Curcumin Attenuates Breast Cancer Cell-induced Inflammasome Activation via the NOD-like receptor protein 3/Caspase-1/Interleukin-1β Axis

Abstract

Breast cancer is one of the most prevalent malignancies among women worldwide; its incidence and mortality are expected to increase annually. Cancer is composed not only malignant cells but also a complex and dynamic network of interacting stromal cells, specifically immune cells, which contribute to tumor development and progression. Increasing evidence highlights the critical role of tumor-associated macrophages (TAMs) and their inflammasome-driven signaling pathways in tumor progression and therapeutic resistance. Curcumin, a natural compound with anti-carcinogenic potential, has a role in the regulation of cancer development and progression. However, its specific effects on inflammasome activation in TAMs within the tumor microenvironment (TME) remain insufficiently characterized. THP-1 monocytes differentiated into macrophages acquire the TAM-like phenotype when treated with conditioned media from breast cancer cells. Our present study aimed to investigate the effects of curcumin on inflammasome activation in macrophages induced by breast cancer–derived conditioned media. Breast cancer-derived conditioned medium stimulation induced manifestation of a pro-inflammatory TAM-like phenotype, characterized by increased interleukin (IL)-1β secretion and upregulation of NOD-like receptor protein 3 (NLRP3), caspase-1, and IL-1β. Curcumin pretreatment significantly reduced IL-1β secretion as well as NLRP3 protein levels. Moreover, it also suppressed IL1B and CASP1 mRNA expression. In conclusion, curcumin attenuates tumor-induced inflammasome activation, highlighting its potential to modulate TME-driven breast cancer progression via the NLRP3/caspase-1/IL-1β axis.

INTRODUCTION

Breast cancer is one of the most prevalent malignancies among women globally, with an estimated 2.5 million new diagnoses in 2025. According to recent projections, the global burden of breast cancer is expected to reach approximately 3.2 million new cases and 1.1 million deaths annually by 2050 [1]. Like the majority of other malignancies, breast cancer is not merely a collection of cancer cells, but rather a complex and heterogeneous ecosystem that is composed of a variety of stromal cells, including fibroblasts, mesenchymal cells, adipocytes, and specifically immune cells [2]. This dynamic network, collectively known as the tumor microenvironment (TME), plays a critical role in shaping tumor behavior through the sustained release of cytokines and growth factors that promote tumor development and progression, and also therapeutic resistance [3].

Some immune cells in the TME are involved in cancer development by modulating the inflammatory state [4]. Among these immune populations in TME, tumor-associated macrophages (TAMs) are highly abundant and have an impact on breast cancer progression [5]. Chemokine and cytokine signals from tumors can induce the recruitment of monocytes to the TME, where they differentiate into TAMs [6]. TAMs exhibit substantial plasticity and often acquire immunosuppressive, tissue-remodeling, and tumor-promoting M2-like phenotypes in response to tumor-derived signals, including interleukin (IL)-4, IL-10, TGF-β, and colony-stimulating factor 1 [6]. M2-like TAMs are essential for malignant metastasis, invasion and treatment resistance [6,7].

Tumor-derived soluble factors and danger-associated molecular patterns (DAMPs) can activate macrophage receptors, including pattern recognition receptors such as Toll-like receptors (TLRs), thereby triggering inflammatory signaling pathways mediated by NF-κB [8]. Many DAMPs released from dying cells after tissue injury or chemo-/radiotherapy can be ligands for TLRs expressed on macrophages and induce cytokine production [9]. Furthermore, DAMP-induced chronic inflammation in the TME can increase immunosuppressive M2 macrophages populations [9].

The phosphorylation of NF-κB facilitates its translocation into the nucleus and promotes the production of pro-inflammatory factors. The inflammasome comprises the NLRP3/ASC/caspase-1 complex, and its activation promotes pro-caspase-1 cleavage to active caspase-1. This, in turn, facilitates the conversion of pro-IL-1β into IL-1β and subsequent releases [10]. The NF-κB/NLRP3/IL-1β axis plays a central role in tumor progression across multiple cancer types, including breast cancer, by promoting angiogenesis, epithelial–mesenchymal transition (EMT), invasion, and metastatic dissemination [11]. Therefore, targeting the inflammasome of TAMs might be a promising therapeutic strategy for modulating the TME [12,13]. The inflammasomes play a key driver of breast cancer progression by shaping an immunosuppressive TME, where dysregulated activation promotes chronic inflammation, macrophage polarization, angiogenesis, metastasis, and impaired anti-tumor immunity. Given the therapeutic potential of targeting this pathway, bioactive agents that modulate the NLRP3/caspase-1/IL-1β axis may represent a promising strategy to counter inflammasome-driven tumor progression.

Curcumin, derived from turmeric (Curcuma longa L., Zingiberaceae), has a cancer chemopreventive and anticarcinogenic properties which are mainly attributable to its anti-inflammatory and antioxidant properties [14]. Numerous studies have demonstrated that curcumin modulates multiple signaling pathways involved in cancer cell proliferation, survival and death, thereby suppressing tumor progression [15-17]. Curcumin inhibits growth and survival of breast cancer cells through multiple mechanisms [18,19]. Enhanced bioavailability and stability of curcumin using nanoparticle-based delivery systems improves its therapeutic efficacy to inhibit breast cancer progression [17,20,21]. However, the majority of previous studies with both conventional and nano-formulated curcumin have focused on direct tumor targeting, with limited attention given to effects of curcumin on the TME.

Beyond its direct cytotoxic effects on cancer cells, curcumin can modulate immune responses within TME, particularly through regulation of macrophage activity. It has been reported that curcumin induces macrophage polarization from M2 to M1 and suppresses pro-inflammatory signaling pathways [22]. Inflammasome activation is a central mediator of tumor-associated inflammation within the TME, promoting pro-angiogenic signaling, tumor cell invasion, and metastatic dissemination. Although curcumin has been proposed as a potential inhibitor of inflammasome activation [23], its role in regulating this pathway under breast cancer-specific microenvironmental conditions remains poorly understood.

Macrophages are, in general, classified into two main phenotypes, M1 and M2. The classically activated pro-inflammatory M1 macrophages promote anti-tumor immune responses, whilst the alternatively activated M2 macrophages are anti-inflammatory and capable of repairing damaged tissues. In the TME, TAMs are somehow educated towards the M2 phenotype, thereby promoting growth, migration, invasion and metastasis of malignant cells [8]. Curcumin treatment abolished the capability of M2 TAMs to induce chemoresistance in breast cancer cells [24].

In investigating how immune cells influence tumor progression, human monocytic cell line (THP-1)-derived macrophages have been commonly used to generate conditioned media for treating cancer cells. However, this approach mainly reflects a unidirectional interaction from macrophages to cancer cells. Within TME, macrophages are shaped by tumor-derived signals in which inflammasomes play a crucial role. In this context, we utilized conditioned media derived from two subtypes of the breast cancer cell line (MDA-MB-231 and MDA-MB-468) to induce TAM-like characteristics in THP-1 cells. We then investigated whether curcumin could effectively suppress the NLRP3 inflammasome signaling activated by soluble factors released from breast cancer cells.

MATERIALS AND METHODS

Chemicals

The chemicals utilized in this investigation were of analytical quality or superior (≥ 95%). Type 1 ultrapure water was acquired using the Smart2Pure™ Water Purification System (Thermo Fisher Scientific), exhibiting a resistivity of 18.2 MΩ·cm at 25°C and a Total Organic Carbon concentration of ≤ 10 ppb. The Bio-Rad protein assay and polyacrylamide were procured from Bio-Rad Laboratories Ltd. Dulbecco’s Modified Eagle Medium (DMEM), Roswell Park Memorial Institute medium (RPMI 1640), FBS, trypsin–EDTA solution, [3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide] (MTT), and various cell culture supplies were supplied from Gibco® (Thermo Fisher Scientific).

Cell culture and treatment

THP-1 cells were cultured in RPMI medium enriched with 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin within a humidified incubator at 37°C and 5% CO2. MD Anderson metastatic breast (MDA-MB) 231 and MDA-MB-468 cancer cells were maintained in DMEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin under identical conditions. The cell culture medium was replaced every three days until 80% confluence was achieved, after which the cells were subcultured.

Curcumin (Sigma-Aldrich) stock solutions were prepared by dissolving the compound in 100% DMSO at a concentration of 5 mM, and stored at –20°C until use. For cell treatment, THP-1 cells cultured in RPIM supplemented with 10% FBS were treated with 100 nM phorbol 12-myristate 13-acetate (PMA) to promote differentiation into macrophages. For the MTT assay, differentiated THP-1 cells were seeded at a density of 1.5 × 105 cells per well in 6-well cell culture plates and incubated for 48 hours. For ELISA, mRNA expression, and Western blot analyses, differentiated THP-1 cells were seeded at a density of 1.5 × 107 cells per 60 mm cell culture dish and incubated for 48 hours. After changing the medium with a fresh one, cells were incubated for additional 24 hours. Subsequently, cells were pretreated with new medium containing different concentrations of curcumin (15, 20, and 25 µM) and incubated for 12 hours.

To prepare conditioned media from breast cancer cells, MDA-MB-231 and MDA-MB-468 cells were plated in a 100 mm cell culture dish at a concentration of 1.5 × 106 cells per dish and incubated for 24 hours. After replacement with fresh DMEM supplemented with 10% FBS, cells were cultured for 24 hours. The media were collected and filtered using a 0.2 µm sterile syringe filter membrane.

Cell viability assay

The toxicity of curcumin on THP-1 cells was assessed by the MTT assay. THP-1 cells were cultured in RPMI supplemented with 10% FBS and 100 nM PMA at a density of 1.5 × 105 cells per well in a 6-well cell culture plate for 48 hours. Media were changed for a duration of 24 hours. Cells were pretreated with 10, 20, or 30 µM of curcumin and incubated for 12 hours. Following incubation, cells were washed twice with 1 × PBS to eliminate curcumin interference. Subsequently, media containing the MTT solution (0.25 mg/mL) were added followed by incubation for additional 4 hours. The media were eliminated, and formazan crystals were solubilized in 100% DMSO. After incubation for 30 minutes with gentle agitation, the absorbance at 550 nm was measured using a spectrophotometer. Data are shown as mean ± SEM of % cell viability relative to the vehicle-treated group.

Determination of IL-1β release

The effect of curcumin on release of IL-1β in THP-1 cells stimulated with conditioned media from breast cancer cells (MDA-MB-231 and -468) was assessed using a human IL-1 beta ELISA kit (LS Bio). THP-1 cells were pretreated with 15, 20, or 25 µM of curcumin for 12 hours, followed by incubation with conditioned media for an additional 12 hours. The conditioned media were collected and put into sterile microcentrifuge tubes. Each tube was centrifuged at 5,000 rpm at 4°C for 5 minutes to separate the cell pellets. Supernatants were collected and stored at 4°C until use.

For measurement of IL-1β by the ELISA, the sample media were mixed with Diluent B at a ratio of 1 : 15. One hundred µL of each sample was dispensed into each 96-well plate coated with anti-human IL-1β and incubated for 2.5 hours at room temperature with gentle agitation. Subsequently, the media was removed and washed four times using a 1× wash solution. Then biotinylated detection antibody was added to each well and incubated for 1 hour at room temperature with gentle agitation. The excess antibody was eliminated and rinsed four times. One hundred µL of streptavidin solution was added and incubated for 45 minutes at ambient temperature with gentle agitation. Subsequently, the cells were washed again, and 100 µL of TMB one-step substrate reagent was added, followed by incubation for 30 minutes at room temperature in the dark with gentle agitation. After addition of 50 µL of stop solution to each well, the absorbance at 450 nm was read utilizing a spectrophotometer. The quantification of IL-1β was determined from the interpolation of standard IL-1β concentrations. Data are presented as mean IL-1β concentrations (pg/mL) ± SEM.

Determination of mRNA expression

The effect of curcumin on mRNA expression of NLRP3, IL1B, CASP1, and PYCARD in PMA-stimulated THP-1 cells for differentiation cells treated with conditioned media from MDA-MB-231 and MDA-MB-468 cells was assessed by real-time PCR. After incubation, cells were harvested using TRIzolTM (Sigma-Aldrich) and combined with 100% chloroform. After incubation at ambient temperature for 5 minutes, the mixures were subjected to centrifugation at 12,000 rpm for 15 minutes at 4°C. The supernatant was partitioned into three phases: the aqueous phase, the interphase, and chloroform, with the aqueous phase containing RNA being recovered. The collected aqueous phase was inverted and combined with 100% isopropanol, then incubated at room temperature for 10 minutes. After centrifugation at 12,000 rpm for 8 minutes at 4°C, supernatant was discarded, and the RNA pellets were rinsed with 75% ethanol in diethylpyrocarbonate (DEPC)-treated water and centrifuged at 7,500 rpm for 5 minutes at 4°C. The supernatant was distinctly removed, and the particle was dried until it became transparent. Pellets were resuspended in DEPC-treated RNase-free water. Each RNA sample was measured, and the concentration was adjusted to 150 µg/mL before usage. RT-PCR (Promega) was employed to transcribe RNA into cDNA, while real-time PCR was utilized to quantify the expression of NLRP3, IL1B, CASP1, and PYCARD mRNA using 7500 Real-Time PCR instrument (Thermo Fisher Scientific,) and the RealHelix Premier Quantitative PCR Kit (NanoHelix Co. Ltd). The information on their primer sequences is summarized in Table 1. Data are presented as mRNA levels relative to the vehicle-treated control group. Normalization of target gene expression to GAPDH as the housekeeping gene was implemented. The comparative cycle threshold (Ct) (ΔΔCt) method was employed to analyze the relative gene expression.

Table 1.

Primer sequences used for qPCR

Primer name		Sequence (5'-3')
PYCARD	Forward	AGCTCACCGCTAACGTGCTGC
	Reverse	GCTTGGCTGCCGACTGAGGAG
CASP1	Forward	GCTGAGGTTGACATCACAGGCA
	Reverse	TGCTGTCAGAGGTCTTGTGCTC
IL1B	Forward	AATCCCCAGCCCTTTTGTTG
	Reverse	AAATGTGGCCGTGGTTTCTG
NLRP3	Forward	GGACTGAAGCACCTGTTGTGCA
	Reverse	TCCTGAGTCTCCCAAGGCATTC
GAPDH	Forward	TTGCCATCAATGACCCCTTC
	Reverse	TGATGACAAGCTTCCCGTTC

CASP1, caspase 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL1B, interleukin 1 beta; NLRP3, NOD-like receptor family pyrin domain containing 3; PYCARD, PYD and CARD domain containing.

Western blot analysis

After incubation, the treated cells were harvested for total protein lysates using RIPA buffer. The quantity of protein lysate in each sample was standardized using the BCA protein assay (Thermo Fisher Scientific). An equivalent quantity of protein was isolated by SDS-PAGE and subsequently transferred to a PVDF membrane (Bio-Rad Laboratories). Membranes were treated with 5% blocking reagent (5% BSA or 5% nonfat dry milk) for 1 hour and subsequently incubated with primary antibodies (1 : 1,000 NLRP3, IL-1β, caspase-1, ASC, NF-κB, and β-actin) at 4°C overnight. Subsequently, the incubation mixtures were rinsed three times with 1 x Tris-buffered saline with 1% Tween (TBST). Membranes were incubated with 1 : 3,000 anti-rabbit or anti-mouse secondary antibody (Invitrogen) for one hour and subsequently washed three times. Protein bands on the membrane were seen by incubation with ECL developer (Abclone) and documented using a LAS-4000 image reader (Fujifilm). The Image J program was utilized to examine the captured protein bands.

