ABSTRACT
A nucleotide substitution in the intron 6 donor splice site gives rise to the novel HLA‐C*12:02:02:24Q allele.
Keywords: HLA typing, HLA‐C*12:02:02:24Q, splice site
Single nucleotide polymorphisms in splice sites have been strongly associated with translation disruption, producing truncated or variant proteins, which may produce null (N) or questionable (Q) alleles [1, 2].
Here, we describe a novel HLA‐C allele, a variant of the HLA‐C*12:02:02:01 allele which presented a single nucleotide substitution within the donor splice site of intron 6. This novel allele was identified in a female volunteer bone marrow donor during routine HLA‐typing by next‐generation sequencing (NGS). Briefly, genomic DNA was extracted from buccal swab ORAcollect DNA (DNA Genotek Inc., Ottawa, Canada) using Maxwell RSC Buffy Coat DNA Kit (Promega, Madison, Wisconsin) and the extractor Maxwell16 (Promega, Madison, Wisconsin). The NGS protocol was assessed in duplicate using NGSgo‐MX11‐3 (EurobioGenDx, The Netherlands) and AlloSeq Tx9 (CareDx, USA) and the MiniSeq platform (Illumina, California). Data were analysed according to the NGSengine software, the AlloSeq Assign software and version 3.51 of the IPD‐IMGT/HLA Database (January 2023).
HLA sequencing gave the assignment of HLA‐C*16:02:01:01 and HLA‐C*12var after complete genomic HLA‐C analysis in a single phase. The HLA‐C*12var, grouped within HLA‐C*12:02P, showed a single nucleotide substitution in the donor splice site of intron 6 respect to its closest HLA‐C*12:02:02:01 allele. The nucleotide substitution was located at genomic position 2572 (G>T) (Figure 1).
FIGURE 1.
Alignment of the exon 6 and intron 6 sequence of the novel HLA‐C*12:02:02:24Q with the most closely related HLA‐C*12:02:02:01 allele. HLA‐C*12:02:02:24Q showed a single nucleotide substitution at genomic position 2572 (G>T). Dashes (−) indicate nucleotide identity with HLA‐C*12:02:02:01, numbers above the sequence correspond to the genomic position and exon/intron boundary is indicated by pipe (|).
The nucleotide sequence of the novel allele was submitted to the GenBank Database (accession number: OQ579014) and to the IPD‐IMGT/HLA Database (submission number: HWS10065797). The name C*12:02:02:24Q has been officially assigned by the World Health Organization (WHO) Nomenclature Committee for Factors of the HLA System in April 2023. This follows the agreed policy that, subject to the conditions stated in the most recent Nomenclature Report [3] names would be assigned to new sequences as they are identified. Lists of such new names will be published in the following WHO Nomenclature Report.
Complete high‐resolution HLA typing of the donor was: HLA‐A*02:01:01, 32:01:01:16; ‐C*12:02:02:24Q, 16:02:01:01; ‐B*51:01:01, 52:01:01; ‐DRB1*07:01:01, 13:01:01; ‐DRB3*01:01:02; ‐DRB4*01:01P; ‐DQA1*01:03:01:10, 02:01:01; ‐DQB1*02:02:01:01, 06:03:01:02; ‐DPA1*01:03:01, ‐; ‐DPB1*02:01:02, 04:01:01.
This nucleotide substitution gives rise to the first identified HLA‐C allele with a change in the intron 6 donor splice site. To evaluate the impact of this change on splicing specificity, we analysed intron 6 sequence of the novel allele and its closest counterpart using the online available tools: Human Splicing Finder (HSF) Pro [4] and MaxEntScan [5]. As expected, both alleles showed the same branch point motif (AGCTCAC) with the highest strength (90.93). Furthermore, the acceptor splice site motifs with the highest scores identified by both tools were identical in the novel allele and its closest counterpart: GTTCTACCCCAGCC (82.96) according to HSF Pro and TTTTTTTTGTTCTACCCCAGCCA (7.7) according to MaxEntScan. However, analysis of the donor splice site revealed differences between the two alleles. For the HLA‐C*12:02:02:01 allele, the donor splice site motif with the highest strength was CGTGTAAGT (83.39 in HSF Pro; 8.58 in MaxEntScan). In contrast, for the novel allele, the highest‐scoring donor splice site motif identified by both tools was GCGGTGGGC (79.75 in HSF Pro; 4.7 in MaxEntScan).
This alteration suggests a potential expansion of exon 6 (TTT AAG TGA TGG CG), introducing a premature stop‐codon (TGA), which could result in the absence of cell surface expression. Similarly, Marín Rubio et al. demonstrated that previously named HLA‐DQB1*03:01:01:21Q allele was non‐expressed, due to a change in the donor splice site of intron 3, which extended exon 3 and generated a premature stop codon, favouring its reclassification as HLA‐DQB1*03:01:01:21N [6]. These findings suggest that expression patterns of the novel HLA‐C*12:02:02:24Q, as well as other Q alleles, should be investigated to clarify if they are expressed on the cell surface and capable of inducing immunological responses, since this could be particularly relevant in clinical settings, especially in transplantation.
Author Contributions
Francisco Javier Gil‐Etayo: analysing data, writing and discussion of the manuscript. Jairo Eduardo Niño Ramírez: analysing data, reviewing and discussion of the manuscript. María Pilar Terradillos Sánchez: technical work and reviewing. Daniel Arroyo‐Sánchez: reviewing and discussion of the manuscript. Amalia Tejeda Velarde: analysing data, sequence submission, writing, reviewing and discussion of the manuscript. All authors have read and approved the final manuscript.
Funding
This work was supported by the Gerencia Regional de Salud de Castilla y León Grant number: GRS 3060/A1/2024.
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgements
Authors acknowledge Isabel Jiménez Hernaz, Nuria Calzada Nieto and Ariadna Vicente Parra for their excellent technical support.
Contributor Information
Francisco Javier Gil‐Etayo, Email: fjgile@saludcastillayleon.es.
Amalia Tejeda Velarde, Email: atejeda@saludcastillayleon.es.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request. The sequence of this HLA allele is freely available in the IPD‐IMGT/HLA Database (submission number: HWS10065797). GenBank accession number: OQ579014.
References
- 1. Kurmangaliyev Y. Z., Sutormin R. A., Naumenko S. A., Bazykin G. A., and Gelfand M. S., “Functional Implications of Splicing Polymorphisms in the Human Genome,” Human Molecular Genetics 22, no. 17 (2013): 3449–3459. [DOI] [PubMed] [Google Scholar]
- 2. Barker D. J., Natarajan R. H. L., Cooper M. A., et al., “The IPD‐IMGT/HLA Database: Recent Developments in Sequence Submission,” Nucleic Acids Research 54 (2026): D1152–D1158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Marsh S. G. E., Osoegawa K., Bodmer W. F., et al., “Nomenclature for Factors of the HLA System, 2026,” HLA 107 (2026): e70595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Desmet F. O., Hamroun D., Lalande M., Collod‐Béroud G., Claustres M., and Béroud C., “Human Splicing Finder: An Online Bioinformatics Tool to Predict Splicing Signals,” Nucleic Acids Research 37, no. 9 (2009): e67, 10.1093/nar/gkp215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Yeo G. and Burge C. B., “Maximum Entropy Modeling of Short Sequence Motifs With Applications to RNA Splicing Signals,” Journal of Computational Biology 11, no. 2–3 (2004): 377–394. [DOI] [PubMed] [Google Scholar]
- 6. Marin Rubio L. A., Aroca‐Aguilar J. D., Luis‐Hidalgo M., Escribano J., and Ontañon J., “RNA and Protein Expression Analysis of HLA‐DQB1*03:01:01:21Q Allele: A Null Allele Renamed as HLA‐DQB1*03:01:01:21N,” HLA 99, no. 3 (2022): 160–166. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request. The sequence of this HLA allele is freely available in the IPD‐IMGT/HLA Database (submission number: HWS10065797). GenBank accession number: OQ579014.