Vibrio parahaemolyticus_AHPND infection altered eicosanoid biosynthesis in the gastrointestinal tract of Litopenaeus vannamei

Abstract

Acute Hepatopancreatic Necrosis Disease (AHPND) is one of the main culprits for massive shrimp mortality in the aquaculture industry. AHPND is caused by Vibrio parahaemolyticus (VP_AHPND) containing plasmids for the PirA and PirB binary toxins. These toxins cause sloughing and cell death in the hepatopancreatic tubules as well as inflammation in the shrimp gastrointestinal tract. Nevertheless, changes in the pro- and anti-inflammatory signaling molecules have yet to be reported. Here, we examined changes in eicosanoid biosynthesis in the Litopenaeus vannamei gastrointestinal tract infected with VP_AHPND isolate 5HP. At 24 h post-infection, cyclooxygenase enzyme levels increased in the hepatopancreases of VP_AHPND-infected shrimp. The transcription levels of cytosolic phospholipase A2 were elevated in the intestines of VP_AHPND-infected shrimp compared with control shrimp. Although the eicosanoid and PUFA profiles were differentially altered in shrimp hepatopancreas, stomach, and intestines, the levels of prostaglandin F_2α were elevated, whereas the levels of 5-hydroxyeicosapentaenoic acid and 5-hydroxyeicosatetraenoic acid were suppressed in all three organs of VP_AHPND-infected shrimp. These findings suggest that eicosanoid changes may serve as biomarkers for shrimp gastrointestinal health. Moreover, they indicate the conserved nature of the eicosanoid biosynthesis pathway in the host-pathogen response to bacterial infection in crustaceans.

Graphical abstract

Highlights

• •VP_AHPND infection increased the levels of cyclooxygenase enzyme in hepatopancreas.
• •Cytosolic phospholipase A2 transcripts increased in VP_AHPND-infected intestines.
• •VP_AHPND infection suppressed 5-HEPE and 5-HETE levels in the shrimp GI tract.
• •VP_AHPND infection elevated prostaglandin F_2α levels in the shrimp GI tract.
• •Eicosanoids are part of the host's response to bacterial infection in crustaceans.

1. Introduction

Acute hepatopancreatic necrosis disease (AHPND) was first discovered in China in 2009 after mass mortality of Penaeus monodon and Litopenaeus vannamei [[1], [2], [3]]. Since then, the disease has spread throughout Southeast Asia [1,3]. AHPND is caused by a specific isolate of Vibrio parahaemolyticus (VP_AHPND) that encodes Pir-like binary toxins, namely PirA and PirB [4,5]. VP_AHPND infects and colonizes the shrimp stomach cuticle, where it secretes PirA/PirB toxins that damage hepatopancreatic cells [6,7]. During early infection, the number of fat storage cell vesicles and fat droplets in shrimp hepatopancreases decreases. As infection progresses, severe atrophy and sloughing of hepatopancreatic epithelial cells are observed [3]. Shrimp become lethargic and anorexic, resulting in 100% mortality in severely affected ponds [3]. Although inflammatory responses in shrimp hepatopancreases have been reported [3,8], changes in the associated inflammatory signaling molecules, such as eicosanoids, remain unexplored.

The production of eicosanoids begins with the extraction of eicosapentaenoic acid (EPA) and arachidonic acid (ARA) from the phospholipid bilayer via cytosolic phospholipase A2 (cPLA2) enzyme [9]. In the prostaglandin biosynthesis pathway, ARA is converted to prostaglandin H₂ (PGH₂) by the cyclooxygenase enzyme. PGH₂ subsequently binds to various prostaglandin synthases to produce prostaglandin D₂ (PGD₂), prostaglandin E₂ (PGE₂), and prostaglandin F_2α (PGF_2α). Additionally, PGD₂ can undergo further non-enzymatic reactions to become 15-deoxy-Δ^12,14-prostaglandin J₂ (15d-PGJ₂) [10]. Alternatively, ARA and EPA are converted by lipoxygenase enzymes to produce signaling molecules, such as hydroperoxyeicosatetraenoic acid (HPETE), leukotrienes, hydroxyeicosatetraenoic acid (HETE), and hydroxyeicosapentaenoic acid (HEPE) [11,12].

This study investigated changes in the eicosanoid biosynthesis pathway in the gastrointestinal tract of shrimp infected with VP_AHPND. Results showed the upregulation of the eicosanoid biosynthesis pathway at the translation level, with metabolic changes varying according to the specific organ examined. These data highlight the conserved role of the eicosanoid biosynthesis pathway in the crustacean immune response to bacterial infection.

