X, Xu S, et al. LONP1 targets HMGCS2 to protect mitochondrial function and attenuate chronic kidney disease. EMBO Mol Med. 2023;15(2):e16581. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Chen XM, Kuang JB, Yu HY, Wu ZN, Wang SY, Zhou SY. A novel rabbit dry eye model induced by a controlled drying system. Transl Vis Sci Technol. 2021;10(4):32. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Bai M, Xu S, Jiang M, Guo Y, Hu D, He J, et al. Meis1 targets protein tyrosine phosphatase receptor J in fibroblast to retard chronic kidney disease progression. Adv Sci. 2024;11(39):e2309754. [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Street JM, Souza AC, Alvarez-Prats A, Horino T, Hu X, Yuen PS, et al. Automated quantification of renal fibrosis with sirius red and polarization contrast microscopy. Physiol Rep. 2014;2(7):e12088. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Huang XZ, Wen D, Zhang M, Xie Q, Ma L, Guan Y, et al. Sirt1 activation ameliorates renal fibrosis by inhibiting the TGF-beta/Smad3 pathway. J Cell Biochem. 2014;115(5):996–1005. [DOI] [PubMed] [Google Scholar]
47. Radford MG Jr, Donadio JV Jr, Bergstralh EJ, Grande JP. Predicting renal outcome in IgA nephropathy. J Am Soc Nephrol. 1997;8(2):199–207. [DOI] [PubMed] [Google Scholar]
48. Gong W, Mao S, Yu J, Song J, Jia Z, Huang S, et al. NLRP3 deletion protects against renal fibrosis and attenuates mitochondrial abnormality in mouse with 5/6 nephrectomy. Am J Physiol Ren Physiol. 2016;310(10):F1081–1088. [DOI] [PubMed] [Google Scholar]
49. Hrdlickova R, Toloue M, Tian B. RNA-Seq methods for transcriptome analysis. Wiley Interdiscip Rev RNA. 2017;8(1):e1364. [DOI] [PMC free article] [PubMed] [Google Scholar]
50. NCBI), N.C.f.B.I. Sequence Read Archive (SRA): accession PRJNA1355189. Available from: https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA1355189
51. miTED DLUo . MicroRNA tissue-expression database. Available from: https://www.dianalab.e-ce.uth.gr/mited/#/topExpressed [DOI] [PMC free article] [PubMed]
52. Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol. 2001;230(2):230–42. [DOI] [PubMed] [Google Scholar]
53. Jourde-Chiche N, Fakhouri F, Dou L, Bellien J, Burtey S, Frimat M, et al. Endothelium structure and function in kidney health and disease. Nat Rev Nephrol. 2019;15(2):87–108. [DOI] [PubMed] [Google Scholar]
54. Li X, Zhang Y, Xing X, Li M, Liu Y, Xu A, et al. Podocyte injury of diabetic nephropathy: novel mechanism discovery and therapeutic prospects. Biomed Pharmacother. 2023;168:115670. [DOI] [PubMed] [Google Scholar]
55. Liu Y. Kidney fibrosis: fundamental questions, challenges, and perspectives. Integr Med Nephrol Androl. 2024;11(4):e24–00027. [Google Scholar]
56. Cao Y, Tang S, Nie X, Zhou Z, Ruan G, Han W, et al. Decreased miR-214-3p activates NF-κB pathway and aggravates osteoarthritis progression. EBioMedicine. 2021;65:103283. [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Liu Y, Usa K, Wang F, Liu P, Geurts AM, Li J, et al. MicroRNA-214-3p in the kidney contributes to the development of hypertension. J Am Soc Nephrol. 2018;29(10):2518–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
58. Zhu X, Li W, Li H. miR-214 ameliorates acute kidney injury via targeting DKK3 and activating of Wnt/β-catenin signaling pathway. Biol Res. 2018;51(1):31. [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Denby L, Ramdas V, McBride MW, Wang J, Robinson H, McClure J, et al. miR-21 and miR-214 are consistently modulated during renal injury in rodent models. Am J Pathol. 2011;179(2):661–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