Statistical analysis

Data from at least three independent experiments were used for statistical analysis. The statistical significance was determined using the Student's t-test or one-way ANOVA, followed by Tukey's multiple comparisons for post-hoc testing. A P-value of less than 0.05 was considered statistically significant. GraphPad Prism 8 (GraphPad Software) was employed to conduct all statistical analyses.

RESULTS

Determination of curcumin toxicity

The MTT test indicated that curcumin concentrations up to 20 µM exhibited no significant toxicity in THP-1 cells; however, 30 µM curcumin reduced cell viability 26.70% compared to the vehicle-treated group (Figure S1). Therefore, this concentration was excluded in subsequent experiments.

Effects of curcumin on macrophage secretion of IL-1β stimulated by breast cancer cell conditioned media

The effect of curcumin on secretion of IL-1β in THP-1 cells stimulated with conditioned media from MDA-MB 231 and MDA-MB-468 breast cancer cells was assessed using an ELISA kit. The addition of both conditioned media resulted in significantly elevated IL-1β production in the THP-1 cells differentiated to macrophages (Fig. 1). Curcumin pretreatment resulted in concentration-dependent inhibition of IL-1β secretion in THP-1 cells (Fig. 1).

Figure 1. The effect of curcumin on IL-1β production in THP-1 cells treated with conditioned media derived from breast cancer cells.

THP-1 cells stimulated with PMA (100 nM) for 48 hours for differentiation into macrophages were preincubated with indicated concentrations of curcumin prior to exposure to conditioned media from MDA-MB-231 (A) or MDA-MB-468 (B) cells for 12 hours. Data are expressed as mean ± SEM (n = 3). ***Significantly different (P < 0.001) compared with the vehicle-treated group. ###Significantly different (P < 0.001) compared with the group treated with the condition media alone. IL-1β, interleukin-1 beta; THP-1, human monocytic leukemia cell line; PMA, phorbol 12-myristate 13-acetate; MDA-MB-231, MD Anderson metastatic breast 231; CM, conditioned medium; MDA-MB-468, MD Anderson metastatic breast 468.

Effects of curcumin on inflammasome-associated gene expression

Next, we examined the effect of curcumin pretreatment on expression of some representative inflammasome-associated genes induced by conditioned media in THP-1 cells using real-time PCR. Incubation of PMA-stimulated THP-1 cells with breast cancer conditioned media markedly increased the IL1B (Fig. 2A and 2B) and CASP1 (Fig. 2C and 2D) mRNA levels, whilst expression of PYCARD encoding ASC was dramatically lowered (Fig. 2E and 2F). NLRP3 expression remained unaltered (Fig. 2G and 2H). Curcumin pretreatment of THP-1 cells exposed to each breast cancer cell conditioned medium resulted in a significant reduction of IL1B and CASP1 mRNA levels in a concentration-dependent manner (Fig. 2A-D). Nonetheless, the mRNA expression levels of NLRP3 and PYCARD barely changed by curcumin pretreatment (Fig. 2E-H).

Figure 2. Effect of curcumin on expression of some inflammasome-associated genes in THP-1 cells in the presence of conditioned media from breast cancer cells.

THP-1 cells were differentiated with PMA and pretreated with curcumin as described in the legend to Figure 1 prior to exposure to the conditioned media. The expression of some representative genes, IL1B (A, B), CASP1 (C, D), PYCARD (E, F), and NLRP3 (G, H) in both MDA-MB-231 (A, C, E, and G) and MDA-MB-468 (B, D, F, and H) cells was measured by real-time PCR as described in Materials and Methods. Data are presented as mean ± SEM (n = 3). *,***Significantly different (*P < 0.05; ***P < 0.001) compared with the vehicle-treated group. #,##,###Significantly different (#P < 0.05; ##P < 0.01; ###P < 0.001) when compared with the group treated with the conditioned media alone. THP-1, human monocytic leukemia cell line; PMA, phorbol 12-myristate 13-acetate; IL1B, interleukin 1 beta; CASP1, caspase 1; PYCARD, PYD and CARD domain containing; NLRP3, NOD-like receptor family pyrin domain containing 3; mRNA, messenger RNA; MDA-MB-231, MD Anderson metastatic breast 231; CM, conditioned medium; MDA-MB-468, MD Anderson metastatic breast 468.

Effects of curcumin on protein expression of inflammasome components

The effect of curcumin on expression of some representative proteins involved in the inflammasome activation was assessed using Western blot analysis. Despite no alteration in the NLRP3 mRNA expression, the NLRP3 protein expression was significantly elevated in differentiated THP-1 cells exposed to the conditioned medium from MDA-MB-231 (Fig. 3) and MDA-MB-468 cells (Fig. 4), and this was inhibited by curcumin treatment in a concentration-dependent manner. Under the same experimental conditions, ASC protein expression apparently diminished in comparison to the vehicle-treated group, whereas curcumin pretreatment had no significant effect (Fig. 3 and 4) The protein expression of pro-caspase-1 did not change substantially among the groups. In conjunction with the IL-1β secretion and IL1B mRNA expression, pro-IL-1β protein expression was also elevated in the THP-1 cells in the presence of conditioned media from both MDA-MB-231 (Fig. 3) and MDA-MB-468 (Fig. 4) cells.

Figure 3. Effects of curcumin pretreatment on expression of proteins associated with inflammasomes in THP-1 cells exposed to MDA-MB 231 cell conditioned media.

THP-1 cells were differentiated with PMA and pretreated with curcumin as described in the legend to Figure 1 prior to exposure to the conditioned media. Data are expressed as mean ± SEM (n = 3). *,**,***Significantly different (*P < 0.05; **P < 0.01; ***P < 0.001) compared with the vehicle-treated group. ##,###Significantly different (##P < 0.01; ###P < 0.001) when compared with the group treated with the conditioned media alone. THP-1, human monocytic leukemia cell line; PMA, phorbol 12-myristate 13-acetate; CM, conditioned medium; ASC, apoptosis-associated speck-like protein containing a caspase recruitment domain; IL-1β, interleukin-1 beta; MDA-MB-231, MD Anderson metastatic breast 231; NLRP3, NOD-like receptor family pyrin domain-containing 3.

Figure 4. Effect of curcumin pretreatment on inflammasome-associated protein expression induced by MDA-MB 468-derived conditioned media.

THP-1 cells were differentiated with PMA and pretreated with curcumin as described in the legend to Figure 1 prior to exposure to the conditioned media. ***Significantly different (P < 0.001) from the vehicle-treated control. ##,###Significantly different (##P < 0.01; ###P < 0.001) when compared with the group treated with the conditioned media alone. THP-1, human monocytic leukemia cell line; PMA, phorbol 12-myristate 13-acetate; CM, conditioned medium; ASC, apoptosis-associated speck-like protein containing a caspase recruitment domain; IL-1β, interleukin-1 beta; MDA-MB-468, MD Anderson metastatic breast 468; NLRP3, NOD-like receptor family pyrin domain-containing 3; Pro-IL-1β, pro-interleukin-1 beta; Pro-caspase-1, procaspase-1.

DISCUSSION

The interaction between breast cancer cells and macrophages within the TME creates a self-sustaining loop of inflammation that drives tumor progression [11]. Our study demonstrates that conditioned media from two distinct TNBC subtypes-the mesenchymal-like MDA-MB-231 and the basal-like MDA-MB-468-effectively "re-educates" THP-1 monocytes into a pro-tumorigenic TAM-like phenotype, in which the NLRP3/caspase-1/IL-1 axis is activated. It has been reported that NLRP3-mediated release of IL-1β activates NF-κB, β-catenin, AKT, and HIF-1α, leading to oncogene expression, VEGF production, and EMT [25]. Furthermore, cytokines derived from inflammasomes promote immune evasion by inhibiting anti-tumor T cell and NK cell responses, promoting immune checkpoint expression, and increasing the recruitment of immunosuppressive cells, including myeloid-derived suppressor cells [25]. Therefore, targeting the NLRP3 inflammasome represents a promising therapeutic strategy in the management of breast cancer [26].

In the present study, we found that curcumin efficiently inhibited tumor-induced inflammasome activation in THP-1-derived macrophages. IL-1β, a major downstream effector of inflammasome activation, is critically involved in tumor-promoting inflammation within the TME. The increase in IL-1β levels has been found to correlate with elevated tumor invasiveness and metastatic ability in various cancer types [27].

Our study demonstrates that curcumin treatment diminishes IL-1β secretion in a concentration-dependent manner in THP-1 monocytes treated with conditioned media from breast cancer cells, indicating its suppression of the inflammasome activation. Similar to other bioactive compounds that target tumor-associated macrophages and regulate their pro-tumorigenic functions [28], curcumin appears to regulate key inflammatory pathways involved in cancer progression. Consequently, curcumin not only possesses direct anti-cancer activity but also disrupts the tumor-supportive microenvironment by attenuating IL-1β–mediated inflammasome signaling in TAM-like cells.

Mechanistically, the suppression of the inflammasome priming step and translation can be associated with the decrease in IL-1β secretion. The expression of major inflammasome components, such as NLRP3, ASC (encoded by PYCARD), IL-1 (encoded by IL1B), and caspase-1 (encoded by CASP1), is primarily regulated through NF-κB–dependent transcription. NF-κB signaling plays a pivotal role in regulating the expression of inflammatory genes in macrophages [29]. The inflammasome complex, composed of NLRP3, ASC, and caspase-1, functions as a coordinated signaling platform that regulates the maturation of pro-inflammatory cytokines. NLRP3 recruits ASC upon activation, which enables the assembly and activation of pro-caspase-1 into its cleaved, active form. Pro-IL-1β is subsequently converted to mature IL-1β by active caspase-1, which is the final functional consequence of inflammasome signaling [30]. Our study shows that conditioned media from breast cancer cells exert differential effects on expression of inflammasome components.

The inflammasomes were activated in response to tumor-derived signals, as evidenced by the increased expression of NLRP3 at both the mRNA and protein levels under TME-mimicking conditions. Nevertheless, curcumin pretreatment did not substantially alter NLRP3 mRNA expression, but it did significantly reduce NLRP3 protein levels. This discrepancy implies that curcumin regulates NLRP3 at the post-transcriptional level, rather than predominantly affecting transcriptional priming [10]. It is well established that protein abundance does not necessarily correlate with mRNA levels due to differences in translation efficiency and protein stability [31]. Post-translational processes, such as ubiquination and subsequent proteasomal degradation, drive NLRP3 activation. These processes are important in the inflammasome stimulation [10]. Therefore, curcumin suppresses inflammasome activity, most likely by modulating the stability of NLRP3, rather than through inhibition of its de novo synthesis.

Both ASC protein and its mRNA transcript, PYCARD were consistently reduced following stimulation with breast cancer–conditioned medium, indicating coordinated downregulation of this inflammasome adaptor in response to tumor-derived factors. This finding suggests that breast cancer cells may actively suppress ASC expression in macrophages within the TME. Because ASC functions as a scaffold for inflammasome assembly and also participates in apoptosis-related signaling, its downregulation may represent a tumor-driven adaptation to limit inflammasome-dependent cytotoxicity (e.g., pyroptosis) while still permitting a persistent, low-grade inflammatory milieu that supports tumor progression [32]. Curcumin treatment had no effect on ASC expression at either the mRNA or protein level. This suggests that its anti-inflammatory effects may not be mediated through the modulation of this adaptor protein.

Caspase-1 represents the critical effector protease within the inflammasome complex, responsible for cleaving pro-IL-1β into its active form. In our study, stimulation of THP-1 cells with breast cancer conditioned media significantly increased CASP1 expression, indicating enhanced transcriptional priming of the inflammasome pathway. At the protein level, pro-caspase-1 showed an increasing trend. This suggests that tumor-derived signals promote caspase-1 priming, and that the regulation of its activity may occur predominantly at the level of inflammasome assembly and post-translational activation rather than total protein abundance. Curcumin treatment reduced CASP1 levels, suggesting suppression of the priming process at the transcriptional level as reported previously by other investigators [23]. However, pro-caspase-1 expression was not reduced by curcumin treatment at a protein level. This suggests that curcumin might not directly affect expression of caspase-1, but instead interferes with its catalytic activity within the inflammasome complex, leading to reduced IL-1β maturation and secretion.

Notably, IL-1β expression and secretion were markedly elevated in THP-1 cells following stimulation with breast cancer cell conditioned media, confirming effective activation of the downstream inflammasome pathway. In contrast, curcumin treatment significantly reduced expression and release of IL1B, highlighting a consistent inhibitory effect on the functional output of inflammasome signaling in cancer-induced TAM-like macrophages. Although NF-κB activity was not directly assessed in this study, the observed downregulation of inflammasome-related transcripts is consistent with previous reports demonstrating that inhibition of NF-κB signaling limits pro-IL-1β synthesis and attenuates inflammasome activation [11].

Collectively, these findings indicate that curcumin not only suppresses inflammasome activation in cancer cells [23] but also effectively modulates inflammasome signaling within TAMs and the broader TME. Curcumin disrupts the critical inflammatory axis that maintains tumor–immune crosstalk by attenuating IL-1β at transcriptional, protein, and secretion levels. Thus, curcumin has a therapeutic potential in limiting breast cancer progression by targeting both cancer cells and the tumor-supportive stromal cells, particularly TAMs.

The post-translational suppression of NLRP3 by curcumin observed in this research may be associated with its well-established anti-oxidant capacity. Reactive oxygen species (ROS) serve as a significant upstream signal for the formation of the NLRP3 inflammasome [33], and curcumin can efficiently attenuate the cellular redox signals necessary for the activation of the inflammasome complex by directly scavenging ROS and/or through upregulation of Nrf2-induced antioxidant gene expression.

In summary, the breast cancer–derived conditioned media induces a pro-tumorigenic TAM-like phenotype in macrophages by activating the NLRP3 inflammasome axis, resulting in increased caspase-1 priming and IL-1β production. Curcumin attenuates activation of inflammasome signaling by reducing the expression of NLRP3 protein and also the expression and secretion of IL-1β. This event restricts the inflammatory output within the TME, thereby disrupting the tumor–immune crosstalk as illustrated in Figure 5. All of these discoveries underscore curcumin's potential as a prospective modulator of macrophage-driven inflammation in the TME of breast cancer.

Figure 5. Graphical representation of the proposed mechanism underlying inhibition of NLRP3 inflammasome axis by curcumin in the TAM-like THP-1 model.

CM, conditioned medium; THP-1, human monocytic leukemia cell line; TME, tumor microenvironment; NLRP3, NOD-like receptor family pyrin domain-containing 3; PYCARD, PYD and CARD domain-containing; CASP1, caspase-1; IL1B, interleukin-1 beta (gene); ASC, apoptosis-associated speck-like protein containing a caspase recruitment domain; IL-1β, interleukin-1 beta (protein); TAM, tumor-associated macrophage; MDA-MB-231, MD Anderson metastatic breast 231; MDA-MB-468, MD Anderson metastatic breast 468; NF-κB, nuclear factor kappa B.

Despite these findings, there are several limitations in our present study. The activation status of active caspase-1 was not evaluated, and NF-κB signaling was not experimentally validated. In addition, other key markers of inflammasome activation, such as mature IL-1β, ASC speck formation, Gasdermin D (GSDMD) cleavage, and pyroptosis-related events, were not assessed. Consequently, additional research is necessary to elucidate the upstream regulatory mechanisms. Furthermore, the in vitro THP-1-derived macrophage model employed in this investigation does not adequately represent the in vivo TME. Although previous in vivo studies have demonstrated the anti-inflammatory and anti-tumor effects of curcumin, such models often lack the resolution to specifically dissect macrophage reprogramming and inflammasome dynamics within defined tumor–immune interactions. Therefore, further studies are warranted to validate whether the modulation of the NLRP3 inflammasomes can be translated into physiologically relevant therapeutic outcomes.

SUPPLEMENTARY MATERIALS

Supplementary materials can be found via https://doi.org/10.15430/JCP.26.026.