2. Materials and methods

2.1. Ethical statement

Shrimp rearing and VP_AHPND challenge was performed according to the guidelines and requirements from Animal Research: Reporting of In Vivo Experiments (ARRIVE) as well as international and national legal and ethical requirements [13,14]. The VP_AHPND challenge was authorized by the Institutional Animal Care and Use Committee of the National Center for Genetic Engineering and Biotechnology (BT-Animal 02/2565).

2.2. VP_AHPND challenge

L. vannamei (2-3 g body weight) were acclimated in 10 x 300-L tanks (N = 80 each). The shrimp were fed with commercial feed twice daily at 3% body weight. Water temperature was maintained at 28 – 30°C, pH between 7.8 and 8.3, salinity levels at 20 ppt, total ammonia nitrogen <5 ppm, and nitrite <0.5 ppm. VP_AHPND isolate 5HP was cultured in 1L of Tryptic soy broth (TSB) with 1.5% NaCl. The culture was added to five VP_AHPND rearing tanks to achieve a 10⁴ CFU/mL final concentration. One liter of TSB (1.5% NaCl) was added to the control tanks. Shrimp were challenged for 24 h. Shrimp hepatopancreas, stomach, and intestine were collected as previously described [15].

2.3. Verification of VP_AHPND infection using the AP4 nested PCR

The VP infection was confirmed using nested PCR analysis of the AP4 gene (abbreviated from AHPND detection version 4) [16]. The primers for the first-step PCR reaction are AP4-F1 (5′ ATGAGTAACAATATAAAACATGAAAC) and AP4-R1 (5′ ACGATTTCGACGTTCCCCAA 3′). The nested PCR was performed using the products from the first-step PCR reaction as a template. The primers are AP4-F2 (5′ TTGAGAATACGGGACGTGGG 3′) and AP4-R2 (5′ GTTAGTCATGTGAGCACCTTC 3’). The annealing temperature and PCR conditions were performed as previously described [16].

2.4. Quantitative real-time PCR (qPCR) analysis

Shrimp organs were homogenized separately in liquid N₂ using a pestle and mortar. RNA extraction was performed using 40 mg of shrimp tissue per 1 ml Trizol reagent (Invitrogen, California, USA). Total RNA was dissolved in DEPC-treated water, and the contaminated genomic DNA was removed by treatment with DNase I (Promega, Wisconsin, USA) at 0.15 U/μg total RNA at 37°C for 30 min [15]. DNase-treated RNA was used as a template for the RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Massachusetts, USA) according to the manufacturer's instructions. The oligo (dT)18 was selected as a primer for the cDNA synthesis.

The qPCR analysis was performed using 500 ng of cDNA as a template and the SsoFast™ EvaGreen® Supermix (Bio-Rad, California, USA). The fold change in the prostaglandin biosynthesis gene transcripts relative to elongation factor 1α (EF1α) was determined [17]. Primer sequences of the genes of interest and EF1α are shown in Supplementary Table 1.

2.5. Immunohistochemical analysis of shrimp hepatopancreas

Fifty shrimp cephalothoraxes were fixed, embedded in paraffin block, and sectioned onto the Histogrip-coated glass slides (Invitrogen) [15,18]. The slides were incubated in the anti-cyclooxygenase antibody (Cat No. ab244261, Abcam, United Kingdom) diluted at a 1:50 (v/v) in PBS in a moist chamber at 37°C overnight. The slides were submerged in PBS and placed under constant agitation for 5 min. The PBS was removed, and the washing process was repeated twice. The slides were incubated in an HRP-conjugated goat anti-rabbit antibody diluted in PBS at a 1:500 (v/v) for 1 h at room temperature. Subsequently, these slides were washed 3 times with PBS for 5 min each. The peroxidase reaction was performed for 30 min using a peroxidase substrate kit (VECTOR NovaRED, California, USA). The slides were washed with distilled water and counterstained with hematoxylin for 30 s. The tissues were dehydrated, cleared, mounted, and photographed [19]. The images were analyzed with the ImageJ program (LOCI, University of Wisconsin) to determine the immunoreactive signals in shrimp hepatopancreas [20].

