Abstract
Objective
The mechanisms by which type II diabetes mellitus (T2DM) impairs tooth supraeruption following tooth loss remain incompletely understood, with evidence suggesting disruption of alveolar bone remodeling. This study aimed to investigate the effects of T2DM on apical alveolar bone remodeling during tooth supraeruption in a mouse model.
Methods
A T2DM mouse model with unopposed mandibular molars was established, including a control group (n = 70) and an experimental T2DM group (n = 70). We systematically analyzed periapical alveolar bone volume, periodontal ligament morphology, supraeruption distance, and histomorphometric counts of osteoblasts and osteoclasts. mRNA expression levels of osteogenesis-related factors were assessed by real-time quantitative polymerase chain reaction (RT-qPCR). Protein expression was evaluated by immunohistochemistry. Data were analyzed using Student’s t-test, with significance set at P < 0.05.
Results
T2DM significantly altered the alveolar bone remodeling microenvironment. The diabetic group exhibited reduced osteoblast numbers and decreased mRNA expression of transforming growth factor-β (Tgf-β), insulin-like growth factor-1 (Igf-1) and periostin (Postn), as well as reduced protein expression of TGF-β, IGF-1, and POSTN (P < 0.05). Conversely, osteoclast numbers were increased, accompanied by elevated Runx2 mRNA and RUNX2 protein expression (P < 0.05). This bone imbalance resulted in reduced periapical bone volume and disorganized periodontal tissue structure. Consequently, the degree of tooth supraeruption was significantly reduced in T2DM mice compared to controls (P < 0.05).
Conclusion
T2DM impairs tooth supraeruption by downregulating osteoblast-related factors, increasing osteoclast numbers and activity, and disrupting alveolar bone remodeling capacity. This study provides a theoretical foundation for future clinical research on the mechanism by which type 2 diabetes mellitus affects tooth supraeruption.
Keywords: Type II diabetes mellitus, Alveolar bone, Supraeruption, Osteoblasts, Osteoclasts
Introduction
Diabetes mellitus is a chronic metabolic disorder characterized by hyperglycemia resulting from insulin deficiency or resistance [1, 2]. The prevalence of T2DM is steadily increasing worldwide [3]. Related studies indicate that diabetes can alter the remodeling of both periodontal soft tissues and alveolar bone, thereby exerting varying degrees of influence on tooth movement [4]. Supraeruption is a type of post-eruptive tooth movement characterized by the continuous or excessive axial elongation of a tooth following the loss of its antagonist [5]. Diabetes may impact both normal physiological tooth eruption and supraeruption following tooth loss, though the latter is the focus of this study [6]. By investigating whether T2DM affects the remodeling of periodontal soft tissues and periapical alveolar bone, this study aims to provide a theoretical basis for understanding tooth supraeruption in patients with T2DM.We hypothesized that T2DM impairs tooth supraeruption by disrupting the balance between osteoblast and osteoclast activity in periapical alveolar bone.
During tooth supraeruption, osteoblasts and osteoclasts are essential for alveolar bone remodeling. Previous studies have demonstrated that diabetes affects the differentiation and function of both cell types [7]. Specifically, diabetes disrupts alveolar bone metabolism by increasing osteoblast apoptosis and promoting osteoclast differentiation and activity [8]. Under normal conditions, alveolar bone absorption and new bone formation happen at the same time. Mesenchymal stem cells (MSCs) are the source of osteoblasts, while the hematopoietic monocyte-macrophage system is the source of osteoclasts. Both contribute to alveolar bone remodeling [9]. Meanwhile, alveolar bone growth is encouraged and tooth supraeruption is propelled by osteoprogenitor cells on the surface of the periapical alveolar bone that differentiate into osteoblasts. A balanced environment for tooth supraeruption is created by osteoclasts’ simultaneous resorption of periapical alveolar bone. Osteoblasts and osteoclasts are widely recognized as the key cells involved in bone remodeling and regeneration [10]. Diabetes disrupts this normal process by suppressing osteoblast formation and function while simultaneously promoting the generation and activation of osteoclasts. T2DM is associated with a systemic inflammatory state, in which pro-inflammatory mediators such as tumor necrosis factor (TNF) are upregulated in bone tissue This inflammatory milieu enhances the expression of transcription factors like RUNX2 that promote osteoclastogenesis and activates nuclear factor signaling pathways in osteoclasts [11]. The differentiation and function of osteoclasts are closely associated with the expression of RUNX2. Diabetes promotes osteoclast differentiation by enhancing RUNX2 expression [12], which in turn disrupts the balance between osteoprotegerin (OPG) and receptor activator of nuclear factor kappa-B ligand (RANKL)—both crucial regulators of osteoclast differentiation. RUNX2 facilitates the translocation of RANKL to the surface of bone marrow pre-osteoblasts, where it binds to the RANK receptor on adjacent monocytes, thereby stimulating osteoclast development [13]. Furthermore, while RUNX2 activates the transcription of osteogenic genes such as osteocalcin, bone sialoprotein, and type I collagen, it also promotes osteoclastogenesis by upregulating RANKL expression and inhibiting osteoprotegerin production [14].
Alveolar bone remodeling involves both bone resorption and bone creation. In periosteal bone formation, TGF-β, IGF-1 and POSTN are important factors that directly affect osteoblast activity [15–17]. These factors are secreted by osteoblasts and other bone cells and are essential for osteoblast development and proliferation. The proliferation and differentiation of osteoprogenitor cells are significantly influenced by the autocrine and paracrine stimulation of TGF-β [18]. Preosteoblasts, mature osteoblasts, and bone cells all manufacture IGF-1 [19], which also functions as a paracrine factor. Its signaling is essential for strengthening osteoblast function, encouraging early osteoblast differentiation, and increasing mineralization activity in mature osteoblasts. POSTN, formerly known as osteoblast-specific factor, was discovered as a potential cell adhesion protein for preosteoblasts in a mouse osteoblastic cell line [20]. Fibroblasts and osteoblasts in the periodontal ligament (PDL) secrete POSTN. Research has shown that POSTN is present in osteoblasts, preosteoblasts, and osteoblasts that line the trabeculae of bone.
In this study, we examined the mass of the alveolar bone, the supraeruption of the teeth, and the morphology of the periodontal ligament in the unopposed molars model of T2DM mice. We also examined the associated molecular mechanisms based on aberrant expression of factors related to osteoblasts and osteoclasts. This study provides a theoretical foundation for the phenomenon of slowed tooth supraeruption in patients with type 2 diabetes.
Materials and methods
Unopposed molar of T2DM mice model
140 6-week-old C57 BL/6J mice, obtained from the Animal Experiment Center of Shanxi Medical University (Taiyuan, China), were used in the experiment. The mice were split into two groups at random: 70 mice in the T2DM group and 70 mice in the control group. Following a week of acclimatization, the mice were given free access to water and fasted for 10 h. For five days in a row, the T2DM group was given intraperitoneal injections of streptozotocin (STZ), which was made by dissolving the powder in sodium citrate buffer (0.1 mol/L, pH = 4.2). No treatment was given to the control group. 72 h following the last injection, tail blood glucose readings were taken. A total of four blood glucose tests were conducted, one every week. The mouse model of type 2 diabetes was deemed properly established when the fasting blood glucose level was ≥ 11.1 mmol/L [21], and the mice were fasted for 10 h prior to each measurement. The diet of the T2DM group was rich in fat and sugar. The mice’s water intake, food consumption, urine output, and body weight changes were all noted over the modeling period. Symptoms including “polyphagia, polydipsia, polyuria, and weight loss” appeared in the T2DM group of 70 mice after they were administered following the methodology [22]. In the T2DM group, 65 mice survived, with a survival rate of 92%. Five mice in the T2DM group died during STZ injection and the following week (mortality 7.1%) and were excluded from all analyses; the remaining 65 T2DM mice and 65 randomly selected control mice were used for all experiments. 65 mice from the T2DM group and 65 randomly selected mice from the control group were anesthetized with 2 ml/20 g doses of 1% pentobarbital sodium. Following tooth extraction, the right lower molars were allowed to grow naturally, but the right upper three molars were removed. The unopposed molar of T2DM mice model was established by giving all mice unrestricted access to food and drink following tooth extraction. The model’s construction ultimately took roughly six weeks. Five subgroups were created from the T2DM and control groups: 0, 3, 6, 9, and 12-day groups after tooth extraction. At the appropriate time, the mice in each group were euthanized.
Animal euthanasia
Mice were euthanized at the indicated time points (0, 3, 6, 9, and 12 days post‑extraction) using an overdose of isoflurane anesthesia. Specifically, animals were placed in an induction chamber saturated with 5% isoflurane delivered in 100% oxygen at a flow rate of 1 L/min. Loss of consciousness was confirmed by loss of righting reflex and absence of response to toe pinch. After the animals became deeply unconscious, isoflurane exposure was continued for an additional 5 min to ensure death. Cervical dislocation was then performed as a secondary method to confirm euthanasia. This method is consistent with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals and was approved by our institutional animal care committee (Ethical number: DW2022038). The rationale for using isoflurane overdose is to minimize pain and distress while ensuring rapid and humane sacrifice.
Histological analysis
Specimens of the mandible were gathered, decalcified for 30 to 40 days in 10% EDTA, and then fixed for 24 h in 10% neutral formalin. After decalcification and paraffin embedding, the samples were separated into longitudinal 4 mm sagittal slices along the molar axis and stained with hematoxylin and eosin (H&E), alkaline phosphatase (ALP), and tartrate resistant acid phosphatase (TRAP). Microscopic observations were made using an Olympus microscope in the scanning system, and analysis was done using Spectrum software (Olympus). Following the observation of H&E staining results in mice from both the T2DM and control groups on day 12 post-tooth extraction, five high-power fields were selected at the 1/3 position of the roots of the bilateral first molars to assess the breadth of the periodontal ligament. The average value was calculated using the left mandibular molar of the same mouse was served as an internal control. Ten high-power fields were randomly chosen from each group of T2DM and control slices to see and count osteoblasts based on the findings of ALP staining in groups at 0,3,6,9,12 days after tooth extraction. The same technique was used to determine the number and shape of osteoclasts using TRAP staining.
Immunohistochemical labeling was performed to detect TGF-β, IGF-1, POSTN, and RUNX2 protein expression in periapical tissues. Briefly, paraffin-embedded Sect. (4 μm) were deparaffinized, rehydrated, and treated with 3% hydrogen peroxide to block endogenous peroxidase activity. Antigen retrieval was performed by microwaving sections in sodium citrate buffer (0.01 M, pH 6.0) for 15 min. After blocking with 5% normal goat serum for 30 min, sections were incubated overnight at 4 °C with primary antibodies: rabbit anti-mouse TGF-β (1:200, Abcam, ab215715), rabbit anti-mouse IGF-1 (1:100, Abcam, ab9572), rabbit anti-mouse POSTN (1:150, Abcam, ab315104), and rabbit anti-mouse RUNX2 (1:100, Abcam, ab192256). Sections incubated without primary antibody served as negative controls. Known positive control tissues (mouse bone tissue) were included in each staining run to validate antibody specificity. After washing, sections were incubated with HRP-conjugated goat anti-rabbit secondary antibody (1:500, Abcam, ab205718) for 1 h at room temperature. Immunoreactivity was visualized using diaminobenzidine (DAB), followed by counterstaining with hematoxylin.
Quantitative analysis of positive area percentage was performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA). Five random high-power fields (×400) were captured per section. A consistent color threshold was applied to identify DAB-positive areas, and the percentage of positive area relative to the total tissue area was calculated for each field. The mean value of five fields was taken as the positive expression rate for each specimen. All images were acquired under identical lighting and exposure conditions.
RT-qPCR analyses
For each subgroup, three mice were randomly selected, and their right mandibles were harvested and frozen at -80 °C for RT-qPCR analysis (total n = 15 per group). The right mandibles of three mice were frozen at -80 °C. Tgf-β, Igf-1, Postn, and Runx2 CT levels were measured in the T2DM and control groups. The relative expression levels of Tgf-β, Igf-1, Postn, and Runx2 in T2DM mice relative to control mice were determined using the 2-∆∆Ct technique. Additionally, the expression levels of both groups at 3, 6, 9, and 12 days in comparison to the 0-day group were also calculated. We used the Sprint RT Complete kit (Clontech) to perform RT-qPCR on RNA. DLUX fluorescent primers and the Taqman Fast Universal PCR Master Mix (Applied Biosystems) were used to conduct RT-qPCR. 30 s at 95 °C (1 cycle), 5 s at 95 °C, and 30 s at 60 °C (40 cycles) were the reaction conditions. PCR products were continually monitored by Applied Biosystems’ ABI PRISM 7900 detection equipment. The RT-qPCR analysis primer sequences are given . GraphPad Prism software was used to plot the CT values for each group after they were computed and processed in accordance with 2−∆∆Ct.
| GENE | Forward primer (5’-3’) | Reverse primer (5’-3’) |
|---|---|---|
| Tgf-β | TGGAGCAACATGTGGAACTC | GTCAGCAGCCGGTTACCA |
| Igf-1 | GGTGGATGCTCTTCAGTTCG | GCACAGTACATCTCCACTCTCC |
| Postn | TGGTATCAAGGTGCTATCTGCG | AATGCCCAGCGTGCCATAA |
| Runx2 | GCCCACTGGTGCCCAAGACC | CGTGTGGAAGACAGCGGCGT |
Measurement of mandibular bone mass and supraeruption distance in molars
For scanning and three-dimensional reconstruction, the mice’s right mandibles from each group were put inside the Viva CT80 Micro CT scanner. Based on post-scan data analysis, bone volume fractions (BV/TV) were calculated. The results show how much mandibular bone each group of mice had in relation to variations in bone volume. After that, the buccal side was positioned outward for scanning in the Viva CT80 Micro CT scanner. The reference plane for the photographs was the line joining the summits of the bilateral mandibular angles. image processing using 3D reconstruction software (Scorio Medical’s mCT Evaluation Program v6.0). The line connecting the tangent points of the upper margins of the mandibular foramen on both sides was used as the reference line, and the highest point of the mouse’s right mandibular first molar was used as the reference point. The distances from the reference point to the reference line were measured on days 0 and 12, respectively, and the supraeruption distance was calculated by subtracting the distance on day 0 from the distance on day 12. The same experimenter collected the measurements under the identical circumstances, and each set of data was averaged.
Statistical methods
SPSS 21.0 software was used to analyze all of the data. Results are displayed as the M ± SD. Two groups were statistically analyzed using the Student’s t test. Bone density mass, osteoblast counts, and the expression levels of Tgf-β, Igf-1, Postn, Runx2 mRNA and TGF-β, IGF-1, POSTN, RUNX2 protein were all subjected to independent sample t-tests. A p-value of less than 0.05 was deemed statistically significant. Mice that died during modeling were excluded from all analyses without data imputation.
Results
Generation of un-opposed molar of T2DM mice model
All 70 mice in the control group survived, and 65 T2DM mice were successfully modeled. Over the course of 12 days, there was a substantial difference in weight between the groups, with the control group weighing more than the T2DM group. Starting from day 0 after tooth extraction, a significant difference in blood glucose levels was observed between the two groups, with the T2DM group exhibiting consistently higher values than the control group. These data confirmed the successful establishment of the T2DM mouse model, as shown in (Fig. 1).
Fig. 1.
The changes of body weight and blood glucose in control and T2DM groups. From day 0 post-extraction, significant differences in body weight (A) and blood glucose (B) levels were observed between the two groups, and these differences became more pronounced by day 12. In the T2DM group, the body weight on day 12 was significantly lower compared to that on day 0, whereas the blood glucose level was markedly elevated.*P<0.05,**P<0.01,***P<0.001
T2DM reduces osteoblast numbers but increases osteoclast numbers with minor impact on the periodontal ligament
Cellular and tissue structure
Using HE staining to examine alterations in the periapical tissues of roots: The mice’s periapical periodontal membrane showed an ordered arrangement of fibroblasts 0–3 days following tooth extraction. Both the T2DM and control group mice’s fibroblasts exhibited a disorganized arrangement six days after their teeth were extracted. However, compared to the control group, the T2DM group’s fibroblast organization showed more pronounced disorganization. Bone deposition was evident in the periapical alveolar bone along discontinuous borders. While osteoprogenitor cells appeared to proliferate to differing degrees throughout time, the alveolar bone surfaces of the T2DM and control mice did not initially exhibit any substantial osteoprogenitor cells, as shown in (Fig. 2A).
Fig. 2.
The histological presentation (HE) of mandibular molar periodontal tissues in two groups on experimental days 0, 3, 6, 9, and 12 (A). In the T2DM and control groups, the periodontal cells exhibited regular arrangement and no apparent osteoprogenitor cells were observed 0-3 days post-tooth extraction. From days 3 to 12 post-surgery, periodontal cells of mandibular molars are irregularly arranged, with observable osteoprogenitor cells in both groups. Arrows indicate sites where osteoprogenitor cells staining is observed.Comparison of the average width of bilateral periodontal ligaments, there was no significant difference in periodontal membrane width between the extracted and non-extracted sides in the control and T2DM groups (B) (P>0.05)
Periodontal ligament width
There was no discernible change in the average width of the periodontal ligament on either side of the mouse in either group. The supraeruption had no discernible effect on the width of the periodontal ligament. Although the T2DM group’s periodontal ligament width was greater than the control group’s, the difference was not statistically significant, as shown in (Fig. 2B).
Osteoblasts Count
We noticed alterations in periapical osteoblasts using ALP staining. Apical osteoblasts increased significantly in both the T2DM and control groups as the number of days following tooth extraction increased (P < 0.001). In contrast to the control group, the T2DM group had fewer osteoblasts at the same time point. The effect was especially noticeable on day 12, when there were fewer T2DM osteoblasts than in the control group, as shown in (Fig. 3).
Fig. 3.
On experimental days 0, 3, 6, 9, and 12, ALP staining was performed on mandibular molar periodontal tissues for both groups (A).The osteoblast count results showed (B), from postoperative days 0 to 12, osteoblasts gradually increased in both groups(P<0.05), but the T2DM group exhibited fewer osteogenic cells compared to the control group(P<0.05). Arrows indicate sites where positive osteogenic cell staining is observed. OB, osteoblasts. *P<0.05,**P<0.01
Osteoclasts Count
We noticed alterations in periapical osteoclasts by TRAP staining. The findings indicated that both the T2DM and control groups had statistically significant increases in apical osteoclasts as the number of days following tooth extraction increased. In contrast to the control group, the T2DM group’s osteoclast count was higher at the same time point. The effect was especially noticeable on day 9, when there were more T2DM osteoclasts than in the control group, as shown in (Fig. 4).
Fig. 4.
On experimental days 0, 3, 6, 9, and 12, TRAP staining was performed on mandibular molar periodontal tissues for both groups (A). The osteoclast count results showed (B), from postoperative days 0 to 12, the number of osteoclasts gradually increased in both groups(P<0.05), but the T2DM group exhibited more osteoclasts compared to the control group(P<0.05). Arrows indicate sites where positive osteoclast staining is observed. OC, osteoclasts . *P<0.05,**P<0.01
T2DM inhibits the positive expression of TGF-β, IGF-1, POSTN and RUNX2 in mice
The periapical region of right mandibular molar teeth expresses TGF-β, IGF-1, POSTN, and RUNX2. The staining intensity increased over time following tooth extraction in both the T2DM and control groups, and the difference was statistically significant. In the T2DM group, the staining intensity of TGF-β, IGF-1, and POSTN was reduced in the T2DM group compared to the control group, while the staining intensity of RUNX2 was higher than that of the control group. On day 12, the T2DM group showed a lower percentage of TGF-β, IGF-1, and POSTN-positive area, and a higher percentage of RUNX2-positive area compared to the control group (Figs. 5, 6, 7 and 8).
Fig. 5.
The positive expression rate of TGF-β is shown in the figure. From 0 to 3 days, TGF-β shows weak positive expression and light staining. As the extraction time extends, staining gradually increases from 6 to 12 days, reaching its peak at 12 days (A). TGF-β staining positivity results show that at each time, there is significant difference in staining positivity between the two mouse groups (P<0.05). With the extension of extraction time, the staining positivity gradually increases in both groups (P<0.05). The staining positive rate of TGF-β at each time point showed that the T2DM group was consistently lower than the control group (B).*P<0.05,**P<0.01
Fig. 6.
The positive expression rate of IGF-1 is shown in the figure.From 0 to 3 days, IGF-1 shows weak positive expression and light staining. As the extraction time extends, staining gradually increases from 6 to 12 days, reaching its peak at 12 days (A). IGF-1 staining positivity results show that at each time, there is significant difference in staining positivity between the two mouse groups (P<0.05). With the extension of extraction time, the staining positivity gradually increases in both groups (P<0.05). The staining positive rate of IGF-1 at each time point showed that the T2DM group was consistently lower than the control group (B). **P<0.01,***P<0.001
Fig. 7.
The positive expression rate of POSTN is shown in the figure.From 0 to 3 days, POSTN shows weak positive expression and light staining. As the extraction time extends, staining gradually increases from 6 to 12 days, reaching its peak at 12 days (A). POSTN staining positivity results show that at each time, there is significant difference in staining positivity between the two mouse groups (P<0.05). With the extension of extraction time, the staining positivity gradually increases in both groups (P<0.05). The staining positive rate of POSTN at each time point showed that the T2DM group was consistently lower than the control group (B).*P<0.05,**P<0.01,***P<0.001
Fig. 8.
From 0 to 3 days, RUNX2 shows weak positive expression and light staining. As the extraction time extends, staining gradually increases from 6 to 12 days, reaching its peak at 12 days (A). RUNX2 staining positivity results show that at 0 days, there is no significant difference in staining positivity between the two mouse groups (P > 0.05). However, the staining positive rate of RUNX2 showed that the T2DM group was consistently higher than the control group. Moreover, this difference was statistically significant (B) (P < 0.05).*P < 0.05,**P < 0.01,***P < 0.001
T2DM leads to a decrease in the expression of osteoblast marker genes in mice
Tgf-β, Igf-1 and Postn mRNA expression levels in the mandible of both control and T2DM group mice rose over time after tooth extraction (P < 0.001), implying that during supraeruption, osteogenesis is actively influenced by Tgf-β, Igf-1 and Postn. However, throughout the same time period, the T2DM group’s relative expression levels of these factors were lower than that of the control group (P < 0.05), with the exception of day 0, suggesting that T2DM affects the expression of osteogenic factors (Fig. 9).