60. Ferenbach DA, Bonventre JV. Mechanisms of maladaptive repair after AKI leading to accelerated kidney ageing and CKD. Nat Rev Nephrol. 2015;11(5):264–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Wen Y, Parikh CR. Current concepts and advances in biomarkers of acute kidney injury. Crit Rev Clin Lab Sci. 2021;58(5):354–68. [DOI] [PubMed] [Google Scholar]
62. Yoshida Y, Matsunaga N, Nakao T, Hamamura K, Kondo H, Ide T, et al. Alteration of circadian machinery in monocytes underlies chronic kidney disease-associated cardiac inflammation and fibrosis. Nat Commun. 2021;12(1):2783. [DOI] [PMC free article] [PubMed] [Google Scholar]
63. Prieto-Carrasco R, García-Arroyo FE, Aparicio-Trejo OE, Rojas-Morales P, León-Contreras JC, Hernández-Pando R, et al. Progressive reduction in mitochondrial mass is triggered by alterations in mitochondrial biogenesis and dynamics in chronic kidney disease induced by 5/6 nephrectomy. Biology. 2021;10(5):349. [DOI] [PMC free article] [PubMed] [Google Scholar]
64. Gisterå A, Hansson GK. The immunology of atherosclerosis. Nat Rev Nephrol. 2017;13(6):368–80. [DOI] [PubMed] [Google Scholar]
65. Chung JYF, Zhang Y-Y, Ji ZZY, Tang T, Chen J-Y, Chi-Wai Tang S, et al. Immunodynamics of macrophages in renal fibrosis. Integr Med Nephrol Androl. 2023;10(3). [Google Scholar]
66. Oe Y, Hayashi S, Fushima T, Sato E, Kisu K, Sato H, et al. Coagulation factor Xa and protease-activated receptor 2 as novel therapeutic targets for diabetic nephropathy. Arterioscler Thromb Vasc Biol. 2016;36(8):1525–33. [DOI] [PubMed] [Google Scholar]
67. Shao B, Wei B. Glycolysis-driven renal fibrosis in chronic kidney disease: emerging mechanisms and therapeutic opportunities. Integr Med Nephrol Androl. 2025;12(4):e25–00038. [Google Scholar]
68. O’Shea JM, Perkins ND. Thr435 phosphorylation regulates RelA (p65) NF-kappaB subunit transactivation. Biochem J. 2010;426:345–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
69. Gantke T, Sriskantharajah S, Ley SC. Regulation and function of TPL-2, an IκB kinase-regulated MAP kinase kinase kinase. Cell Res. 2011;21(1):131–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
70. Jimi E, Takakura N, Hiura F, Nakamura I, Hirata-Tsuchiya S. The role of NF-κB in physiological bone development and inflammatory bone diseases: is NF-κB inhibition “killing two birds with one stone”? Cells. 2019;8(12):1636. [DOI] [PMC free article] [PubMed] [Google Scholar]
71. Korbecki J, Barczak K, Gutowska I, Chlubek D, Baranowska-Bosiacka I. CXCL1: gene, promoter, regulation of expression, mRNA stability, regulation of activity in the intercellular space. Int J Mol Sci. 2022;23(2):792. [DOI] [PMC free article] [PubMed] [Google Scholar]
72. Alix PM, Guebre-Egziabher F, Soulage CO. Leptin as an uremic toxin: deleterious role of leptin in chronic kidney disease. Biochimie. 2014;105:12–21. [DOI] [PubMed] [Google Scholar]
73. Mao S, Fang L, Liu F, Jiang S, Wu L, Zhang J. Leptin and chronic kidney diseases. J Receptor Signal Transduct Res. 2018;38(2):89–94. [DOI] [PubMed] [Google Scholar]
74. Chandrasekaran KS, Sathyanarayanan A, Karunagaran D. miR-214 activates TP53 but suppresses the expression of RELA, CTNNB1, and STAT3 in human cervical and colorectal cancer cells. Cell Biochem Funct. 2017;35(7):464–71. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary_material-Suppl.1-s1.tif^{(8.9MB, tif)}

Supplementary_material-Suppl.2-s2.docx^{(16.2KB, docx)}

Data Availability Statement

[B1] 1. Rudnick MR, Wahba IM, Leonberg-Yoo AK, Miskulin DLitt HI. Risks and options with gadolinium-based contrast agents in patients with CKD: a review. Am J Kidney Dis. 2021;77(4);517–28. [DOI] [PubMed] [Google Scholar]

[B2] 2. Wang B, Li ZL, Zhang YL, Wen Y, Gao YM, Liu BC. Hypoxia and chronic kidney disease. EBioMedicine. 2022;77:103942. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3. GBD Chronic Kidney Disease Collaboration . Global, regional, and national burden of chronic kidney disease, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2020;395:709–33. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Pietilä R, Marks-Hultström A, He L, Nanavazadeh S, Quaggin SE, Betsholtz C, et al. TIE2 activation by antibody-clustered endogenous angiopoietin-2 prevents capillary loss and fibrosis in experimental kidney disease. J Clin Investig. 2025;135(21):e190286. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5. Ortiz Segura MDC, Del Río Navarro BE, Rodríguez Espino BA, Marchat LA, Muñoz FS, Villafaña S, et al. Abnormality of adipokines and endothelial dysfunction in Mexican obese adolescents with insulin resistance. Endocr Res. 2017;42:1–8. [DOI] [PubMed] [Google Scholar]

[B6] 6. Saha D, Annadorai RK, Thannimangalath S, Shroff NP, Kataria S, Dam B, et al. Angiopoietin-like protein 2 mediates vasculopathy-driven fibrogenesis in a mouse model of systemic sclerosis. J Clin Investig. 2025;135(15):e177123. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7. Li L, Liao J, Zhang Y, Yao Z, Huang J, Wu K, et al. Single cell and spatial transcriptomics define a proinflammatory and profibrotic niche after Kidney Injury. Adv Sci. 2025;13(2):e03691. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. Jiang L, Zhang X, Wu X. Hypoxia-Induced metabolic reprogramming in the renal tubules of patients with diabetic kidney disease and the associated traditional Chinese medicine intervention strategies. Integr Med Nephrol Androl. 2025;12(4):e25–00019. [Google Scholar]

[B9] 9. Pawluczyk IZA, Bhachu JS, Brown JR, Lacey M, Mbadugha C, Straatman K, et al. B cell-derived exosomal miR-483-5p and its potential role in promoting kidney function loss in IgA nephropathy. Kidney Int. 2025;108(1):119–35. [DOI] [PubMed] [Google Scholar]

[B10] 10. Yang W, Yu T, Yang H, Yao S, Ma R, Steinert EM, et al. Intrinsic MicroRNA-10a restricts regulatory T cell suppressive function and intestinal repair by coordinating transcriptional, metabolic, and epithelial repair pathways. Adv Sci. 2025;13(4):e09953. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11. Wang R, Sun Y, Yu W, Yan Y, Qiao M, Jiang R, et al. Downregulation of miRNA-214 in cancer-associated fibroblasts contributes to migration and invasion of gastric cancer cells through targeting FGF9 and inducing EMT. J Exp Clin Cancer Res. 2019;38(1):20. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12. Peng R, Cheng X, Zhang Y, Lu X, Hu Z. miR-214 down-regulates MKK3 and suppresses malignant phenotypes of cervical cancer cells. Gene. 2020;724:144146. [DOI] [PubMed] [Google Scholar]

[B13] 13. Liu Y, Li Y, Wu Y, Zhao Y, Hu X, Sun C. The long non-coding RNA NEAT1 promotes the progression of human ovarian cancer through targeting miR-214-3p and regulating angiogenesis. J Ovarian Res. 2023;16(1):219. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. Huang X, Zheng D, Liu C, Huang J, Chen X, Zhong J, et al. miR-214 could promote myocardial fibrosis and cardiac mesenchymal transition in VMC mice through regulation of the p53 or PTEN-PI3K-Akt signali pathway, promoting CF proliferation and inhibiting its ng pathway. Int Immunopharmacol. 2023;124:110765. [DOI] [PubMed] [Google Scholar]

[B15] 15. Trevelyan CJ, MacCannell ADV, Stewart L, Tarousa T, Taylor HA, Murray M, et al. MiR-214-3p regulates Piezo1, lysyl oxidases and mitochondrial function in human cardiac fibroblasts. Matrix Biol. 2024;132:34–46. [DOI] [PubMed] [Google Scholar]

[B16] 16. Trevelin SC, Zampetaki A, Sawyer G, Ivetic A, Brewer AC, Smyth LA, et al. Nox2-deficient Tregs improve heart transplant outcomes via their increased graft recruitment and enhanced potency. JCI Insight. 2021;6(18):e149301. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17. Du Y, Wang X, Li L, Hao W, Zhang H, Li Y, et al. miRNA-Mediated suppression of a cardioprotective cardiokine as a novel mechanism exacerbating Post-MI remodeling by sleep breathing disorders. Circ Res. 2020;126(2):212–28. [DOI] [PubMed] [Google Scholar]