2.6. Ultra-high performance liquid chromatography high-resolution tandem mass spectrometry (UHPLC-HRMS/MS) analysis

Shrimp organs were homogenized in liquid N₂ and diluted in Hank's Balanced Salt Solution (Invitrogen). The 500-μL aliquot of organ homogenates was mixed with 10 μL of 10% butylated hydroxytoluene (Sigma-Aldrich, Missouri, USA) in ethanol (w/v) and adjusted to pH 4.0 by adding 5 μL of glacial acetic acid (Merck, New Jersey, USA). Deuterated eicosanoid standards, including EPA-d₅, 5-HETE-d₈, and PGE₂-d₄ (Cayman Chemicals, Michigan, USA), were added to the homogenates to determine percent recovery. The mixtures were subjected to ethyl acetate extraction as previously described [15]. The pooled organic phase was dried under speed vacuum and stored at −80°C.

The dried ethyl acetate extract was reconstituted in 100% HPLC-grade ethanol (Thermo Fisher Scientific). Subsequently, 12-HETE-d8 (Cayman Chemical, Michigan, USA) was added to the extract as an internal standard for quantitative analysis. The extract was separated via liquid chromatography using the Waters Acclaim™ RSLC 120C18 (2.1 × 150 mm, 2.2 μm) column. Mobile phase A consisted of 0.01% (v/v) acetic acid in water. Mobile phase B consisted of 0.01% (v/v) acetic acid in acetonitrile. An Orbitrap Fusion™ Tribrid™ mass spectrometer (Thermo Fisher Scientific) with an electrospray ionization (ESI) source was operated in a negative ion mode using Xcalibur software (version 4.4.16.14). Additionally, the instrument calibration was performed using the Pierce™ FlexMix™ calibration solution (Thermo Fisher Scientific). The tandem mass spectrometry acquisition parameters and the scheduled parallel reaction monitoring (PRM) method were performed as previously described [21].

2.7. Statistical analysis

Significant differences between the means of the control and VP_AHPND-infected groups were determined using the t-test (P < 0.05 for * and P < 0.01 for **).

3. Results

3.1. VP_AHPND challenge

The VP_AHPND challenge was performed to collect the hepatopancreases, stomachs, and intestines at 24 h post-infection (hpi) (Fig. 1A). Nested PCR analysis for the AP4 gene detected the 1^st and nested PCR products at 1269 and 230 bp, respectively. The lack of PCR products indicated the absence of VP_AHPND in the control tanks (Fig. 1B). Additionally, VP_AHPND infection was confirmed in Tanks 2 to 5 of the VP_AHPND-infected group (Fig. 1C). A low VP_AHPND infectivity was observed in Tank 1 of the VP_AHPND-infected group, which was excluded from further analysis.

Fig. 1.

VP_AHPND infection resulted in the upregulation of eicosanoid biosynthesis at the transcription and enzymatic levels.

(A) Outline for the VP_AHPND cohabitation challenge. Created in BioRender. Wimuttisuk, W. (2026) https://BioRender.com/w6c8whq. Shrimp stomachs from the control (B) and VP_AHPND-infected shrimp (C) were subjected to AP4 nested PCR to confirm the infection. M, N, and P indicate molecular weight markers, negative control (water), and positive control (plasmid), respectively. Shrimp hepatopancreases collected from the (D to F) control and (G to I) VP_AHPND-infected groups were subjected to immunohistochemistry analysis. Micrographs show H&E staining (D and G) and immunoreactivity of COX in the hepatopancreas of the negative control group (E and H) and the VP_AHPND-infected group (F and I). The black arrowhead points to the localization of the immunoreactive signal to the COX antibody at the apical compartment of B cells. (J) A semi-quantitative analysis of the COX immunoreactive signals was performed on the control and VP_AHPND-infected groups. The transcription levels of (K) cPLA2, (L) COX, and (M) PGFS genes in shrimp hepatopancreases (HP), stomachs (ST), and intestines (IN) of the control (white bars) and VP_AHPND-infected shrimp (black bars) collected at 24 hpi. Asterisk marks a significant difference between the VP_AHPND-infected group and the control group using t-test (* for P < 0.05 and ** for P < 0.01).

3.2. Immunohistochemical analysis of COX in shrimp hepatopancreas

The cellular structure of shrimp hepatopancreases collected from the control and VP_AHPND-infected groups was confirmed using hematoxylin and eosin staining (Fig. 1D and G). Negative controls were performed on the control and VP_AHPND-infected group to confirm the absence of COX immunoactivity signal (Fig. 1E and H). The L. vannamei COX enzyme was detected based on the red-brown precipitates, which localized in the apical compartment of B cells in the hepatopancreases of VP_AHPND-infected shrimp and control shrimp (Fig. 1F and I, black arrows). Vesicles in B-cells were less clearly visible in the hepatopancreas of VP_AHPND-infected samples compared to the control group. Moreover, COX immunoreactive signals from the VP_AHPND-infected shrimp were higher than those of the control shrimp (Fig. 1J).

3.3. Quantitative real-time PCR analysis of eicosanoid biosynthesis genes

The qPCR analysis was performed on cDNA extracted from shrimp hepatopancreases, stomachs, and intestines to determine changes in the transcription levels of cPLA2, COX, and prostaglandin F synthase (PGFS). VP_AHPND infection increased the transcription levels of cPLA2 in shrimp intestines (Fig. 1K). On the other hand, the transcription levels of COX and PGFS were comparable in all three organs of the control and VP_AHPND-infected shrimp (Fig. 1L and M).

3.4. Changes in the eicosanoid profiles in the gastrointestinal tract of VP_AHPND-infected shrimp

The UHPLC-HRMS/MS analysis was performed on ethyl acetate extracts of shrimp hepatopancreases, stomachs, and intestines. The analysis revealed the presence of 13 eicosanoids, including PGF_2α, 15d-PGJ₂, six isomers of hydroxyeicosapentaenoic acids (HEPE), including 5-, 8-, 9-, 12-, 15-, and 18-HEPE, and five isomers of hydroxyeicosatetraenoic acids (HETE), including 5-, 8-, 9-, 11-, and 12-HETE. Additionally, the UHPLC-HRMS/MS also detected the levels of three polyunsaturated fatty acids (PUFAs), including ARA, docosahexaenoic acid (DHA), and EPA.

In shrimp hepatopancreas, the levels of PGF_2α, 8-HEPE, 12-HEPE, 8-HETE, and 12-HETE were higher in the VP_AHPND-infected shrimp than the control shrimp (Fig. 2). Although VP_AHPND infection did not affect the levels of 15d-PGJ₂, DHA, and EPA, the levels of 5-HEPE, 9-HEPE, 15-HEPE, 18-HEPE, 5-HETE, 9-HETE, 11-HETE, and ARA were lower in the hepatopancreases of VP_AHPND-infected shrimp compared to the control shrimp, suggesting the differential regulation of eicosanoid biosynthesis in response to VP_AHPND infection within shrimp hepatopancreas.

Fig. 2.

Levels of eicosanoids and PUFAs in the hepatopancreases of the control and VP_AHPND-infected shrimp.

Relative abundance of (A) PGF_2α, (B) 15d-PGJ₂, (C) 5-HEPE, (D) 8-HEPE, (E) 9-HEPE, (F) 12-HEPE, (G) 15-HEPE, (H) 18-HEPE, (I) 5-HETE, (J) 8-HETE, (K) 9-HETE, (L) 11-HETE, (M) 12-HETE, (N) ARA, (O) DHA, and (P) EPA in shrimp hepatopancreases were compared between the control (white bars) and VP_AHPND-infected groups (black bars). Data is shown as means ± SD. Asterisk marks a statistically significant difference in eicosanoid levels in hepatopancreases of shrimp between the two groups using the t-test (* for P < 0.05 and ** for P < 0.01).

A similar analysis was performed on shrimp stomachs, revealing that VP_AHPND infection increased the levels of PGF_2α, 15d-PGJ₂, 11-HETE, ARA, DHA, and EPA (Fig. 3). On the other hand, the levels of 5-HEPE, 9-HEPE, 12-HEPE, 15-HEPE, 18-HEPE, 5-HETE, 9-HETE, and 12-HETE were suppressed by VP_AHPND infection. Lastly, the levels of 8-HEPE and 8-HETE remained unchanged in the VP_AHPND-infected shrimp compared to the control shrimp.

Fig. 3.

Levels of eicosanoids and PUFAs in the stomachs of the control and VP_AHPND-infected shrimp.

Relative abundance of (A) PGF_2α, (B) 15d-PGJ₂, (C) 5-HEPE, (D) 8-HEPE, (E) 9-HEPE, (F) 12-HEPE, (G) 15-HEPE, (H) 18-HEPE, (I) 5-HETE, (J) 8-HETE, (K) 9-HETE, (L) 11-HETE, (M) 12-HETE, (N) ARA, (O) DHA, and (P) EPA in shrimp stomachs were compared between the control (white bars) and VP_AHPND-infected groups (black bars). Data is shown as means ± SD. Asterisk marks a statistically significant difference in eicosanoid levels in the stomachs of shrimp between the two groups using the t-test (* for P < 0.05).

Although the shrimp intestine was not the primary target for the PirA and PirB binary toxin, the highest number of eicosanoids and PUFAs was upregulated in the intestines of VP_AHPND-infected shrimp compared to other organs. VP_AHPND infection elevated the levels of PGF_2α, 15d-PGJ₂, 8-HEPE, 12-HEPE, 8-HETE, 11-HETE, 12-HETE, ARA, EPA, and DHA compared to those of the control shrimp (Fig. 4). Conversely, the intestines of VP_AHPND-infected shrimp contained lower levels of 5-HEPE and 5-HETE than the control shrimp. On the other hand, the levels of 9-HEPE, 15-HEPE, 18-HEPE, and 9-HETE were unaffected by VP_AHPND infection.

Fig. 4.

Levels of eicosanoids and PUFAs in the intestines of the control and VP_AHPND-infected shrimp.

Relative abundance of (A) PGF_2α, (B) 15d-PGJ₂, (C) 5-HEPE, (D) 8-HEPE, (E) 9-HEPE, (F) 12-HEPE, (G) 15-HEPE, (H) 18-HEPE, (I) 5-HETE, (J) 8-HETE, (K) 9-HETE, (L) 11-HETE, (M) 12-HETE, (N) ARA, (O) DHA, and (P) EPA in shrimp intestines were compared between the control (white bars) and VP_AHPND-infected groups (black bars). Data are shown as means ± SD. Asterisk marks a statistically significant difference in eicosanoid levels in shrimp intestines between the two groups using the t-test (* and ** for P < 0.05 and P < 0.01, respectively).

4. Discussion

This study explores changes in the eicosanoid biosynthesis pathway as part of the crustacean host-pathogen responses to VP_AHPND infection in L. vannamei. The immunohistochemistry analysis demonstrated that VP_AHPND infection increased the levels of COX transcripts in shrimp hepatopancreas. Additionally, the UHPLC-HRMS/MS analysis revealed that VP_AHPND infection differentially altered the levels of eicosanoids and PUFAs in shrimp hepatopancreas, stomach, and intestine.

During the initial phase of VP_AHPND infection, the levels of VP_AHPND presented in shrimp were correlated with the reduction in size of hepatopancreatic R and B cells [22]. As the VP_AHPND infection became more severe, the atrophy in the shrimp hepatopancreas was observed due to extensive shedding and sloughing of hepatopancreatic tubular epithelial cells [22]. Because eicosanoids are early responders to bacterial and viral infections in mammals, our study examined changes that occurred at 24 hpi. The immunostaining signals revealed that COX was localized at the apical compartment of the B cells in both the control and VP_AHPND-infected shrimp, suggesting that B cells are the production sites for prostaglandins in hepatopancreatic cells. Additionally, the increasing COX immunoreactive signals in the VP_AHPND-infected hepatopancreas suggest the upregulation of eicosanoid biosynthesis. A separate study with the transcriptomic and metabolomic analysis of L. vannamei hepatopancreas infected with VP_AHPND uncovered the upregulation of phospholipase A2 (PLA2) and COX transcripts as well as increasing levels of ARA [23]. While the upregulation of COX transcripts matched the immunohistochemistry results from our study, the levels of ARA and cPLA2 transcripts differed. In fact, the absence of cPLA2 transcripts in hepatopancreas samples in this study may be responsible for the reduction of ARA levels in the hepatopancreases of VP_AHPND-infected shrimp.

Recently, the UHPLC-HRMS/MS analysis of L. vanmamei post-larvae led to the identification of 9 eicosanoids, including PGF_2α, 15d-PGJ₂, 5-HEPE, 8-HEPE, 12-HEPE, 18-HEPE, 8-HETE, 11-HETE, and 12-HETE [24]. Our study was able to identify four additional eicosanoids, namely 9-HEPE, 15-HEPE, 5-HETE, and 9-HETE, in the L. vannamei gastrointestinal tract, which indicates that the production of certain eicosanoids does not occur at the post-larvae stage. Moreover, HETE and HEPE, which were hydroxylated at the same carbon position, responded the same way to VP_AHPND infection. We believe that their shared response likely depends on the availability of a specific lipoxygenase enzyme, which converts ARA into HETE and EPA into HEPE by placing the hydroxyl group at the same carbon position [25,26]. Nevertheless, the lipoxygenase genes have yet to be identified in crustaceans.

Although it was reported that the PirA and PirB binary toxin causes damage in shrimp hepatopancreas, several studies revealed that indicators for inflammation were also observed in the stomach and intestine of VP_AHPND-infected shrimp [22,[27], [28], [29]]. For example, the L. vannamei with a severe VP_AHPND infection displayed severe necrosis in the hepatopancreatic tubules, the detachment of epithelial cells, and hemocyte infiltrations in the shrimp stomachs and intestines [27]. The effects of VP_AHPND infection in the shrimp gastrointestinal tract were also reported in the brine shrimp, in which PirA and PirB toxins resulted in necrosis and damaged epithelial cells as well as disrupting enterocytes in the hindgut and midgut regions [22]. Additionally, VP_AHPND infection disrupted intestinal function by increasing intestinal permeability and reducing nutrient absorption in L. vannamei [28].

By establishing the eicosanoid biosynthesis pathway as part of the host-pathogen response in crustaceans, this study not only connects the previously existing pathway for the regulation of crustacean innate immunity but also emphasizes the conserved function of eicosanoids among mammals, insects, and crustaceans. Future studies to examine the impact of eicosanoids on the signal transduction pathway and innate immune response will offer a more in-depth perspective on the roles of the host-pathogen response in crustaceans.

Funding

This work was carried out with financial support from the International Development Research Centre (IDRC), Canada, and the Global AMR Innovation Fund (GAMRIF), part of UK Government's Department of Health and Social Care (DHSC). The views expressed herein do not necessarily represent those of IDRC or its Board of Governors. This research also received funding support from the NSRF via the Program Management Unit for Human Resources & Institutional Development, Research and Innovation, Thailand [Grant Number B05F640184 to W.W.]. The funders do not play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

CRediT authorship contribution statement

Wananit Wimuttisuk: Conceptualization, Funding acquisition, Investigation, Project administration, Writing – original draft, Writing – review & editing. Pisut Yotbuntueng: Data curation, Formal analysis, Investigation. Pacharawan Deenarn: Data curation, Formal analysis, Investigation, Writing – review & editing. Punsa Tobwor: Formal analysis, Investigation, Writing – review & editing. Surasak Jiemsup: Methodology, Writing – review & editing. Suganya Yongkiettrakul: Supervision, Writing – review & editing. Kamonluk Kittiwongpukdee: Investigation. Siriwan Khidprasert: Conceptualization, Investigation. Chanadda Kasamechotchung: Conceptualization, Investigation. Kitlada Srichomthong: Formal analysis. Phawit Putprasert: Formal analysis, Writing – review & editing.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Glossary

5-HEPE

5-Hydroxy-6,8,11,14,17-eicosapentaenoic acid

8-HEPE

8-Hydroxy-5Z,9E,11Z,14Z,17Z-eicosapentaenoic acid

9-HEPE

9-Hydroxy-5Z,7E,11Z,14Z,17Z-eicosapentaenoic acid

12-HEPE

12-Hydroxy-5Z,8Z,10E,14Z,17Z-eicosapentaenoic acid

15-HEPE

15-Hydroxy-5,8,11,13,17-eicosapentaenoic acid

18-HEPE

18-Hydroxy-5Z,8Z,11Z,14Z,16E-eicosapentaenoic acid

5-HETE

5-Hydroxy,6E,8Z,11Z,14Z-eicosatetraenoic acid

8-HETE

8-Hydroxy-5Z,9E,11Z,14Z-eicosatetraenoic acid

9-HETE

9-Hydroxy-5Z,7E,11Z,14Z-eicosatetraenoic acid

11-HETE

11-hydroxy-5Z,8Z,12E,14Z-eicosatetraenoic acid

12-HETE

12-hydroxy-5Z,8Z,10E,14Z-eicosatetraenoic acid

15d-PGJ₂

15-deoxy-Δ^12,14-prostaglandin J₂

ARA

Arachidonic acid

cPLA2

Cytosolic phospholipase A2

COX

Cyclooxygenase

DHA

Docosahexaenoic acid

EPA

Eicosapentaenoic acid

HETE

Hydroxyeicosatetraenoic acid

HEPE

Hydroxyeicosapentaenoic acid

PGF_2α

Prostaglandin F₂ alpha

PGFS

Prostaglandin F synthase

UHPLC-MS/MS

Ultra-high performance liquid chromatography tandem mass spectrometry

Appendix A. Supplementary data

The following is the Supplementary data to this article.

Data availability

All data generated or obtained during this study are included in this article. The detailed experimental procedures will be freely available upon request. Please contact phawit@gmail.com.