Fig. 9.
The relative expression of Tgf-β, Igf-1, and Postn in T2DM and control group on days 0, 3, 6, 9, and 12 of the tooth extraction. At 0 day after tooth extraction, there was no significant difference in the relative expression levels of Tgf-β mRNA, Igf-1 mRNA and Postn mRNA between the two groups of mice (P>0.05). The rate of increase in Tgf-β mRNA expression was most pronounced between days 6 and 9, reaching its highest relative expression level during this period. Additionally, the relative expression levels of Igf-1 and Postn mRNA exhibited the fastest rise between days 3 and 6 following tooth extraction, peaking during this interval. Except at 0 day, the relative expression levels of Tgf-β, Igf-1 and Postn mRNA in the T2DM group were consistently lower than those in the control group at the same time points (P< 0.05). *P < 0.05,**P < 0.01,***P < 0.001
T2DM leads to a decrease in the expression of Osteoclast marker genes in mice
Runx2 mRNA expression levels in the right mandible of both T2DM and control group mice rose over time after tooth extraction (P < 0.001). It is suggesting that during supraeruption, Runx2 has a major impact on the osteoclastic process. However, at comparable time points, the T2DM group’s relative expression levels of these factors were significantly higher than those of the control group (P < 0.05), except for days 0–3, suggesting that T2DM may affect the expression of osteoclastic factors (Fig. 10).
Fig. 10.

The relative expression of Runx2 mRNA in T2DM and control group on days 0, 3, 6, 9, and 12 of the tooth extraction. At 0-3 days after tooth extraction, there was no significant difference in the relative expression levels of Runx2 mRNA between the two groups of mice (P>0.05). At day 12, the expression level of Runx2 mRNA in the control group had the largest difference with that in the T2DM group. Except at 0 to 3 day, the relative expression levels of Runx2 mRNA in the T2DM group were consistently higher than those in the control group at the same time points(P<0.05). *P<0.05,***P<0.001
T2DM reduces periapical bone mass and inhibits the supraeruption distance of the mouse right mandibular teeth in mice
The findings show that during the supraeruption process, the right mandibular bone mass increased in both mouse groups from day 0 to day 12 following the extraction of the right upper molars. At days 0–3, the T2DM group’s bone mass was somewhat lower than the control group’s, but the difference was not statistically significant (P >0.05). Both the T2DM group and the control group saw a considerable increase in bone mass between days 6 and 12, although the T2DM group’s bone mass was lower than the control group’s, and the differences were statistically significant.
The findings showed that both groups’ lower molars had supraeruption 12 days following the extraction of their upper molars. The supraeruption of the T2DM group was significantly less than that of the control group, and this difference was statistically significant (P < 0.001) (Fig. 11).
Fig. 11.
(A) is the bone mass (BV/TV) of the right mandible in T2DM and control groups on days 0 to 12 of the experiment. After tooth extraction, the bone mass of both T2DM and control mice showed an increasing trend, reaching the highest level by day 12. However, the bone mass of the control mice was significantly greater than that of the T2DM group from day 6 onwards. (B) is the comparison of the supraeruption distance in T2DM and control groups in 12th day. Compared to the control group, the T2DM group has a shorter supraeruption distance. *P<0.05,**P<0.01,***P<0.001
Discussion
Through the expression of factors associated with osteoblasts and osteoclasts, we examined whether diabetes has an impact on the metabolism of periapical alveolar bone and the supraeruption of teeth. The prerequisite for the experiment was the establishment of a mouse model with unopposed molars. In the present study, after extracting the maxillary molars in the T2DM group to create this no-opposing-teeth model, we found that T2DM disrupted the normal alveolar bone remodeling process. Furthermore, the degree of tooth supraeruption in the T2DM group was less than that in the control group. In this work, two mouse groups’ periosteal bone mass was measured. Both mouse groups’ periosteal bone mass increased, according to the data; however the T2DM group’s gain was less pronounced. Both the decreased capacity of osteoblasts to multiply and develop from osteoprogenitor cells to osteoblasts and the decreased metabolism of the periapical alveolar bone under the effect of type 2 diabetes are the causes of this.
The primary causes of osteoblast and osteoclast differentiation in diabetes include the direct effects of hyperglycemia [23], the indirect consequences of hyperglycemia due to an increased inflammatory state, and the accelerated buildup of advanced glycation end products (AGEs) [24]. In the pre-T2DM stage, osteoprogenitor cells retain the ability to differentiate into osteoblasts. However, this capacity diminishes as the disease progresses. Specifically, the ability to differentiate into osteoblasts declines by 4–7% annually during the first 10 years after a diagnosis of T2DM, and then slows down to 2–3% [25] after the 18th year. In the end, this slows the growth of bone volume and lowers the velocity of supraeruption, which impacts periapical alveolar bone remodeling.
These two mouse groups’ mandibular molar tooth periapical cell and tissue changes differed markedly. Following tooth extraction, the alveolar bone undergoes irregular resorption and displays a disorganized arrangement of collagen fibers over time. Diabetes disrupts collagen remodeling [26], as evidenced by the T2DM group’s wavy bone cortical borders, poorly defined bone trabecular structure, irregular periodontal membrane fiber arrangement, and collagen breakage when compared to the control group. The strength of the periodontium is primarily provided by Col-I fibers, while its elasticity is largely determined by Col-III fibers [27]. It has been demonstrated that elevated blood glucose levels lead to increased Col-III content and a higher Col-III/ Col-I ratio in the PDL. Consequently, the T2DM group exhibited prolonged degradation and remodeling time for PDL collagen fibers compared to the control group [28]. This indicates that the PDL is more brittle in a high-glucose environment. This could be because diabetes inhibits the metabolism of collagen, which slows down tooth movement.
PDL plays a critical role in regulating both longitudinal and lateral tooth mobility. During orthodontic treatment, external forces are applied to teeth, leading to either compression or tension within the PDL, depending on the direction of force [29]. Although alveolar bone and odontoblasts were continuously undergoing remodeling and deposition, the two groups of mice in the current study did not exhibit substantial changes in PDL width following supraeruption of the teeth over time. This could be because no external force was applied during the supraeruption of the tooth. This is in line with other research showing that the PDL width remains constant across an adult mammal’s lifetime [30].
The results of the RT-qPCR and immunohistochemistry show that the expression levels of factors related to osteoblasts and osteoclasts rose in both mouse groups over time after tooth extraction. Nevertheless, the expression level of TGF-β, IGF-1, and POSTN in the T2DM group showed a significant decrease, while the expression level of RUNX2 significantly increased. To date, most studies show that TGF-β stimulates matrix synthesis, osteoblast proliferation, and early differentiation of osteoprogenitor cells [31, 32]. TGF-β1, a member of the TGF-β family, exerts dose- and time-dependent effects on osteoblasts. According to certain experimental findings, mice with Tgf-β1 deficiency had fewer mature osteoblasts and lower ALP activity in vivo [33]. Phosphoinositide 3-kinase (PI3K) is one of the intracellular kinases whose activity is stimulated by IGF-1 binding to its receptor. By facilitating the activity of its peripheral PDK1, PI3K activates protein kinase B (AKT), which in turn speeds up osteoblast development through the transcription factor [34]. Thus, IGF-1 and TGF-β are closely associated with osteoblast differentiation and production. Immunoreactivity to POSTN is evenly confined to ground fiber bundles in the PDL, according to early findings. This suggests that POSTN is involved in the process of alveolar bone remodeling and PDL morphogenesis. Consistent with our experimental findings, animals lacking POSTN in vivo [35] showed reduced reduced alveolar bone volume (BV/TV). It has been established that the expression of lysosomal-associated protein transmembrane 5 (LAPTM5) is regulated through the interaction of Runx2 with its promoter region and that LAPTM5 is involved in the transport of RANKL. This implies that RUNX2 may influence lysosome-associated genes [36] to contribute to osteoclast differentiation. This indicates that RUNX2 may influence osteoclast differentiation via lysosome-related genes, aligning with our findings that RUNX2 expression levels correlated with the proliferation and differentiation of osteoclasts.
Several limitations of this study warrant consideration. First, although we performed micro-CT scanning and reported BV/TV, we did not systematically analyze other key micro-architectural parameters such as trabecular thickness (Tb.Th), trabecular number (Tb.N), or cortical porosity. Given that T2DM induces site-specific alterations in jaw bone microstructure, which including altered trabecular thickness and cortical porosity-comprehensive micro-CT analysis would have provided deeper insight into the structural basis of the observed bone changes [37]. Second, we did not measure OPG expression or the RANKL/OPG ratio. This signaling axis is a critical regulator of bone remodeling, and its disruption contributes to enhanced bone resorption under diabetic and inflammatory conditions [38]. Third, we did not directly assess oxidative stress parameters. Hyperglycemia induces reactive oxygen species (ROS) production and enhances oxidative stress, which exacerbates periodontal tissue destruction and disrupts bone homeostasis [39, 40]. Future studies incorporating these parameters will be essential to more comprehensively elucidate how T2DM impairs tooth supraeruption through alveolar bone remodeling.
In conclusion, supraeruption results from the combined biological responses of the periodontal ligament and the alveolar bone around the tooth root. This process involves both bone remodeling and resorption, in which signaling molecules such as TGF-β, IGF-1, POSTN, and RUNX2 play critical regulatory roles. Type 2 diabetes mellitus leads to several pathological manifestations, including delayed supraeruption, downregulation of osteoblast-related factors, increased osteoclast numbers with enhanced expression of associated markers, and impaired mandibular bone remodeling capacity. To provide a theoretical foundation for tooth supraeruption in individuals with type 2 diabetes mellitus, we investigated the relevant mechanisms by which T2DM influences the periapical alveolar bone remodeling process.
Conclusions
Supraeruption of unopposed teeth is achieved through coordinated biological responses involving both the periodontal ligament and the surrounding alveolar bone. This process encompasses bone remodeling and resorption regulated by key signaling molecules, including TGF-β, IGF-1, POSTN, and RUNX2. Our findings demonstrate that T2DM disrupts this process by downregulating osteoblast-related factors, increasing osteoclast numbers and activity, and ultimately impairing alveolar bone remodeling capacity, leading to delayed supraeruption. This study provides a theoretical foundation for future clinical research on the mechanism by which type 2 diabetes mellitus affects tooth supraeruption.
Acknowledgements
The authors thank the Animal Experiment Center of Shanxi Medical University for technical support.
Authors' contributions
JS: Writing – review & editing, Writing – original draft. XA: Writing – original draft, Writing – review & editing. XW: Writing – review & editing, Writing – original draft. SR: Writing – review & editing, Writing – original draft. YC: Writing – original draft, Writing – review & editing. TL: Writing – review & editing, Writing – original draft. WW: Writing – review & editing, Writing – original draft. WL: Writing – review & editing, Writing – original draft.
Funding
The authors declare financial support was received for the research and/or publication of this article. This study was supported by the Natural Science Research Project of Shanxi Basic Research Program (No. 202303021211214), the Fund Program for the Scientific Activities of Selected Returned Overseas Professionals in Shanxi Province (No. 20240048), and the Research Project Task Book of the Health Commission of Shanxi Province (No. 2025YD032).
Data availability
The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding autho.
Declarations
Ethics approval and consent to participate
The animal study was approved by the Ethics Committee of Shanxi Medical University (ethical number: DW2022038). All animal experiments were acquired from Shanxi Medical University’s Animal Experiment Center. The study was conducted in accordance with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments), as well as local legislation and institutional requirements. All animals were obtained from the institutional animal facility (Animal Experiment Center of Shanxi Medical University); therefore, no informed consent from private owners was required.
Consent for publication
Not Applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Jing Shi and Xingqi An contributed equally to this work.
References
- 1.Horibe K, Hara M, Nakamura H. M2-like macrophage infiltration and transforming growth factor-β secretion during socket healing process in mice. Arch Oral Bio. 2021;123:105042. 10.1016/j.archoralbio. [DOI] [PubMed] [Google Scholar]
- 2.García-Molina L, Lewis-Mikhael AM, Riquelme-Gallego B, et al. Improving type 2 diabetes mellitus glycaemic control through lifestyle modification implementing diet intervention: a systematic review and meta-analysis. Eur J Nutr. 2020;59:1313–28. 10.1007/s00394-019-02147-6. [DOI] [PubMed] [Google Scholar]
- 3.Liu S, Yan X, Guo J, et al. Periodontal ligament-associated protein-1 knockout mice regulate the differentiation of osteoclasts and osteoblasts through TGF-β1/Smad signaling pathway. J Cell Physiol. 2024;239:e31062. 10.1002/jcp.31062. [DOI] [PubMed] [Google Scholar]
- 4.Wang J, Zhu Q, Cao D, et al. Bone marrow-derived IGF-1 orchestrates maintenance and regeneration of the adult skeleton. Proc Natl Acad Sci U S A. 2023;120:e2203779120. 10.1073/pnas.2203779120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Al Moaleem MM, Porwal A, Qahhar MA, et al. Clinical and radiographical measurements of supraeruption and occlusal interferences in unopposed posterior teeth. J Contemp Dent Pract. 2021;22:784–92. [PubMed] [Google Scholar]
- 6.Almousa A, Kamran MA, Alshahrani A, et al. Influence of Diabetes mellitus on tooth eruption and occurrence of malocclusion. J Biol Regul Homeost Agents. 2020;34(2). 10.23812/20-81L. [DOI] [PubMed]
- 7.Maulani A, Farmasyanti CA, Sutantyo D. The number of osteoblasts and osteoclasts in hypofunctional teeth during orthodontic tooth movement in rats. F1000Res. 2022;10:541. 10.12688/f1000research.53728.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Rathinavelu S, Guidry-Elizondo C, Banu J. Molecular modulation of osteoblasts and osteoclasts in type 2 diabetes. J Diabetes Res. 2018;6354787. 10.1155/2018/6354787. [DOI] [PMC free article] [PubMed]
- 9.Zhou J, Zhu Y, Ai D, et al. Low-intensity pulsed ultrasound regulates osteoblast-osteoclast crosstalk via EphrinB2/EphB4 signaling for orthodontic alveolar bone remodeling. Front Bioeng Biotechnol. 2023;11:1192720. 10.3389/fbioe.2023.1192720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kim JM, Lin C, Stavre Z, et al. Osteoblast-osteoclast communication and bone homeostasis. Cells. 2020;9(9):2073. 10.3390/cells9092073. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Bonnet N, Standley KN, Bianchi EN, et al. The matricellular protein periostin is required for sost inhibition and the anabolic response to mechanical loading and physical activity. J Biol Chem. 2009;284(51):35939–50. 10.1074/jbc.M109.060335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kashima TG, Nishiyama T, Shimazu K, et al. Periostin, a novel marker of intramembranous ossification, is expressed in fibrous dysplasia and in c-Fos-overexpressing bone lesions. Hum Pathol. 2009;40(2):226–37. 10.1016/j.humpath.2008.07.008. [DOI] [PubMed] [Google Scholar]
- 13.Tao LY, Łagosz-Ćwik KB, Hogervorst JMA, et al. Diabetes medication metformin inhibits osteoclast formation and activity in vitro models for periodontitis. Front Cell Dev Biol. 2022;9:777450. 10.3389/fcell.2021.777450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wang T, Ye J, Zhang Y, Li J, et al. Role of oxytocin in bone. Front Endocrinol (Lausanne). 2024;15:1450007. 10.3389/fendo.2024.1450007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wu M, Wu S, Chen W, et al. The roles and regulatory mechanisms of TGF-β and BMP signaling in bone and cartilage development, homeostasis and disease. Cell Res. 2024;34:101–23. 10.1038/s41422-023-00918-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Yan J, Herzog JW, Tsang K, et al. Gut microbiota induce IGF-1 and promote bone formation and growth. Proc Natl Acad Sci U S A. 2016;113(47):E7554–63. 10.1073/pnas.1607235113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Idolazzi L, Ridolo E, Fassio A, et al. Periostin: The bone and beyond. Eur J Intern Med. 2017;38:12–6. 10.1016/j.ejim.2016.11.015. [DOI] [PubMed] [Google Scholar]
- 18.Jann J, Gascon S, Roux S, et al. Influence of the TGF-β superfamily on osteoclasts/osteoblasts balance in physiological and pathological bone conditions. Int J Mol Sci. 2020;21(20):7595. 10.3390/ijms21207597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Xun Y, Jiang Y, Khalid A, et al. KBTBD2 controls bone development by regulating IGF-1 signaling during osteoblast differentiation. Cell Death Differ. 2025;32(6):1099–111. 10.1038/s41418-024-01416-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Haseeb A, Kc R, Angelozzi M, et al. SOX9 keeps growth plates and articular cartilage healthy by inhibiting chondrocyte dedifferentiation/osteoblastic redifferentiation. Proc Natl Acad Sci U S A. 2021;118(8):e2019152118. 10.1073/pnas.2019152118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Pan L, Li Z, Wang Y, et al. Network pharmacology and metabolomics study on the intervention of traditional Chinese medicine Huanglian Decoction in rats with type 2 diabetes mellitus. J Ethnopharmacol. 2020;258:112842. 10.1016/j.jep.2020.112842. [DOI] [PubMed] [Google Scholar]
- 22.Westerberg DP. Diabetic ketoacidosis: evaluation and treatment. Am Fam Physician. 2013;87(5):337–46. [PubMed] [Google Scholar]
- 23.Yang L, Liu J, Shan Q, et al. High glucose inhibits proliferation and differentiation of osteoblast in alveolar bone by inducing pyroptosis. Biochem Biophys Res Commun. 2020;522(2):471–8. 10.1016/j.bbrc.2019.11.080. [DOI] [PubMed] [Google Scholar]
- 24.Liu J, Mao J, Jiang Y, et al. AGEs induce apoptosis in rat osteoblast cells by activating the caspase-3 signaling pathway under a high-glucose environment in vitro. Appl Biochem Biotechnol. 2016;178(5):1015–27. 10.1007/s12010-015-1925-3. [DOI] [PubMed] [Google Scholar]
- 25.Phimphilai M, Pothacharoen P, Chattipakorn N, et al. The trajectory of osteoblast progenitor cells in patients with type 2 diabetes and the predictive model for their osteogenic differentiation ability. Sci Rep. 2023;13(1):2338. 10.1038/s41598-023-29677-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Pabisch S, Akabane C, Wagermaier W, et al. The nanostructure of murine alveolar bone and its changes due to type 2 diabetes. J Struct Biol. 2016;196(2):223–31. 10.1016/j.jsb.2016.09.007. [DOI] [PubMed] [Google Scholar]
- 27.Chen L, He D, Li Z, et al. Endo 180 participates in collagen remodeling of the periodontal ligament during orthodontic tooth movement. BMC Oral Health. 2024;24(1):1576. 10.1186/s12903-024-05362-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Guo W, Chen L, Gong K, et al. Heterogeneous dental follicle cells and the regeneration of complex periodontal tissues. Tissue Eng Part A. 2012;18(5–6):459–70. 10.1089/ten.TEA.2011.0261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yang L, Kang M, He R, et al. Microanatomical changes and biomolecular expression at the PDL-entheses during experimental tooth movement. J Periodontal Res. 2019;54(3):251–8. 10.1111/jre.12625. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.McCulloch CA, Melcher AH. Continuous labelling of the periodontal ligament of mice. J Periodontal Res. 1983;18(3):231–41. 10.1111/j.1600-0765.1983.tb00357.x. [DOI] [PubMed] [Google Scholar]
- 31.Tezval M, Tezval H, Dresing K, et al. Differentiation dependent expression of urocortin’s mRNA and peptide in human osteoprogenitor cells: influence of BMP-2, TGF-beta-1 and dexamethasone. J Mol Histol. 2009;40(5–6):331–41. 10.1007/s10735-009-9244-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Predes D, Cruz JVR, Abreu JG, et al. CUB domain-containing protein 1 (CDCP1) binds transforming growth factor beta family members and increase TGF-β1 signaling pathway. Exp Cell Res. 2019;383(1):111499. 10.1016/j.yexcr.2019.111499. [DOI] [PubMed] [Google Scholar]
- 33.Chen Y, Wang H, Ni Q, et al. B-cell-derived TGF-β1 inhibits osteogenesis and contributes to bone loss in periodontitis. J Dent Res. 2023;102(7):767–76. 10.1177/00220345231161005. [DOI] [PubMed] [Google Scholar]
- 34.Wang T, Zhang X, Bikle D. Osteogenic differentiation of periosteal cells during fracture healing. J Cell Physiol. 2017;232(5):913–21. 10.1002/jcp.25641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Du J, Li M. Functions of Periostin in dental tissues and its role in periodontal tissues’ regeneration. Cell Mol Life Sci. 2017;74(23):4279–86. 10.1007/s00018-017-2645-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Geng YM, Liu CX, Lu WY, et al. LAPTM5 is transactivated by RUNX2 and involved in RANKL trafficking in osteoblastic cells. Mol Med Rep. 2019;20(5):4193–201. 10.3892/mmr.2019.10688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Rodic T, Wölfel EM, Milovanovic P, et al. Bone quality analysis of jaw bones in individuals with type 2 diabetes mellitus-post mortem anatomical and microstructural evaluation. Clin Oral Investig. 2021;25(7):4377–400. 10.1007/s00784-020-03751-1. [DOI] [PubMed] [Google Scholar]
- 38.Ateeq H, Zia A, Husain Q, et al. Effect of inflammation on bones in diabetic patients with periodontitis via RANKL/OPG system-A review. J Diabetes Metab Disord. 2022;21(1):1003–9. 10.1007/s40200-021-00960-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Li G, Qin H, Zhou M, et al. Knockdown of SIRT3 perturbs protective effects of irisin against bone loss in diabetes and periodontitis. Free Radic Biol Med. 2023;200:11–25. 10.1016/j.freeradbiomed.2023.02.023. [DOI] [PubMed] [Google Scholar]
- 40.Li P, Alenazi KKK, Dally J, et al. Role of oxidative stress in impaired type II diabetic bone repair: scope for antioxidant therapy intervention? Front Dent Med. 2024;5:1464009. 10.3389/fdmed.2024.1464009. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding autho.