[B18] 18. Lan X, Yu R, Xu J, Jiang X. Exosomes from chondrocytes overexpressing miR-214-3p facilitate M2 macrophage polarization and angiogenesis to relieve Legg Calve-Perthes disease. Cytokine. 2023;168:156233. [DOI] [PubMed] [Google Scholar]

[B19] 19. Jo HR, Hwang J, Jeong JH. MicroRNA miR-214-5p induces senescence of microvascular endothelial cells by targeting the JAG1/Notch signaling pathway. Noncoding RNA Res. 2023;8(3):385–91. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20. Wang X, Li X, Li J, Zhai L, Liu D, Abdurahman A, et al. Mechanical loading stimulates bone angiogenesis through enhancing type H vessel formation and downregulating exosomal miR-214-3p from bone marrow-derived mesenchymal stem cells. FASEB J. 2021;35(1):e21150. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21. Liu F, Jiang LJ, Zhang YX, Xu ST, Liu SL, Ye JT, et al. Inhibition of miR-214-3p attenuates ferroptosis in myocardial infarction via regulating ME2. Biochem biophysical Res Commun. 2023;661:64–74. [DOI] [PubMed] [Google Scholar]

[B22] 22. Wugeng S, Zan S, Liu Y, Bai Y, Hu A, Wei X, et al. MicroRNA-214-3p protects against myocardial ischemia-reperfusion injury by targeting demethylase lysine demethylase 3A. Regen Ther. 2023;23:17–24. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23. Ryabov VV, Maslov LN, Vyshlov EV, Mukhomedzyanov AV, Kilin M, Gusakova SV, et al. Ferroptosis, a regulated form of cell death, as a target for the development of novel drugs preventing ischemia/reperfusion of cardiac injury, cardiomyopathy and stress-induced cardiac injury. Int J Mol Sci. 2024;25(2):897. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24. Chi B, Zou A, Mao L, Cai D, Xiao T, Wang Y, et al. Empagliflozin-Pretreated mesenchymal stem cell-derived small extracellular vesicles attenuated heart injury. Oxidative Med Cell longevity. 2023;2023:1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25. Sang Z, Dong S, Zhang P, Wei Y. miR-214 ameliorates sepsis-induced acute kidney injury via PTEN/AKT/mTOR-regulated autophagy. Mol Med Rep. 2021;24(4):683. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26. Ye W, Miao Q, Xu G, Jin K, Li X, Wu W, et al. CircRNA itchy E3 ubiquitin protein ligase improves mitochondrial dysfunction in sepsis-induced acute kidney injury by targeting microRNA-214-3p/ATP-binding cassette A1 axis. Ren Fail. 2023;45(2):2261552. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Liu M, Liu L, Bai M, Zhang L, Ma F, Yang X, et al. Hypoxia-induced activation of Twist/miR-214/E-cadherin axis promotes renal tubular epithelial cell mesenchymal transition and renal fibrosis. Biochem biophysical Res Commun. 2018;495(3):2324–30. [DOI] [PubMed] [Google Scholar]

[B28] 28. Hu Q, Zhao M, Wang H, Li X, Wang F, Zhang H, et al. Niao-Du-Kang granules regulate autophagy of diabetic nephropathy via the miR-214-3p/SIRT1 signaling pathway. J Ethnopharmacol. 2025;352:120175. [DOI] [PubMed] [Google Scholar]

[B29] 29. Bai M, Chen H, Ding D, Song R, Lin J, Zhang Y, et al. MicroRNA-214 promotes chronic kidney disease by disrupting mitochondrial oxidative phosphorylation. Kidney Int. 2019;95(6):1389–404. [DOI] [PubMed] [Google Scholar]

[B30] 30. Denby L, Ramdas V, Lu R, Conway BR, Grant JS, Dickinson B, et al. MicroRNA-214 antagonism protects against renal fibrosis. J Am Soc Nephrol. 2014;25(1):65–80. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. Hack CE, Zeerleder S. The endothelium in sepsis: source of and a target for inflammation. Crit Care Med. 2001;29:S21–7. [DOI] [PubMed] [Google Scholar]

[B32] 32. Hasegawa K, Kawashima N, Kawabata A, Sakakura M, Onoda N, Sano T, et al. Inflammation-associated molecules in the glomerular-endothelium in mild IgA-nephropathy patients identified by single-cell and spatial transcriptome. Commun Biol. 2025;8(1):915. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33. Groten SA, Smit ER, Janssen EFJ, van den Eshof BL, van Alphen FPJ, van der Zwaan C, et al. Multi-omics delineation of cytokine-induced endothelial inflammatory states. Commun Biol. 2023;6(1):525. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Nosalski R, Siedlinski M, Denby L, McGinnigle E, Nowak M, Cat AND, et al. T-Cell-Derived miRNA-214 mediates perivascular fibrosis in hypertension. Circ Res. 2020;126(8):988–1003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35. Guo C, Ye FX, Jian YH, Liu CH, Tu ZH, Yang DP, MicroRNA-214-5p aggravates sepsis-related acute kidney injury in mice. Drug Dev Res. 2022;83(2):339–50. [DOI] [PubMed] [Google Scholar]

[B36] 36. Hou D, Wu Q, Wang S, Pang S, Liang H, Lyu H, et al. Knockdown of miR-214 alleviates renal interstitial fibrosis by targeting the regulation of the PTEN/PI3K/AKT signalling pathway. Oxid Med Cell Longev. 2022;2022(1):7553928. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37. Aurora AB, Mahmoud AI, Luo X, Johnson BA, van Rooij E, Matsuzaki S, et al. MicroRNA-214 protects the mouse heart from ischemic injury by controlling Ca²⁺ overload and cell death. J Clin Investig. 2012;122(4):1222–32. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38. Li S, Liu B, Kang S, Yang B, Zhang Y, Huang S, et al. Endothelial MicroRNA-214 confers angiotensin II hypertension by targeting eNOS in mice. Kidney Blood Press Res. 2025;50(1):442–59. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39. Mokady D, Charish J, Barretto-Burns P, Grisé KN, Coles BLK, Raab S, et al. Small-molecule-directed endogenous regeneration of visual function in a Mammalian retinal degeneration model. Int J Mol Sci. 2024;25(3):1521. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40. Yang CJ, Wang JT, Yang JL, Chuang YC. Comparative efficacy of high-dose daptomycin monotherapy versus combination therapy for daptomycin-resistant enterococcus faecium endocarditis in a rat model. Infect Drug Resist. 2025;18:6865–74. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] 41. Souza AC, Tsuji T, Baranova IN, Bocharov AV, Wilkins KJ, Street JM, et al. TLR4 mutant mice are protected from renal fibrosis and chronic kidney disease progression. Physiol Rep. 2015;3(9):e12558. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42. Bai M, Wu M, Jiang M, He J, Deng X, Xu S, et al. LONP1 targets HMGCS2 to protect mitochondrial function and attenuate chronic kidney disease. EMBO Mol Med. 2023;15(2):e16581. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43. Chen XM, Kuang JB, Yu HY, Wu ZN, Wang SY, Zhou SY. A novel rabbit dry eye model induced by a controlled drying system. Transl Vis Sci Technol. 2021;10(4):32. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44. Bai M, Xu S, Jiang M, Guo Y, Hu D, He J, et al. Meis1 targets protein tyrosine phosphatase receptor J in fibroblast to retard chronic kidney disease progression. Adv Sci. 2024;11(39):e2309754. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45. Street JM, Souza AC, Alvarez-Prats A, Horino T, Hu X, Yuen PS, et al. Automated quantification of renal fibrosis with sirius red and polarization contrast microscopy. Physiol Rep. 2014;2(7):e12088. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46. Huang XZ, Wen D, Zhang M, Xie Q, Ma L, Guan Y, et al. Sirt1 activation ameliorates renal fibrosis by inhibiting the TGF-beta/Smad3 pathway. J Cell Biochem. 2014;115(5):996–1005. [DOI] [PubMed] [Google Scholar]

[B47] 47. Radford MG Jr, Donadio JV Jr, Bergstralh EJ, Grande JP. Predicting renal outcome in IgA nephropathy. J Am Soc Nephrol. 1997;8(2):199–207. [DOI] [PubMed] [Google Scholar]

[B48] 48. Gong W, Mao S, Yu J, Song J, Jia Z, Huang S, et al. NLRP3 deletion protects against renal fibrosis and attenuates mitochondrial abnormality in mouse with 5/6 nephrectomy. Am J Physiol Ren Physiol. 2016;310(10):F1081–1088. [DOI] [PubMed] [Google Scholar]

[B49] 49. Hrdlickova R, Toloue M, Tian B. RNA-Seq methods for transcriptome analysis. Wiley Interdiscip Rev RNA. 2017;8(1):e1364. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B50] 50. NCBI), N.C.f.B.I. Sequence Read Archive (SRA): accession PRJNA1355189. Available from: https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA1355189

[B51] 51. miTED DLUo . MicroRNA tissue-expression database. Available from: https://www.dianalab.e-ce.uth.gr/mited/#/topExpressed [DOI] [PMC free article] [PubMed]

[B52] 52. Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol. 2001;230(2):230–42. [DOI] [PubMed] [Google Scholar]

[B53] 53. Jourde-Chiche N, Fakhouri F, Dou L, Bellien J, Burtey S, Frimat M, et al. Endothelium structure and function in kidney health and disease. Nat Rev Nephrol. 2019;15(2):87–108. [DOI] [PubMed] [Google Scholar]

[B54] 54. Li X, Zhang Y, Xing X, Li M, Liu Y, Xu A, et al. Podocyte injury of diabetic nephropathy: novel mechanism discovery and therapeutic prospects. Biomed Pharmacother. 2023;168:115670. [DOI] [PubMed] [Google Scholar]

[B55] 55. Liu Y. Kidney fibrosis: fundamental questions, challenges, and perspectives. Integr Med Nephrol Androl. 2024;11(4):e24–00027. [Google Scholar]

[B56] 56. Cao Y, Tang S, Nie X, Zhou Z, Ruan G, Han W, et al. Decreased miR-214-3p activates NF-κB pathway and aggravates osteoarthritis progression. EBioMedicine. 2021;65:103283. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] 57. Liu Y, Usa K, Wang F, Liu P, Geurts AM, Li J, et al. MicroRNA-214-3p in the kidney contributes to the development of hypertension. J Am Soc Nephrol. 2018;29(10):2518–28. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 58. Zhu X, Li W, Li H. miR-214 ameliorates acute kidney injury via targeting DKK3 and activating of Wnt/β-catenin signaling pathway. Biol Res. 2018;51(1):31. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59. Denby L, Ramdas V, McBride MW, Wang J, Robinson H, McClure J, et al. miR-21 and miR-214 are consistently modulated during renal injury in rodent models. Am J Pathol. 2011;179(2):661–72. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60. Ferenbach DA, Bonventre JV. Mechanisms of maladaptive repair after AKI leading to accelerated kidney ageing and CKD. Nat Rev Nephrol. 2015;11(5):264–76. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 61. Wen Y, Parikh CR. Current concepts and advances in biomarkers of acute kidney injury. Crit Rev Clin Lab Sci. 2021;58(5):354–68. [DOI] [PubMed] [Google Scholar]

[B62] 62. Yoshida Y, Matsunaga N, Nakao T, Hamamura K, Kondo H, Ide T, et al. Alteration of circadian machinery in monocytes underlies chronic kidney disease-associated cardiac inflammation and fibrosis. Nat Commun. 2021;12(1):2783. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B63] 63. Prieto-Carrasco R, García-Arroyo FE, Aparicio-Trejo OE, Rojas-Morales P, León-Contreras JC, Hernández-Pando R, et al. Progressive reduction in mitochondrial mass is triggered by alterations in mitochondrial biogenesis and dynamics in chronic kidney disease induced by 5/6 nephrectomy. Biology. 2021;10(5):349. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B64] 64. Gisterå A, Hansson GK. The immunology of atherosclerosis. Nat Rev Nephrol. 2017;13(6):368–80. [DOI] [PubMed] [Google Scholar]

[B65] 65. Chung JYF, Zhang Y-Y, Ji ZZY, Tang T, Chen J-Y, Chi-Wai Tang S, et al. Immunodynamics of macrophages in renal fibrosis. Integr Med Nephrol Androl. 2023;10(3). [Google Scholar]

[B66] 66. Oe Y, Hayashi S, Fushima T, Sato E, Kisu K, Sato H, et al. Coagulation factor Xa and protease-activated receptor 2 as novel therapeutic targets for diabetic nephropathy. Arterioscler Thromb Vasc Biol. 2016;36(8):1525–33. [DOI] [PubMed] [Google Scholar]

[B67] 67. Shao B, Wei B. Glycolysis-driven renal fibrosis in chronic kidney disease: emerging mechanisms and therapeutic opportunities. Integr Med Nephrol Androl. 2025;12(4):e25–00038. [Google Scholar]

[B68] 68. O’Shea JM, Perkins ND. Thr435 phosphorylation regulates RelA (p65) NF-kappaB subunit transactivation. Biochem J. 2010;426:345–54. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B69] 69. Gantke T, Sriskantharajah S, Ley SC. Regulation and function of TPL-2, an IκB kinase-regulated MAP kinase kinase kinase. Cell Res. 2011;21(1):131–45. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B70] 70. Jimi E, Takakura N, Hiura F, Nakamura I, Hirata-Tsuchiya S. The role of NF-κB in physiological bone development and inflammatory bone diseases: is NF-κB inhibition “killing two birds with one stone”? Cells. 2019;8(12):1636. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B71] 71. Korbecki J, Barczak K, Gutowska I, Chlubek D, Baranowska-Bosiacka I. CXCL1: gene, promoter, regulation of expression, mRNA stability, regulation of activity in the intercellular space. Int J Mol Sci. 2022;23(2):792. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B72] 72. Alix PM, Guebre-Egziabher F, Soulage CO. Leptin as an uremic toxin: deleterious role of leptin in chronic kidney disease. Biochimie. 2014;105:12–21. [DOI] [PubMed] [Google Scholar]

[B73] 73. Mao S, Fang L, Liu F, Jiang S, Wu L, Zhang J. Leptin and chronic kidney diseases. J Receptor Signal Transduct Res. 2018;38(2):89–94. [DOI] [PubMed] [Google Scholar]

[B74] 74. Chandrasekaran KS, Sathyanarayanan A, Karunagaran D. miR-214 activates TP53 but suppresses the expression of RELA, CTNNB1, and STAT3 in human cervical and colorectal cancer cells. Cell Biochem Funct. 2017;35(7):464–71. [DOI] [PubMed] [Google Scholar]

PERMALINK

Enhanced miR-214 in Vascular Endothelial Cells Retards Renal Inflammation and Glomerular Sclerosis in Five-Sixths Nephrectomy Mice

Lingxiao Tan

Xinwen Fan

Xiaolu Zhang

Shanshan Li

Bingyu Yang

Yue Zhang

Songming Huang

Zhanjun Jia

Wei Gong

Aihua Zhang

Shuzhen Li

Abstract

Introduction

Methods

Results

Conclusion

Plain Language Summary

Introduction

Methods

Animals

5/6Nx Animal Model

Histological Analysis

Noninvasive Blood Pressure Analysis

Urine Collection and Analysis

RNA Extraction and Quantitative Reverse Transcription Polymerase Chain Reaction

Table 1.

Western Blot Analysis

Table 2.

Cell Culture and Transfection

Isolation of Primary Mouse Renal Endothelial Cells

Transmission Electron Microscopy

Terminal Deoxynucleotidyl Transferase Staining

Dual-Luciferase Reporter Assay

RNA-Sequencing Transcriptome Analysis

Inflammation Array

Statistical Analysis

Results

Endothelial Cell-Specific Knockout of miR-214 Aggravates 5/6Nx-Induced Renal Dysfunction

Fig. 1.

Endothelial Cell-Specific Knockout of miR-214 Aggravates 5/6Nx-Induced Glomerulosclerosis

Fig. 2.

Endothelial Cell-Specific Knockout of miR-214 Aggravates 5/6Nx-Induced Renal Inflammation

Fig. 3.

Knockout of Endothelial miR-214 Aggravates 5/6Nx-Induced Renal Apoptosis

Fig. 4.

Knockout of Endothelial miR-214 Aggravates Endothelial Cell and Podocyte Damage in the 5/6Nx Model

Fig. 5.

Endothelial miR-214 Interacts with the RELA 3′-UTR and Regulates RELA Expression

Fig. 6.

Endothelial miR-214 Regulates RELA-Associated Signaling in vivo

Fig. 7.

miR-214 Attenuates RELA-Associated Inflammation in Endothelial Cells under Pro-Inflammatory Stimulation

Fig. 8.

Fig. 9.

miR-214 Deficiency in Vascular Smooth Muscle Cells Does Not Affect 5/6Nx-Induced Glomerulosclerosis

Discussion

Conclusion

Statement of Ethics

Conflict of Interest Statement

Funding Sources

Author Contributions

Funding Statement

Data Availability Statement

Supplementary Material.

Supplementary Material.

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases