A-to-I RNA Editing Endows miR-3664-5p with Carcinogenicity in Breast Cancer Through Modulating LONP2 Mediated Glycolysis

Yajing Han; Xueli Wei; Xuesen Zhang; Jianjun Wu; Fan Wang

doi:10.1007/s10911-026-09602-1

. 2026 Apr 16;31(1):19. doi: 10.1007/s10911-026-09602-1

A-to-I RNA Editing Endows miR-3664-5p with Carcinogenicity in Breast Cancer Through Modulating LONP2 Mediated Glycolysis

Yajing Han ¹, Xueli Wei ¹, Xuesen Zhang ¹, Jianjun Wu ¹, Fan Wang ^2,^✉

PMCID: PMC13429528 PMID: 41989607

Abstract

Breast cancer has become the main cause threatening women’s health. RNA editing is one of the most important mechanisms for modifying genetic information. This study explained the relationship between A-to-I RNA edited miR-3664-5p and malignant phenotype of breast cancer. The results showed that high editing level of miR-3664-5p in breast cancer, which was related to tumor stage, recurrence and prognosis of breast cancer patients. ADAR perturbation experiments demonstrated that ADAR1 is the key enzyme regulating miR-3664-5p editing in breast cancer. A series of in vitro assays revealed that miR-3664-5p functioned as a tumor suppressor in breast cancer, but ed-miR-3664-5p promoted breast cancer development. Mechanically, dual-luciferase reporter assay confirmed that ed-miR-3664-5p directly targets LONP2, yet wt-miR-3664-5p loss this binding site. ChIP assay proved that PKM2 was enriched in the transcriptional regulatory region of LONP2 gene. Seahorse XFe analysis showed that LONP2 knockdown strengthened glycolysis in breast cancer. Xenograft assay also demonstrated that edited miR-3664-5p affected glycolysis in breast cancer through the regulation of LONP2. In conclusion, A-to-I RNA editing endows miR-3664-5p with carcinogenicity in breast cancer through modulating LONP2 mediated glycolysis.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10911-026-09602-1.

Keywords: miR-3664-5p, Breast cancer, A-to-I RNA editing, LONP2, Glycolysis

Introduction

As a common malignant tumor of women, breast cancer is the leading cause of death among women [1]. Breast cancer cases in China account for 30% of the world’s total, showing an increasing trend year by year over the past few years [2]. There are many high-risk factors associated with breast cancer, such as heredity and estradiol exposure, but the cause of breast cancer is still unknown [3]. Symptoms of early breast cancer may not be apparent, and patients with terminal breast cancer may suffer from distant metastases, which directly threaten their lives [4]. And the prognosis of breast cancer is closely associated with the development stage of the disease. The earlier the disease is discovered, the greater the chance that the patient will live for 5 years [5]. Although breast cancer can be treated with surgery, radiotherapy, chemotherapy, targeted therapy, and hormone therapy, there is a high rate of recurrence following treatment [6]. Thus, exploring the important factors affecting the progress of breast cancer is crucial for early diagnosis and effective treatment.

It has become increasingly common for life forms to use RNA editing to modify their genetic code [7]. In precursor mRNA molecules, deamination of adenosine is an important mechanism for RNA editing. A-to-I editing, the deamination event, converts special adenosine into inosine. Translating inosine into guanosine (G) results in codon changes that often result in amino acid substitutions at the amino acid level [8]. Additionally to genetic recoding, A-to-I editing can alter alternative splicing, modify microRNAs, and change microRNA targets [9]. In the development of human disease, various A-to-I editing events have occurred. For example, ADAR1 inhibition increases oxidative stress sensitivity of hepatocellular carcinoma cells via regulating Keap1/Nrf2 pathway [10]. Parkinson’s disease and blood-based A-to-I editing are associated via transcriptomic analysis [11]. Gjendine et al. reported that the editing of miR-379 increased tumor growth in androgen-sensitive prostate cancer cells by attenuating its growth-suppressive function [12]. These researches highlight the significant role of A-to-I RNA-editing events in human diseases, especially tumors. To date, there have been no reports of miR-3664-5p editing events in human diseases.

In the past few decades, research has shown the role of miR-3664-5p in some human tumors. For instance, abnormal miR‑3664‑5p expression has been identified in colorectal cancer [13]. And miR‑3664‑5p was reported to suppress cell metastasis and proliferation in gastric cancer [14]. However, it is still uncertain what role miR‑3664‑5p plays in breast cancer. And the RNA modification of miR‑3664‑5p has never been reported before. In addition, our research found that LONP2 was a target of edited miR‑3664‑5p. Cui et al. implied that LONP2 knockdown has an oncogenic effect on head and neck squamous cell carcinoma [15]. And LONP2 downregulation contributed to cervical carcinogenesis by inducing oxidative stress [16]. In addition, As AAA+ ATPase and protease, the core function of LONP2 is to recognize and degrade misfolded, damaged or unnecessary protein, thus maintaining the protein steady state of peroxisome. Abnormal expression of LONP2 can lead to peroxisome dysfunction and a series of energy metabolism including glycolysis disorders [17, 18]. Glycolysis is a crucial metabolic pathway in the progression of tumors [19]. As a rule of thumb, normally, cells only undergo glycolysis when oxygen is restricted. However, cancer cells are more likely to glycolyze even when oxygen is abundant. A cancer cell differs from a normal cell on this basis, which is called the Warburg effect or aerobic glycolysis [20]. According to the above studies, we determined if LONP2 affects glycolysis of breast cancer cells.

In short, this research verified the function of original and edited miR-3664-5p in breast cancer through numerous experiments in vitro and in vivo. Meanwhile, we explained how original or edited miR-3664-5p affects LONP2 expression. The functional mechanism of wild or edited miR-3664-5p is preliminarily clarified in breast cancer, contributing to a deeper insight into the disease’s pathogenesis.

Materials and Methods

Clinical samples

In total, 78 breast cancer samples were taken from the The Fifth People’s Hospital of Datong and stored in liquid nitrogen for further analysis. Both cancer tissues and their paired adjacent normal tissues (> 5 cm from the tumor) were collected from each patient. These clinical materials were used for research with the approval of the The Fifth People’s Hospital of Datong Hospital according to Helsinki Principles. The patients’ written consent was obtained prior to sampling and analysis.

Cell Culture and Transfection

Both SK-BR-3 and MCF-7 cell lines were cultured at 37 °C in a humidified incubator with 5% CO₂ in DMEM medium with 10% FBS. Wild-type or edited miR-3664-5p mimics were purchased from GeneChem (Guangzhou, China) and transfected into breast cancer cells with Lipofectamine 3000 (Invitrogen, USA). In the control group (NC), breast cancer cells were not transfected.

ADAR Perturbation Experiment and Sanger Sequencing

Site-directed mutagenesis was used to generate mutant versions of open reading frames associated with RNA editing sites in ADAR1 and ADAR2. As a result of the substitution of E to A in ADAR1-E912A and ADAR2-E396A, editase activity was lost. Breast cancer cells were transfected with control vectors with GFP or pHAGE-V5-puromycin expression vector with ADAR1-E912A, ADAR1-WT, ADAR2-E396A, or ADAR2-WT. Sanger sequencing was used to evaluate the effects of ADAR perturbation.

RT-qPCR

Total RNA was extracted with Trizol reagent (Thermo Fisher Scientific, USA). From extracted RNA, cDNA was synthesized using Thermo Fisher Scientific’s High-Capacity RNA Reverse Transcription Kit (USA). Corresponding primers and SYBR Green fluorescence signal detection kit (Takara, Japan) was used for real-time qPCR. The expression level of specific mRNA was quantified the 2^-ΔΔCT method. The Primers sequences are listed below: wt-miR-3664-5p: F: AGGGTCCGAGGTATTCGCA, R: GTGCAGGGTCCGAGGT; ed-miR-3664-5p: F: AGTGGGTCTCTGGGCTTG, R: GTGCAGGGTCCGAGGT; ADAR1: F: GCAGCCATCTACGACATCGT, R: CTGCTCCAGGTACTTGGTGG; ADAR2: F: CAGCAGATCCACAACCACCA, R: GGTAGGCGTTGTCCTTGCTC; LONP2: F: GGAGGCTGTTCAAGGTGCTG, R: CCAGGCACTGTTGTCCTCAT; U6: F: CTCGCTTCGGCAGCACA, R: AACGCTTCACGAATTTGCGT; GAPDH: F: GGAGTCAACGGATTTGGTCGT, R: GACAAGCTTCCCGTTCTCAG.

Colony Formation Assay

Transfected breast cancer cells (1 × 10³ cells/well) plated in six-well plates were cultured for two weeks at 37℃. In addition to paraformaldehyde fixation, 1% crystal violet staining was performed to determine the colonies, which were then enumerated and photographed.

MTT Assay

A 96-well plate was seeded with transfected breast cancer cells (5 × 10³ cells/well) and incubated at 37 °C and 5% CO₂. Following the addition of MTT (5 mg/mL, 20 µL/well) at 0, 12, 24, 48, and 72 h, the cells underwent a four-hour incubation. A microplate reader was used to detect the absorbance at 570 nm after removing the culture medium and adding 150 L/well of DMSO.

Transwell Assay

Invasion experiments were conducted using an 8 m diameter Transwell chamber with Matrigel matrix adhesive. The upper chamber was filled with cell suspension (5 × 10⁴/ml) and the lower chamber with DMEM medium (FBS). Invasion cells underwent fixation with 4% paraformaldehyde, and 0.1% crystal violet was used for cell staining after 24 h of culture. Invasion cells in three random visual fields were counted under the microscope.

Wound-Healing Assay

A wound-healing assay was conducted by scratching a monolayer of breast cancer cells vertically and incubating them for 24 h to assess cell migration. An inverted microscope was used to capture images following incubation.

Target Gene Prediction

The target gene of edited or wild-type miR-3664-5p was screened in TargetScan (http://www.targetscan.org/vert_80/) database and MiREDiBase (https://ncrnaome.osumc.edu/miredibase/) database.

Dual-Luciferase Reporter Assay

The pmiRRB-Report™ vectors (RiboBio) with the 3’-UTR of LONP2 sequence were constructed and transfected into HEK293 cells with wt-miR-3664-5p or ed-miR-3664-5p mimics using Lipofectamine 3000. A commercially available positive control plasmid (pmiRRB-Report™ with a perfect miR-21 target site) was used to validate the assay system. The empty pmiRRB-Report vector served as a negative control. A mutant reporter plasmid, in which the predicted binding site was disrupted by site-directed mutagenesis, was used to confirm specificity. To measure luciferase activity, the Dual-Luciferase Reporter Assay System (Promega Corporation) was utilized after 48 h.

ChIP Assay

In accordance with the instructions of an EZ ChIP kit (Millipore, Germany), transfected MCF-7 cells were fixed with 1% formaldehyde to crosslink DNA–protein complexes for 10 min. After that, the crosslinking was terminated by adding glycine for 5 min. The cells (10⁶) were lysed with 100µL SDS lysis buffer (SDS lysis buffer + proteinase inhibitor cocktail II). Next, the DNA from the cell lysate was ultrasonically broken into 200 bp fragments. IgG antibody (Millipore) and PKM2 monoclonal antibody (CST #4053; Cell Signaling Technology) were used for ChIP assay. The purified DNA products obtained were detected by qRT-PCR to confirm whether the DNA precipitated by antibodies contained the DNA sequence of the target gene and its relative content.

Glucose Uptake and Lactate Production Measurement

First, overnight incubation was performed on cells seeded in six-well plates. We added lovastatin (0, 1, and 3 µM) to the medium the following day and carried on the culture for 48 h. We collected the medium and then measured glucose and lactate levels using the Automatic Biochemical Analyzer (AU680, Beckman, USA).

Oxygen Consumption Rate (OCR) and Extra Cellular Acidification Rate (ECAR) Measurement

Seahorse XFe analyzer (with the Cell Energy Phenotype kit) was applied to quantify glycolysis metabolism pathways of breast cancer cells. Specifically, the OCR reflects the function of cell mitochondria, and the ECAR reflects the glycolysis function. Briefly, MCF-7 cells with different treatment in the XF96 cell plate were incubated for 12 h. For OCR, cells were placed in the XF assay medium with 1 mM sodium pyruvate, 2 mM glutamine, and 4.5 g/L glucose. OCR value was detected after sequentially adding 1 µM oligomycin, 1 µM FCCP, and 1 µM rotenone. For ECAR, cells were placed in the XF assay medium with 2 mM glutamine. And ECAR was evaluated after sequentially adding 4.5 g/L glucose, 1 µM oligomycin, and 50 mM 2-DG. The basal OCR and ECAR were measured as the average rate from the initial three measurement cycles prior to the first injection. The following parameters were calculated: Basal OCR = Last measurement before Oligomycin injection; Maximal OCR = Max (Post-FCCP OCR measurements) - non-mitochondrial respiration. Basal ECAR = ECAR rate after Rotenone/Antimycin A injection; Maximal ECAR = Maximum ECAR rate after Rotenone/Antimycin A injection.

Western Blot Assay

Centrifuged supernatants were obtained by lysing transfected cells on ice for 30 min with RIPA lysate. BCA protein quantitative kit was applied to determine supernatant protein content. For electrophoretic separation, 10% SDS-PAGE gel was used, and PVDF membranes were used to transfer the separated proteins. After blocking with 5% skimmed milk for 1 h, the protein was incubated overnight at 4 °C with antibodies against ADAR1-p150 (53120, Cell Signaling Technology, Danvers, USA, 1:1000), ADAR1-p110 (sc-73408, Santa Cruz Biotechnology, Texas, USA, 1:500), LONP2 (55254-1-AP, Proteintech, Wuhan, China, 1:1000), HK2 (2867, Cell Signaling Technology, Danvers, USA, 1:1000), PKM2 (4053, Cell Signaling Technology, Danvers, USA, 1:1000), GLUT1 (ab115730, Abcam, Cambridge, UK, 1:1000) and GAPDH 60004-1-Ig, Proteintech, Wuhan, China, 1:20000). It was then incubated for 1 h at room temperature with the secondary antibody. The blots were visualized using a chemiluminescence kit (Millipore, USA).

Xenograft Assay

Female BALB/c nude mice (4–5 weeks) were maintained in a SPF environment. The experimental protocol involving animals was approved by the Animal Ethics Committee of The Fifth People’s Hospital of Datong. To establish the xenograft model, an untreated MCF-7 cell suspension (1 × 10⁶) was injected subcutaneously into the left flanks of the nude mice, and the mice were subsequently housed under pathogen-free conditions. After cell injection, wt or ed-miR3664-5p mimics were encapsulated into DOPC for in vivo delivery. The intraperitoneal injection of the DOPC-miRNA-PBS solution (200 µL) was administered to each mouse at twice-weekly intervals for five weeks. Tumor volume was measured every 7 days starting from day 7 post-inoculation. Finally, we extracted, weighed, and photographed the tumors.

Statistical Analysis

Data were analyzed with SPSS 20.0 statistical software and plotted with GraphPad Prism 10.0. Measuring data is expressed as mean ± SD. The comparison between groups was conducted by one-way/two-way ANOVA or T test. P < 0.05 indicates statistical significance.

Results

High Editing Level of miR-3664-5p is Identified in Breast Cancer Patients

First, a decrease in miR-3664-5p expression was noted in breast cancer tissues compared with paired adjacent normal tissues (Fig. 1A), which was related to worse clinical outcomes in breast cancer patients (Table 1). Moreover, low miR-3664-5p expression predicted poor prognoses of breast cancer patients (Fig. 1B). Furthermore, MiREDiBase database showed an A-to-I RNA editing event in miR-3664-5p. At the same time, approximately 52.6% (41/78 patients) of breast cancer patients was observed to occur miR-3664-5p overediting. In breast cancer tissues, higher editing level of miR-3664-5p was identified compared to paired adjacent normal tissues (Fig. 1C). We also found that miR-3664-5p editing level gradually increased from normal to early stage to advanced stage breast cancer (Fig. 1D). Additionally, miR-3664-5p overediting was correlated with tumor recurrence of breast cancer patients (Fig. 1E). And high miR-3664-5p editing level was detected to predict worse prognoses of breast cancer patients (Fig. 1F). Taken together, unedited and edited miR-3664-5p may both participate in breast cancer development.

Table 1.

Relationship between miR-3664-5p expression and clinic-pathological characteristics of breast cancer patients

Characteristics	Cases	miR-3664-5p		P-value
Characteristics	Cases	High	Low	P-value
Age (years)				0.665
≥ 60	44	16	28
< 60	34	14	20
Tumor size (mm)				0.023*
≤ 3	57	27	30
˃ 3	21	4	17
Lymph nodes metastasis				0.047*
Yes	49	10	39
No	29	12	17
Tumor stage				0.030*
I-II	52	10	42
III-IV	26	11	15

Open in a new tab

Statistical analyses were performed by the χ2 test

*P < 0.05 was considered significant

ADAR1 is the Key Enzyme Regulating miR-3664-5p Editing in Breast Cancer

It is well-known that adenine deaminase ADARs mediate A-to-I RNA editing, an important post-transcriptional modification. Thus, the relationship between ADARs protein (ADAR1, ADAR2) and edited miR-3664-5p was assessed in breast cancer. Breast cancer tissues expressed higher levels of ADAR1 than normal tissues. However, ADAR2 expression was low in both normal and tumor samples (Fig. 2A). Meanwhile, bioinformatics analysis of GEPIA database also showed high ADAR1 expression and low ADAR2 expression in breast cancer tissues (Fig. 2B). Moreover, Analyses of Pearson correlation showed a positive correlation between ADAR1 expression and miR-3664-5p editing levels in breast cancer patients (Fig. 2C and E), but ADAR2 has no obvious correlation (Fig. 2D and E). Consistently, ADAR perturbation experiments also demonstrated that miR-3664-5p editing levels were enhanced in SK-BR-3 and MCF-7 cells containing WT-ADAR1, whereas it was low or not observed in ADAR1-Mut, ADAR2-WT or ADAR2-Mut groups (Fig. 2F and G). Collectively, we consider that ADAR1 is the key enzyme regulating miR-3664-5p editing in breast cancer.

Fig. 2 — ADAR1 is the key enzyme regulating miR-3664-5p editing in breast cancer. A Western blot showing expression of ADAR1 and ADAR2 proteins in breast cancer patients (B) GEPIA database showed the high expression of ADAR1 and low expression of ADAR2 in breast cancer tissues (C, D) Correlation between the relative expression of ADAR1 or ADAR2 and miR-3664-5p editing in breast cancer tumor (E) Representative sequence chromatograms of edited miR-3664-5p in six patients (P1-P6); F miR-3664-5p editing level changes in MCF-7 and SK-BR-3 cells after transfection of wild-type ADAR enzymes (ADAR WT), and inactive ADAR enzymes (ADAR mut). G Representative sequence chromatograms of edited miR-3664-5p in MCF-7 and SK-BR-3 cells containing ADAR1 WT or ADAR2 WT. ** P < 0.01

A-to-I RNA Editing Endows miR-3664-5p with Carcinogenicity in Breast Cancer

To verify the specific function of wild-type (wt) and edited (ed) miR-3664-5p in breast cancer progression, wt or ed miR-3664-5p mimics was transfected into SK-BR-3 and MCF-7 breast cancer cells, and their expression was both upregulated in breast cancer cells (Fig. 3A). Compared to NC group, wt-miR-3664-5p overexpression repressed the proliferation, invasion and migration of SK-BR-3 and MCF-7 cells (Fig. 3B and E). Interestingly, SK-BR-3 and MCF-7 cell proliferation, invasion and migration were promoted by ed-miR-3664-5p mimics compared with NC group (Fig. 3B and E). Overall, miR-3664-5p plays a role in suppressing tumors in breast cancer, with A-to-I RNA editing endows miR-3664-5p with carcinogenicity.

Fig. 3 — A-to-I RNA editing endows miR-3664-5p with carcinogenicity in breast cancer. A The mRNA expression of wild-type and edited miR-3664-5p in MCF-7 and SK-BR-3 cells containing their mimics (B, C) The proliferation of MCF-7 and SK-BR-3 cells containing wild-type or edited miR-3664-5p mimics (D, E) The migration and invasion of MCF-7 and SK-BR-3 cells containing wild-type or edited miR-3664-5p mimics. ** P < 0.01

Edited miR-3664-5p Gains the Binding Site of LONP2

To gain a clearer insight into how wild-type and modified miR-3664-5p function in breast cancer, their downstream target gene was screened in MiREDiBase and TargetScanHuman database. It is predicted that LONP2 is targeted by ed-miR-3664-5p, but not its wild-type form (Fig. 4A). The reason for this difference is that wt-miR-3664-5p occurs A-to-I RNA modification at position 33 in stem-loop (Fig. 4B), which makes wt-miR-3664-5p lose its binding site with LONP2. To further confirm the above prediction, Dual-luciferase reporter assay was conducted in HEK293 cells. Ed-miR-3664-5p but not wt-miR-3664-5p mimics were found to suppress luciferase activity (Fig. 4C). Moreover, ed-miR-3664-5p overexpression led to a decreased expression of LONP2 in SK-BR-3 and MCF-7 cells, whereas wt-miR-3664-5p had little effect on LONP2 expression (Fig. 4D and E). These findings imply that ed-miR-3664-5p directly targets LONP2, but wt-miR-3664-5p lose the binding site of LONP2.

Fig. 4 — A-to-I RNA editing makes miR-3664-5p gain the binding site of *LONP2*. A *LONP2* is a unique target of ed-miR-3664-5p. B The position of miR-3664-5p that occurs A-to-I RNA editing (C) Luciferase reporter assays were applied to confirm the relationship between ed-miR-3664-5p and *LONP2*. D, E *LONP2* mRNA and protein expression in NC, wt-miR-3664-5p mimics and ed-miR-3664-5p mimics groups. ** P < 0.01

Edited miR-3664-5p Affects Glycolysis in Breast Cancer Through the Regulation of LONP2

LON protease is a highly conserved serine protease dependent on ATP, which plays an important role in maintaining mitochondrial function. Abnormal expression of LONP2 can lead to peroxisome dysfunction and a series of energy metabolism including glycolysis disorders. ChIP assay showed that the enrichment of PKM2 in LONP2 promoter was clearly enhanced compared with IgG group (Fig. 5A). In addition, the enrichment of PKM2 in LONP2 promoter was markedly decreased in sh-PKM2 group compared with sh-NC group (Fig. 5B). Above results suggested that PKM2 was enriched in the transcriptional regulatory region of LONP2 gene. Furthermore, PKM2, HK2 and GLUT1 expressions, the glycolysis-related proteins, were observed to increase in sh-LONP2 group, and ed-miR-3664-5p inhibitor reduced this increased expression. Meanwhile, wt-miR-3664-5p did not influence the function of LONP2 in breast cancer cells (Fig. 5C). A Seahorse Biosciences XF24 analyzer (North Billerica, USA) was used to determine OCR and ECAR. In MCF-7 cells with LONP2 knockdown, ECAR values significantly increased and maximal OCR values decreased (Fig. 5D and E), suggesting that LONP2 knockdown strengthen the glycolysis of breast cancer cells. However, ed-miR-3664-5p inhibitor abolished the effect of LONP2 on OCR and ECAR values, whereas wt-miR-3664-5p inhibitor showed no impact (Fig. 5D and E). Compared to NC group, the production of lactic acid and glucose consumption rate both increased in sh-LONP2 and sh-LONP2 + wt-miR-3664-5p groups. And lactic acid levels and glucose consumption rate in sh-LONP2 + ed-miR-3664-5p group was declined relative to sh-LONP2 group, while no significant difference was identified between sh-LONP2 + wt-miR-3664-5p and sh-LONP2 groups (Fig. 5F and G). All above results demonstrate that LONP2 downregulation can strengthen the glycolysis of breast cancer. And edited miR-3664-5p affects glycolysis in breast cancer through the regulation of LONP2.

Fig. 5 — Edited miR-3664-5p affects the glycolysis of breast cancer cells by regulating *LONP2* expression. A, B ChIP assay was used to test the binding between PKM2 and LONP2 promoter. C The protein expression of HK2, PKM2, and GLUT1 in MCF-7 cells with different treatment. D, E The ECAR and OCR of MCF-7 cells with different treatment. F, G The lactic acid production and glucose consumption rate of MCF-7 cells with different treatment. * P < 0.05, ** P < 0.01

A-to-I RNA Editing Endows miR-3664-5p with Carcinogenicity in vivo by Affecting LONP2 Mediated Glycolysis

To further verify our conclusion, in vivo mouse experiment was conducted. MCF-7 cells containing wt-agomir-3664 or ed-agomir-3664 were inject into mice. Mice with MCF-7 cells were established as the Blank group. We found that tumor volume and weight was noticeably decreased by wt-agomir-3664 compared to the Blank group, but was enhanced by ed-agomir-3664 (Fig. 6A and B). Additionally, tumor growth rate was slower in wt-agomir-3664 group than that in Blank group, whereas ed-agomir-3664 group showed faster growth rate (Fig. 6C). In mice with ed-agomir-3664, LONP2 expression was found to decrease, while HK2, PKM2, and GLUT1 expressions were increased. However, those protein expressions were not altered in wt-agomir-3664 group compared with Blank group (Fig. 6D). Summarily, A-to-I RNA editing endows miR-3664-5p with carcinogenicity in vivo by affecting LONP2 mediated glycolysis.

Fig. 6 — A-to-I RNA editing endows miR-3664-5p with carcinogenicity in vivo by affecting *LONP2* mediated glycolysis. A Representative tumor images. B Tumor weight in Blank, wt-agomir-3664 and ed-agomir-3664groups. C Tumor volume in Blank, wt-agomir-3664 and ed-agomir-3664 groups. D The glycolysis-related protein LONP2, HK2, PKM2, and GLUT1 expressions in Blank, wt-agomir-3664 and ed-agomir-3664 groups. ** P < 0.01

Discussion

RNA editing is one of the important post-transcriptional regulatory mechanisms, which further enriches the diversity of RNA and protein. Previous studies have recorded many A-to-I editing target genes in humans, mice, monkeys and fruit flies. The reported editing targets include nerve receptors, ion transporters and immunoreactive receptors [21–23]. However, there are few studies investigating the functions of A-to-I RNA editing in human diseases including tumors, despite scientists knowing this for many years. Thus, we clarified the function and regulatory mechanism of edited miR-3664-5p in breast cancer. Adenosine deaminase is important for A-to-I RNA editing, and the ADAR enzymes (ADAR1, ADAR2, and ADAR3) are involved in editing dsRNA in the substrate molecule [24]. Since ADAR3 expression is predominantly confined to the brain and lacks A-to-I editing activity [25, 26], this study focuses on investigating the relationship between ADAR1/ADAR2 and miR-3664-5p editing levels. This study showed that ADAR1 is the key enzyme regulating miR-3664-5p editing in breast cancer. Consistent with our result, it was found that ADAR1 attenuated the dsRNA-sensing function of malignant A-to-I RNA editing in T cells [27]. Wong et al. proved that gastric cancers can become drug-resistant and self-renewing through RNA editing of SCD1 mediated by ADAR1 [28]. All these findings indicate that ADAR1 is the key enzyme that causes edited miR-3664-5p to play a role in breast cancer.

By numerous experiments, miR-3664-5p was identified to function as a tumor inhibitor in breast cancer, and A-to-I RNA editing endows miR-3664-5p with carcinogenicity in breast cancer. Similarly, miR-3664-5p also exhibited anti-tumor effects in gastric cancer [29] and colorectal cancer [30]. Moreover, Xu et al. has been proposed that edited miR-1251-5p is more effective than wt-miR-1251-5p in terms of anti-cancer effects on LUAD development [31]. Similar to our results, editing of miR-379 was reported to attenuate the inhibitory function of wt-miR-379 in prostate cancer [32]. The above researches reflect that A-to-I RNA editing can give miRNAs new functions in human tumors. Nevertheless, there are different opinions on how this functional change is caused. Among them, there is a saying that has attracted our attention, that is, A-to-I RNA editing has caused changes in downstream target genes of miRNAs, which has led to changes in functions. Accordingly, our research investigated the downstream targets of miR-3664-5p through MiREDiBase and TargetScanHuman database. The results showed that ed-miR-3664-5p directly targets LONP2, but wt-miR-3664-5p lose the binding site of LONP2.

After a series of experiments, we found that LONP2 knockdown can strengthen the glycolysis of breast cancer. And edited miR-3664-5p affected glycolysis in breast cancer through the regulation of LONP2. It is now recognized that normal differentiated cells primarily depend on mitochondrial oxidative phosphorylation for their energy needs, whereas most cancer cells depend on aerobic glycolysis [33]. Our study identifies the peroxisomal protease LONP2 as a key regulator of the glycolytic pathway, revealing a novel layer of inter-organellar metabolic control. A central question is how LONP2, localized to the peroxisome, influences glycolysis, which occurs primarily in the cytosol. We propose that this regulation is indirect, mediated through the maintenance of peroxisomal homeostasis. Loss of LONP2 may cause peroxisomal dysfunction, impairing its core metabolic processes such as fatty acid β-oxidation. This could alter the intracellular levels of key metabolites and signaling molecules (e.g., acetyl-CoA, NADPH/NADP+ ratio, ROS) exported from peroxisomes, which are known to influence signaling pathways like AMPK that subsequently modulate the transcription or activity of glycolytic enzymes such as HK2 and PKM2. Alternatively, as a quality-control protease, LONP2 deficiency might lead to the accumulation of specific regulatory proteins that could impact glycolysis. The recently emphasized crosstalk between peroxisomes and mitochondria also presents another potential route for this regulation. While the precise mechanism requires further investigation, our data strongly support a critical role for LONP2 at the nexus of peroxisomal function and cellular energy metabolism. Moreover, this study mainly focuses on Luminal A (MCF-7 cells) breast cancer, future work will extend our findings to triple-negative breast cancer and other models.

Conclusion

In summary, high editing level of miR-3664-5p is correlated with tumor stage, recurrence and prognosis of breast cancer patients. ADAR1 is the key enzyme regulating miR-3664-5p editing in breast cancer. Edited miR-3664-5p gains the binding site of LONP2, thus endows miR-3664-5p with carcinogenicity in breast cancer. In addition to providing a theoretical foundation for breast cancer diagnosis and treatment, the findings of this study will also serve as a guide for future research.

Supplementary Information

Supplementary Material 1.^{(24.5MB, pptx)}

Acknowledgements

Not applicable.

Authors’ contributions

YJ. H completed the manuscript, XL. W and XS. Z designed the experiments and analyzed the data statistically, JJ. W and F. W reviewed and edited the manuscript. All authors reviewed the manuscript.

Funding

None.

Data Availability

Data available on request from the authors.

Declarations

Ethics Approval and Consent to Participate

Samples were collected with ethical approval from the Ethics Committee of the Fifth People’s Hospital of Datong, following the Helsinki principles, and patients did not receive chemotherapy or radiotherapy. Prior to enrollment, all patients gave written consent after being informed. The study was approved by the Animal Ethics Committee of the Fifth People’s Hospital of Datong.

Consent for Publication

All authors agree that the work will be published in a journal and understand and agree to the full terms and conditions of its publication.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

1.Sierra P, Harjot A, Anne Claudine B, Armen P. Role of AURKB Inhibition in Reducing Proliferation and Enhancing Effects of Radiotherapy in Triple-Negative Breast Cancer. Breast Cancer (Dove Med Press). 2024;16:341–6. [DOI] [PMC free article] [PubMed]
2.Leyang W, Liyuan Q, Shuhui Z, Jiahui Q, Zengzheng D, Ying S, Xiaoyao C, Lin L, Chenyang L, Xinyue Q, Xingpeng Y, Zichun H. Dual-Engineered Macrophage-Microbe Encapsulation for Metastasis Immunotherapy. Adv Mater. 2024;36:e2406140. [DOI] [PubMed]
3.Kai-Ming Z, De-Chang Z, Ze-Yu L, Yan W, Jian-Nan L, Tian D, Ling Z, Yu-Hong C, Qi-Chao Y, Qing-Shan C, Rui-Zhao C, Zi-Xuan Z, Jia-Lu S, Bing-Xin H, Hai-Liang Z, Gong-Kan F, Xiao-Feng Z, Jun T, Rong D. Inactivated cGAS-STING Signaling Facilitates Endocrine Resistance by Forming a Positive Feedback Loop with AKT Kinase in ER+HER2- Breast Cancer. Adv Sci (Weinh). 2024;11:e2403592. [DOI] [PMC free article] [PubMed]
4.Yan L, Jiahui C, Jia T, Yu H, Xinxing M, Yehui Z, Liangzhu F. Engineered CAR-NK cells with tolerance to H2O2 and hypoxia can suppress postoperative relapse of triple-negative breast cancers. Cancer Immunol Res. 2024;12:1574–88. [DOI] [PubMed]
5.Lin J, Junning P, Nan S, Hongying C, Zhenyu L, Wenhui Z, Qingyuan Z, Liru L. Effect of PR status on the prognosis of advanced ER-high HER2-negative breast cancer patients receiving CDK4/6 inhibitor combined with endocrine as first-line therapy. BMC Cancer. 2024;24:850. [DOI] [PMC free article] [PubMed]
6.Lizhao W, Jianpeng L, Nan M, Heyan C, Ligang N, Jianjun H, Ru W. Identifying subtypes and developing prognostic models based on N6-methyladenosine and immune microenvironment related genes in breast cancer. Sci Rep. 2024;14:16586. [DOI] [PMC free article] [PubMed]
7.Philipp R, Carolin F, Nicolai W, Charlotte PW, Sabrina K, John FY, Daniel TH, Jenna F, Michelle E, Nils W, Maximilian F, Laura SP, Annika ES, Yvonne F, Erez YL, Gail M, Thorsten S. Precise in vivo RNA base editing with a wobble-enhanced circular CLUSTER guide RNA. Nat Biotechnol. 2024;43:545–57. [DOI] [PMC free article] [PubMed]
8.Wan-Bing T, Jun X, Bi-Feng Y. Site-specific quantification of Adenosine-to-Inosine RNA editing by Endonuclease-Mediated qPCR. Bioorg Med Chem. 2024;110:117837. [DOI] [PubMed]
9.Miguel RLS, Brian HK, Ariela BG, Gauri G, Andy Y, Pardis A, Lora EL, Eric V, John FF, Pengfei D, Eric P, Sarah Z, Deepak AK, Ryan CT, Donjing L, You Jeong P, Esther C, Kimia Z, Emily M, Brian F, Lillian W, Hannah S, Lisa ML, Brendan S, Vanessa C, Prashant K, Claudia F, Jessica SJ, Marysia-Kolbe R, Joseph S, Girish NN, Minghui W, Bin Z, Pamela S, Noam DB, Eric ES, Panos R, Alexander WC. Michael S B. Divergent landscapes of A-to-I editing in postmortem and living human brain. Nat Commun. 2024;15:5366. [DOI] [PMC free article] [PubMed]
10.Houhong W, Xiaoyu W, Lu L, Junfeng Z, Heng L. Suppression of A-to-I RNA-editing enzyme ADAR1 sensitizes hepatocellular carcinoma cells to oxidative stress through regulating Keap1/Nrf2 pathway. Exp Hematol Oncol. 2024;13:30. [DOI] [PMC free article] [PubMed]
11.Weimin L, Hao W, Jinxia L, Zhuo W, Miao C, Xiaoli L, Ganqiang L. Transcriptomic analysis reveals associations of blood-based A-to-I editing with Parkinson’s disease. J Neurol. 2023;271:976–85. [DOI] [PubMed]
12.Gjendine V, James RC, Yvonne C. Functional consequences of A-to-I editing of miR-379 in prostate cancer cells. Sci Rep. 2023;13:16602. [DOI] [PMC free article] [PubMed]
13.Marzieh G, Ali A, Reza Y, Rezvan N, Ladan T-T. Through oxaliplatin resistance induction in colorectal cancer cells, increasing ABCB1 level accompanies decreasing level of miR-302c-5p, miR-3664-5p and miR-129-5p. Biomed Pharmacother. 2018;108:1070–80. [DOI] [PubMed]
14.Yuwen J, Haojun Y, Jun Q, Yu G, Hanyang L, Siyuan W, Liang C, Liming T. miR–3664–5P suppresses the proliferation and metastasis of gastric cancer by attenuating the NF–κB signaling pathway through targeting MTDH. Int J Oncol. 2019;54:845–58. [DOI] [PMC free article] [PubMed]
15.Xiaobo C, Yali Z, Le Z, Jiayi L, Yunfei B, Yanru C, Boqian W, Shu Z, Xin L. Role of LONP2 in head and neck squamous cell carcinoma. Gene. 2022;851:147033. [DOI] [PubMed]
16.Wanrong W, Fulin L, Kejia W, Yurou C, Hanshu W, Guo D, Wei Z. Lon Peptidase 2, Peroxisomal (LONP2) Contributes to Cervical Carcinogenesis via Oxidative Stress. Med Sci Monit. 2018;24:1310–20. [DOI] [PMC free article] [PubMed]
17.Laura CDP, Rachel R, Kelvin JAD. The peroxisomal Lon protease LonP2 in aging and disease: functions and comparisons with mitochondrial Lon protease LonP1. Biol Rev Camb Philos Soc. 2016;92:739–53. [DOI] [PMC free article] [PubMed]
18.Dominic BB, Kowcee J, Martina B, Karl XK, Marc G, Alexandra S, Jürgen BJJCB. Pgam5 released from damaged mitochondria induces mitochondrial biogenesis via Wnt signaling. 2018;217:1383–94. [DOI] [PMC free article] [PubMed]
19.Liu Z, Li W, Wang Z, Yang Q, Chen L, Chen W, Qu X. EIF4A3-Induced CircDHTKD1 regulates glycolysis in non-small cell lung cancer via stabilizing PFKL. J Cell Mol Med. 2024;28:e18465. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Chu Y, Ge D, Zhou J, Liu Y, Zheng X, Liu W, Ke L, Lu Y, Chu Y. Controlling glycolysis to generate characteristic volatile organic compounds of lung cancer cells. Sci Rep. 2024;14:16561. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Wang Z, Bian Z, Wang D, Xu J. Functions and mechanisms of A-to-I RNA editing in filamentous ascomycetes. PLoS Pathog. 2024;20:e1012238. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Feng C, Xin K, Du Y, Zou J, Xing X, Xiu Q, Zhang Y, Zhang R, Huang W, Wang Q, Jiang C, Wang X, Kang Z, Xu J, Liu H. Unveiling the A-to-I mRNA editing machinery and its regulation and evolution in fungi. Nat Commun. 2024;15:3934. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Yang L, Yi L, Yang J, Zhang R, Xie Z, Wang H. Temporal landscape and translational regulation of A-to-I RNA editing in mouse retina development. BMC Biol. 2024;22:106. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Mao J, Li J, Lu X, Zhong H, Zhao Y, Zhu L, Fu H, Ding G, Teng F, Chen M, Guo W. Dichotomous roles of ADAR1 in liver hepatocellular carcinoma and kidney renal cell carcinoma: Unraveling the complex tumor microenvironment and prognostic significance. Int Immunopharmacol. 2024;136:112340. [DOI] [PubMed] [Google Scholar]
25.C X C, D S C, Q W FL, K C C, K NJR. A third member of the RNA-specific adenosine deaminase gene family, ADAR3, contains both single- and double-stranded RNA binding domains. RNA. 2000;6:755–67. [DOI] [PMC free article] [PubMed]
26.Meng How T, Qin L, Raghuvaran S, Robert P, Jennefer K, Amy NY, Kaiwen Ivy L, Rui Z, Gokul R, Kentaro A, Ankita G, Liam PK, Cyril XG, Avinash R, Ni H, Elizabeth AP, Dena SL, Alessandra R, Sharon YP, Ajay G, Giannino C, Gary DS, Anne P, Donald B, Charles FC, Mary ES, Carl AOC, Kazuko RW, Jin N, Billy LJN. Dynamic landscape and regulation of RNA editing in mammals. Nature. 2017;550:249–54. [DOI] [PMC free article] [PubMed]
27.Rivera M, Zhang H, Pham J, Isquith J, Zhou Q, Balaian L, Sasik R, Enlund S, Mark A, Ma W, Holm F, Fisch K, Kuo D, Jamieson C, Jiang Q. Malignant A-to-I RNA editing by ADAR1 drives T cell acute lymphoblastic leukemia relapse via attenuating dsRNA sensing. Cell Rep. 2024;43:113704. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Wong T, Loh J, Lu S, Yan H, Siu H, Xi R, Chan D, Kam M, Zhou L, Tong M, Copland J, Chen L, Yun J, Leung S, Ma S. ADAR1-mediated RNA editing of SCD1 drives drug resistance and self-renewal in gastric cancer. Nat Commun. 2023;14:2861. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Jiao Y, Yang H, Qian J, Gong Y, Liu H, Wu S, Cao L, Tang L. miR–3664–5P suppresses the proliferation and metastasis of gastric cancer by attenuating the NF–κB signaling pathway through targeting MTDH. Int J Oncol. 2019;54:845–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Ghanbarian M, Afgar A, Yadegarazari R, Najafi R, Teimoori-Toolabi L. Through oxaliplatin resistance induction in colorectal cancer cells, increasing ABCB1 level accompanies decreasing level of miR-302c-5p, miR-3664-5p and miR-129-5p. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2018;108:1070–80. [DOI] [PubMed]
31.Xu S, Zhou G, He Q, Ding J, Liu X, Cheng Y, Shen Y. A-to-I-edited miR-1251-5p restrains tumor growth and metastasis in lung adenocarcinoma through regulating TCF7-mediated Wnt signaling pathway. Discover Oncol. 2024;15:587. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Voss G, Cassidy J, Ceder Y. Functional consequences of A-to-I editing of miR-379 in prostate cancer cells. Sci Rep. 2023;13:16602. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Thorsten N, Min-Chun C, Nils W, Sinem U, Rupert O, Svenja L, Michael D, Tobias M, Martin J, Katja S, Werner S, Henrik E, Roland MS. Metabolic Reprogramming Is an Initial Step in Pancreatic Carcinogenesis That Can Be Targeted to Inhibit Acinar-to-Ductal Metaplasia. Cancer Res. 2024;84:2297–312. [DOI] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1.^{(24.5MB, pptx)}

Data Availability Statement

Data available on request from the authors.

[CR1] 1.Sierra P, Harjot A, Anne Claudine B, Armen P. Role of AURKB Inhibition in Reducing Proliferation and Enhancing Effects of Radiotherapy in Triple-Negative Breast Cancer. Breast Cancer (Dove Med Press). 2024;16:341–6. [DOI] [PMC free article] [PubMed]

[CR2] 2.Leyang W, Liyuan Q, Shuhui Z, Jiahui Q, Zengzheng D, Ying S, Xiaoyao C, Lin L, Chenyang L, Xinyue Q, Xingpeng Y, Zichun H. Dual-Engineered Macrophage-Microbe Encapsulation for Metastasis Immunotherapy. Adv Mater. 2024;36:e2406140. [DOI] [PubMed]

[CR3] 3.Kai-Ming Z, De-Chang Z, Ze-Yu L, Yan W, Jian-Nan L, Tian D, Ling Z, Yu-Hong C, Qi-Chao Y, Qing-Shan C, Rui-Zhao C, Zi-Xuan Z, Jia-Lu S, Bing-Xin H, Hai-Liang Z, Gong-Kan F, Xiao-Feng Z, Jun T, Rong D. Inactivated cGAS-STING Signaling Facilitates Endocrine Resistance by Forming a Positive Feedback Loop with AKT Kinase in ER+HER2- Breast Cancer. Adv Sci (Weinh). 2024;11:e2403592. [DOI] [PMC free article] [PubMed]

[CR4] 4.Yan L, Jiahui C, Jia T, Yu H, Xinxing M, Yehui Z, Liangzhu F. Engineered CAR-NK cells with tolerance to H2O2 and hypoxia can suppress postoperative relapse of triple-negative breast cancers. Cancer Immunol Res. 2024;12:1574–88. [DOI] [PubMed]

[CR5] 5.Lin J, Junning P, Nan S, Hongying C, Zhenyu L, Wenhui Z, Qingyuan Z, Liru L. Effect of PR status on the prognosis of advanced ER-high HER2-negative breast cancer patients receiving CDK4/6 inhibitor combined with endocrine as first-line therapy. BMC Cancer. 2024;24:850. [DOI] [PMC free article] [PubMed]

[CR6] 6.Lizhao W, Jianpeng L, Nan M, Heyan C, Ligang N, Jianjun H, Ru W. Identifying subtypes and developing prognostic models based on N6-methyladenosine and immune microenvironment related genes in breast cancer. Sci Rep. 2024;14:16586. [DOI] [PMC free article] [PubMed]

[CR7] 7.Philipp R, Carolin F, Nicolai W, Charlotte PW, Sabrina K, John FY, Daniel TH, Jenna F, Michelle E, Nils W, Maximilian F, Laura SP, Annika ES, Yvonne F, Erez YL, Gail M, Thorsten S. Precise in vivo RNA base editing with a wobble-enhanced circular CLUSTER guide RNA. Nat Biotechnol. 2024;43:545–57. [DOI] [PMC free article] [PubMed]

[CR8] 8.Wan-Bing T, Jun X, Bi-Feng Y. Site-specific quantification of Adenosine-to-Inosine RNA editing by Endonuclease-Mediated qPCR. Bioorg Med Chem. 2024;110:117837. [DOI] [PubMed]

[CR9] 9.Miguel RLS, Brian HK, Ariela BG, Gauri G, Andy Y, Pardis A, Lora EL, Eric V, John FF, Pengfei D, Eric P, Sarah Z, Deepak AK, Ryan CT, Donjing L, You Jeong P, Esther C, Kimia Z, Emily M, Brian F, Lillian W, Hannah S, Lisa ML, Brendan S, Vanessa C, Prashant K, Claudia F, Jessica SJ, Marysia-Kolbe R, Joseph S, Girish NN, Minghui W, Bin Z, Pamela S, Noam DB, Eric ES, Panos R, Alexander WC. Michael S B. Divergent landscapes of A-to-I editing in postmortem and living human brain. Nat Commun. 2024;15:5366. [DOI] [PMC free article] [PubMed]

[CR10] 10.Houhong W, Xiaoyu W, Lu L, Junfeng Z, Heng L. Suppression of A-to-I RNA-editing enzyme ADAR1 sensitizes hepatocellular carcinoma cells to oxidative stress through regulating Keap1/Nrf2 pathway. Exp Hematol Oncol. 2024;13:30. [DOI] [PMC free article] [PubMed]

[CR11] 11.Weimin L, Hao W, Jinxia L, Zhuo W, Miao C, Xiaoli L, Ganqiang L. Transcriptomic analysis reveals associations of blood-based A-to-I editing with Parkinson’s disease. J Neurol. 2023;271:976–85. [DOI] [PubMed]

[CR12] 12.Gjendine V, James RC, Yvonne C. Functional consequences of A-to-I editing of miR-379 in prostate cancer cells. Sci Rep. 2023;13:16602. [DOI] [PMC free article] [PubMed]

[CR13] 13.Marzieh G, Ali A, Reza Y, Rezvan N, Ladan T-T. Through oxaliplatin resistance induction in colorectal cancer cells, increasing ABCB1 level accompanies decreasing level of miR-302c-5p, miR-3664-5p and miR-129-5p. Biomed Pharmacother. 2018;108:1070–80. [DOI] [PubMed]

[CR14] 14.Yuwen J, Haojun Y, Jun Q, Yu G, Hanyang L, Siyuan W, Liang C, Liming T. miR–3664–5P suppresses the proliferation and metastasis of gastric cancer by attenuating the NF–κB signaling pathway through targeting MTDH. Int J Oncol. 2019;54:845–58. [DOI] [PMC free article] [PubMed]

[CR15] 15.Xiaobo C, Yali Z, Le Z, Jiayi L, Yunfei B, Yanru C, Boqian W, Shu Z, Xin L. Role of LONP2 in head and neck squamous cell carcinoma. Gene. 2022;851:147033. [DOI] [PubMed]

[CR16] 16.Wanrong W, Fulin L, Kejia W, Yurou C, Hanshu W, Guo D, Wei Z. Lon Peptidase 2, Peroxisomal (LONP2) Contributes to Cervical Carcinogenesis via Oxidative Stress. Med Sci Monit. 2018;24:1310–20. [DOI] [PMC free article] [PubMed]

[CR17] 17.Laura CDP, Rachel R, Kelvin JAD. The peroxisomal Lon protease LonP2 in aging and disease: functions and comparisons with mitochondrial Lon protease LonP1. Biol Rev Camb Philos Soc. 2016;92:739–53. [DOI] [PMC free article] [PubMed]

[CR18] 18.Dominic BB, Kowcee J, Martina B, Karl XK, Marc G, Alexandra S, Jürgen BJJCB. Pgam5 released from damaged mitochondria induces mitochondrial biogenesis via Wnt signaling. 2018;217:1383–94. [DOI] [PMC free article] [PubMed]

[CR19] 19.Liu Z, Li W, Wang Z, Yang Q, Chen L, Chen W, Qu X. EIF4A3-Induced CircDHTKD1 regulates glycolysis in non-small cell lung cancer via stabilizing PFKL. J Cell Mol Med. 2024;28:e18465. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR20] 20.Chu Y, Ge D, Zhou J, Liu Y, Zheng X, Liu W, Ke L, Lu Y, Chu Y. Controlling glycolysis to generate characteristic volatile organic compounds of lung cancer cells. Sci Rep. 2024;14:16561. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR21] 21.Wang Z, Bian Z, Wang D, Xu J. Functions and mechanisms of A-to-I RNA editing in filamentous ascomycetes. PLoS Pathog. 2024;20:e1012238. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR22] 22.Feng C, Xin K, Du Y, Zou J, Xing X, Xiu Q, Zhang Y, Zhang R, Huang W, Wang Q, Jiang C, Wang X, Kang Z, Xu J, Liu H. Unveiling the A-to-I mRNA editing machinery and its regulation and evolution in fungi. Nat Commun. 2024;15:3934. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR23] 23.Yang L, Yi L, Yang J, Zhang R, Xie Z, Wang H. Temporal landscape and translational regulation of A-to-I RNA editing in mouse retina development. BMC Biol. 2024;22:106. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR24] 24.Mao J, Li J, Lu X, Zhong H, Zhao Y, Zhu L, Fu H, Ding G, Teng F, Chen M, Guo W. Dichotomous roles of ADAR1 in liver hepatocellular carcinoma and kidney renal cell carcinoma: Unraveling the complex tumor microenvironment and prognostic significance. Int Immunopharmacol. 2024;136:112340. [DOI] [PubMed] [Google Scholar]

[CR25] 25.C X C, D S C, Q W FL, K C C, K NJR. A third member of the RNA-specific adenosine deaminase gene family, ADAR3, contains both single- and double-stranded RNA binding domains. RNA. 2000;6:755–67. [DOI] [PMC free article] [PubMed]

[CR26] 26.Meng How T, Qin L, Raghuvaran S, Robert P, Jennefer K, Amy NY, Kaiwen Ivy L, Rui Z, Gokul R, Kentaro A, Ankita G, Liam PK, Cyril XG, Avinash R, Ni H, Elizabeth AP, Dena SL, Alessandra R, Sharon YP, Ajay G, Giannino C, Gary DS, Anne P, Donald B, Charles FC, Mary ES, Carl AOC, Kazuko RW, Jin N, Billy LJN. Dynamic landscape and regulation of RNA editing in mammals. Nature. 2017;550:249–54. [DOI] [PMC free article] [PubMed]

[CR27] 27.Rivera M, Zhang H, Pham J, Isquith J, Zhou Q, Balaian L, Sasik R, Enlund S, Mark A, Ma W, Holm F, Fisch K, Kuo D, Jamieson C, Jiang Q. Malignant A-to-I RNA editing by ADAR1 drives T cell acute lymphoblastic leukemia relapse via attenuating dsRNA sensing. Cell Rep. 2024;43:113704. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR28] 28.Wong T, Loh J, Lu S, Yan H, Siu H, Xi R, Chan D, Kam M, Zhou L, Tong M, Copland J, Chen L, Yun J, Leung S, Ma S. ADAR1-mediated RNA editing of SCD1 drives drug resistance and self-renewal in gastric cancer. Nat Commun. 2023;14:2861. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR29] 29.Jiao Y, Yang H, Qian J, Gong Y, Liu H, Wu S, Cao L, Tang L. miR–3664–5P suppresses the proliferation and metastasis of gastric cancer by attenuating the NF–κB signaling pathway through targeting MTDH. Int J Oncol. 2019;54:845–58. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR30] 30.Ghanbarian M, Afgar A, Yadegarazari R, Najafi R, Teimoori-Toolabi L. Through oxaliplatin resistance induction in colorectal cancer cells, increasing ABCB1 level accompanies decreasing level of miR-302c-5p, miR-3664-5p and miR-129-5p. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2018;108:1070–80. [DOI] [PubMed]

[CR31] 31.Xu S, Zhou G, He Q, Ding J, Liu X, Cheng Y, Shen Y. A-to-I-edited miR-1251-5p restrains tumor growth and metastasis in lung adenocarcinoma through regulating TCF7-mediated Wnt signaling pathway. Discover Oncol. 2024;15:587. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR32] 32.Voss G, Cassidy J, Ceder Y. Functional consequences of A-to-I editing of miR-379 in prostate cancer cells. Sci Rep. 2023;13:16602. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR33] 33.Thorsten N, Min-Chun C, Nils W, Sinem U, Rupert O, Svenja L, Michael D, Tobias M, Martin J, Katja S, Werner S, Henrik E, Roland MS. Metabolic Reprogramming Is an Initial Step in Pancreatic Carcinogenesis That Can Be Targeted to Inhibit Acinar-to-Ductal Metaplasia. Cancer Res. 2024;84:2297–312. [DOI] [PubMed]

PERMALINK

A-to-I RNA Editing Endows miR-3664-5p with Carcinogenicity in Breast Cancer Through Modulating LONP2 Mediated Glycolysis

Yajing Han

Xueli Wei

Xuesen Zhang

Jianjun Wu

Fan Wang

Abstract

Supplementary Information

Introduction

Materials and Methods

Clinical samples

Cell Culture and Transfection

ADAR Perturbation Experiment and Sanger Sequencing

RT-qPCR

Colony Formation Assay

MTT Assay

Transwell Assay

Wound-Healing Assay

Target Gene Prediction

Dual-Luciferase Reporter Assay

ChIP Assay

Glucose Uptake and Lactate Production Measurement

Oxygen Consumption Rate (OCR) and Extra Cellular Acidification Rate (ECAR) Measurement

Western Blot Assay

Xenograft Assay

Statistical Analysis

Results

High Editing Level of miR-3664-5p is Identified in Breast Cancer Patients

Fig. 1.

Table 1.

ADAR1 is the Key Enzyme Regulating miR-3664-5p Editing in Breast Cancer

Fig. 2.

A-to-I RNA Editing Endows miR-3664-5p with Carcinogenicity in Breast Cancer

Fig. 3.

Edited miR-3664-5p Gains the Binding Site of LONP2

Fig. 4.

Edited miR-3664-5p Affects Glycolysis in Breast Cancer Through the Regulation of LONP2

Fig. 5.

A-to-I RNA Editing Endows miR-3664-5p with Carcinogenicity in vivo by Affecting LONP2 Mediated Glycolysis

Fig. 6.

Discussion

Conclusion

Supplementary Information

Acknowledgements

Authors’ contributions

Funding

Data Availability

Declarations

Ethics Approval and Consent to Participate

Consent for Publication

Competing interests

Footnotes

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases