Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2026 Aug 3;16:23767. doi: 10.1038/s41598-026-62378-6

The potential therapeutic effect of quercetin on mitochondrial dysfunction in hepatorenal toxicity induced by aluminum chloride in an experimental rat model

Tasneem N Hafez 1, Magda A Megahed 1, Bothaina F Mahmoud 1, Mohammed Salama 2, Nesma A Ghazal 1,✉
PMCID: PMC13429650  PMID: 42543445

Abstract

Aluminum is a xenobiotic element known to induce hepatorenal toxicity through mechanisms involving mitochondrial dysfunction, oxidative stress, and inflammation. Quercetin, a dietary flavonoid with potent antioxidant and anti-inflammatory properties, has shown promise as a therapeutic agent. This study aimed to evaluate the potential therapeutic effects of quercetin against aluminum chloride (AlCl₃)-induced hepatorenal toxicity and mitochondrial dysfunction in rats. Hepatorenal toxicity was induced by oral administration of hydrated aluminum chloride (75 mg/kg body weight) daily for six weeks. Quercetin was administered intraperitoneally at a dose of 30 mg/kg body weight daily for four weeks. Biochemical assays, mitochondrial gene expression analysis, and histopathological examinations were conducted to assess the therapeutic effects. Quercetin significantly ameliorated lipid, protein, and DNA oxidation parameters (MDA, AOPPs and 8-OHdG respectively), reduced inflammation marker (TNF-α), and restored mitochondrial biogenesis markers, including PGC-1α, mtTFA and mitochondrial DNA copy number (mtDNA-CN). In addition, Quercetin significantly decreased TNF-α and increased PGC-1α contents at protein levels. Histopathological findings corroborated these results, demonstrating that quercetin improved liver and kidney architecture. These findings suggest that quercetin may serve as a potential therapeutic agent for aluminum-induced hepatorenal toxicity.

Keyword: Hepatorenal toxicity, Aluminum chloride, Quercetin, Mitochondrial biogenesis, mtDNA-CN

Subject terms: Biochemistry, Diseases, Drug discovery, Medical research, Molecular biology, Physiology

Introduction

Aluminum chloride (AlCl₃) exposure poses a significant environmental and occupational health risk due to its toxic effects on vital organs, particularly the liver and kidneys. The mechanisms underlying AlCl₃-induced toxicity include oxidative stress, mitochondrial dysfunction, and impaired antioxidant defenses1.

In the liver, AlCl₃ exposure disrupts mitochondrial energy metabolism, elevates serum liver enzymes, and induces histopathological changes such as necrosis and fibrosis. Similarly, in the kidneys, AlCl₃ causes tubular necrosis, fibrosis, and epithelial hyperplasia, further exacerbating organ dysfunction2.

The master regulator of mitochondrial biogenesis, peroxisome proliferator activator receptor gamma-coactivator 1α (PGC-1α), controls the expression of mtTFA which facilitate the transcription, replication of mitochondrial DNA (mtDNA) and mitochondrial biogenesis3.

Mitochondrial dysfunction is central to the pathogenesis of hepatorenal toxicity, as mitochondria are critical for energy production and cellular homeostasi4. Disruption of mitochondrial biogenesis contributes to decreased ATP production and increased reactive oxygen species (ROS), leading to cellular damage5. Following oxidative stress exposure, Nrf2 is phosphorylated and Keap1 becomes inactive. When phosphorylateyod Nrf2 (p-Nrf2) accumulates in the nucleus, it binds with the antioxidant-response element (ARE) and activates a variety of genes, including those that produce transport molecules, detoxifying enzymes, and antioxidants6. Extensive evidence highlights a reciprocal regulatory feedback loop between PGC-1α and Nrf2, wherein Nrf2 directly drives mitochondrial biogenesis and cross-talks with PGC-1α to promote lifespan extension7.

Quercetin, a naturally occurring flavonoid, has garnered attention for its antioxidant and anti-inflammatory properties. It neutralizes free radicals, reduces oxidative stress, and modulates biological pathways involved in inflammation and mitochondrial function. Recent studies have highlighted its protective effects against renal inflammation, ferroptosis, and apoptosis8.

Given the pivotal role of mitochondrial dysfunction in AlCl₃ induced toxicity, this study investigates the therapeutic potential of quercetin in mitigating mitochondrial damage and hepatorenal toxicity in an experimental rat model.

Materials and methods

Experimental animals

A total number of 32 two months Wistar male albino rats, (100-150g) were used. The animals were obtained from the animal house of Medical Research Institute, Alexandria University, Egypt. Rats were housed in standard cages in well-ventilated rooms (25 ± 2 °C), with a relative humidity of (43 ± 3), with free access to water and food and 12 hours’ light/dark cycle before experimentation.

Ethical statement

All experiments pursued the standards of the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 8023, revised 1978) and were performed after the approval of the Institutional Animal Care and Use Committee (IACUC)-Alexandria University, Egypt (Approval No.: AU01223101512). The study also followed ARRIVE guidelines and complied with the National Research Council’s Guide for the Care and Use of Laboratory Animals.

Induction of hepatorenal toxicity

Hepatorenal toxicity was induced in rats using hydrated aluminum chloride (AlCl3.6H2O) solution that was given orally at a dose of 75 mg/kg body weight daily for 6 consecutive weeks9

Treatment with quercetin

Quercetin obtained from Sigma Aldrich was administrated intraperitoneally to rats as a powder dissolved in water at a dose of 30 mg/kg body weight daily for 4 weeks10.

Experimental designas

The animals were given standard food and water ad-libitum. Rats were classified into four groups each group contains 8 rats: Group I (Control group), normal healthy male rats. Group II (Quercetin control group), rats were received a daily intraperitoneal injection of quercetin (30 mg/kg body weight, dissolved in 0.25% v/v DMSO) for 4 weeks10. Group III (Untreated AlCl3 group), rats were administered aluminum chloride (AlCl3.6H2O) solution (75 mg/kg body weight /day)9 orally for 6 consecutive weeks followed by daily intraperitoneal injections of the DMSO vehicle alone for 4 weeks. Group IV (Quercetin-treated AlCl3 group), rats were administered AlCl3.6H2O solution (75 mg/kg body weight/day) orally for 6 consecutive weeks then treated interperitoneally wih quercetin (30 mg/kg body weight, dissolved in 0.25% v/v DMSO) daily for 4 weeks.

Collection of samples

After 24 hours from the last administration, rats in all groups were sacrificed under deep anesthesia via isofluoran inhalation. The blood samples were collected from dorsal vein into serum gel separator tubes from each rat. The samples were left f or 20 min at 4◦C, centrifuged at 3000 xg for 10 minutes using Hettich Zentrifugen Tuttlingen centrifuge to obtain serum. Sera were stored at −80◦C until used for assessment liver function tests (ALT, AST, ALP, total bilirubin), kidney function tests (urea, creatinine), lipid profile parameters (total cholesterol, triglycerides, HDL-C, LDL-C), and advanced oxidation protein products (AOPPs).

The excised liver and kidney tissues were rinsed with saline and then divided into two halves. The first half was divided into two parts. First part of excised tissue was homogenized in phosphate buffer saline (PBS) pH 7.4 in the ratio of 1:10 (0.125 gm of tissue in 1.25 ml PBS). The homogenate was used for the determination of malondialdehyde (MDA) while the second aliquot was centrifuged at 10000 rpm, at 4°C for 20 minutes and the obtained supernatants were used for the determination of 8-hydroxy guanidine (8-OHdG), Peroxisome proliferator activator receptor gamma-coactivator 1α (PGC-1 α) and tumor necrosis factor alpha (TNFα) by ELISA. Second part of excised tissue was used for the extraction of total RNA for Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) analysis for assessment of gene expression of PGC-1 α, mitochondrial transcription factor A (mtTFA), nuclear factor-erythroid 2-related factor 2 (Nrf2) and TNF-α and extraction of DNA for determination of mtDNA-CN. Second half of liver and kidney tissues was fixed in 10 % buffered formalin for histological examination.

Histopathological examination

Following necropsy, liver and kidney specimens were immediately fixed in phosphate-buffered formalin (10%, pH 7.4) for at least 24 hours which were then processed using conventional paraffin embedding technique11 Sections of 5 μm thick were sliced, mounted on slides deparaffinated in xylene and rehydrated using decreasing concentrations of ethanol. Slides were stained with hematoxylin and eosin (H&E) for routine histopathological setting. Stained sections were blindly evaluated using light microscope (Leica, DM500) and photographed at a magnification of ×400 using a digital camera (EC3, Leica, Germany). The histopathological staging (or scoring) was done as a semi-quantitative assessment. This scoring is based on a standard 0 to 3 scale , evaluating the percentage of tissue damage or alteration observed across multiple microscopic fields (usually graded as: 0 = Normal, 1 = Mild [<25%], 2 = Moderate [25–50%], 3 = Severe [>50%]). For Liver Tissue Staging Parameters, the scoring for liver slides evaluates the degree of tissue injury based on two main criteria: Hepatocyte vacuolation and degeneration. For Kidney Tissue Staging Parameters, the renal scoring evaluates the deformity, shrinkage, or congestion of the glomeruli and the widening/loss of Bowman’s space.

Serum parameters measurements

The blood samples were obtained and assayed for liver function parameters according to the manufacturer’s instructions using serum ALT Bio-Med Diagnostic INC (USA) kit (ALT Cat. No.: 1200)12, serum AST Bio-Med Diagnostic INC (USA) kit (AST Cat. No.: 1202)12, serum ALP Bio-Med Diagnostic INC (USA) kit (ALP Cat. No.: 101090)13, and serum total bilirubin spectrum Diagnostic (Germany) kit (Cat. No.: 222 001)14.

Also, kidney function parameters were assayed according to the manufacturer’s instructions using serum urea Bio-Med Diagnostic INC (USA) kit (Cat. No.: IFUFCC40)15, and serum creatinine Bio-Med Diagnostic INC (USA) kit (Cat. No.: IFUFCC09)16.

In addition, lipid profile was investigated by using cholesterol Agappe Diagnostic LTD (India) kit17, serum triglycerides Agappe Diagnostic LTD (India) kit13 and serum HDL-C level Agappe Diagnostic LTD (India) kit18. Serum LDL–C was calculated19.

Determination of AOPPs levels according to the manufacturer’s instructions using AOPPs ELISA kit (Cat. No.: CSBEQ027429RA)20.

Determination of malondialdehyde (MDA) content

Malondialdehyde was determined according to the method of21. The tissue samples were heated with thiobarbituric acid (TBA) at low pH. The resulting pink chromogen has a maximal absorbance at 532 nm.

Protein content determination of 8-OHdG, PGC1α, and TNF-α by ELISA.

The content of rat 8-OHdG, PGC1α, and TNF-α in the samples were measured by ELISA kit (Cat. No.: CSB-E10526r)22, (Cat. No.: MBS1600735)23, and (Cat. No.: CSB-E11987r)24. respectively.

Determination of total protein contents

A modification method of Lowry et al.25 was used for the determination of protein in the samples.

Gene expression analysis

Thirty mg of kidney tissues were used for total RNA extraction using Gene Direx Kit (USA) (Cat. No.: NA021-0100) according to the manufacturer’s instructions. The concentration and integrity of extracted RNA were checked using nanodrop. The reverse transcription of the extracted RNA was performed by Viva cDNA Synthesis Kit (vivantis) according to the manufacturer instructions. The tissues expression of PGC-1α, mtTFA, Nrf2, and TNF-α were quantified in the cDNA by CFX Maestro™ Software (Bio-Rad, USA) using Rotor-Gene SYBR Green PCR Kit (Qiagen®, Germany). The housekeeping gene 18S rRNA was used as a reference gene for normalization. The primers used for the determination of rat genes are presented in Table 1. The relative change in mRNA expression in samples was calculated using the 2-ΔΔCt method26.

Table 1.

Primer sets of PGC-1α, mtTFA, Nrf2, TNF-α, and 18S rRNA.

Gene Accession number primer sequence

18S rRNA

(reference gene)

NR_046237.2 F: 5'-GTAACCCGTTGAACCCCATT-3'
R: 5'-CAAGCTTATGACCCGCACTT-3'
PGC-1α NM_031347.1 F: 5'- GTGCAGCCAAGACTCTGTATGG -3'
R: 5'- GTCCAGGTCATTCACATCAAGTTC -3'
mtTFA NM_031326.2 F: 5'-CCCACAGAGAACAGAAACAG-3'
R: 5'-CCCTGGAAGCTTTCAGATACG-3'
Nrf2 NM_017008.4 F: 5'-CGAGATATACGCAGCAGGAGAGGTAAG-3'
R: 5'-GCTCGACAATGTTCTCCAGCTT-3'
TNF-α NM_012675.3 F: 5-TGGGCTCCCTCTCATCAGTTC- 3
R: 5-TCCGCTTGGTGGTTTGCTAC- 3

Mitochondrial DNA copy number determination

A qRT-PCR assay was developed to estimate relative mtDNA copy number (mtDNA-CN) by comparing PCR amplicons of mitochondrial DNA to a single nuclear gene. Following genomic DNA isolation, specific primer pairs for mtDNA and nuclear PGC-1α were used in equal PCR cycles to calculate the mtDNA signal relative to nuclear DNA. The mtDNA content is expressed as the ratio Ct (mtDNA)/Ct (nDNA), where lower Ct values indicate higher template concentration. This ratio demonstrates that increasing Ct values correlate with a decrease in mtDNA per cell, ultimately representing mtDNA-CN as log R, where R=2 –ΔCt and ΔCt= Ct mtDNA – Ct nDNA27 Table 2.

Table 2.

Primers for nuclear PGC-1α and mtDNA for qRT-PCR.

Gene Name Accession number Primer sequence
Nuclear PGC-1α NM_031347.1 F 5'-ATGAATGCAGCGGTCTTAGC-3'
R 5'-AACAATGGCAGGGTTTGTTC-3'
mtDNA X14848.1 F 5'-ACACCAAAAGGACGAACCTG-3'
R 5'- ATGGGGAAGAAGCCCTAGAA-3'

Statistical analysis

Data were analyzed using SPSS software package version 18.0 (SPSS Chicago, IL, USA). The data were expressed as means ± SD and analyzed using a one- way analysis of variance (ANOVA) and followed by post hoc Tukey test to compare the mean values between and within treated groups compared to untreated and control groups. Differences were considered statistically significant at p value < 0.05. Correlation studies were performed using Pearson’s correlation coefficient28.

Results

Liver function tests

The AlCl3 exposure significantly increased serum ALT, AST, ALP activities and total bilirubin levels compared to controls (p ≤ 0.05). Treatment with quercetin significantly reduced these parameters, though not to control levels (p ≤ 0.05). The quercetin control group exhibited lower ALP and total bilirubin levels compared to the untreated AlCl3 group, indicating quercetin’s protective role in liver function (Table 3).

Table 3.

Statistical analysis of serum liver function tests in the different studied groups.

Groups Control Quercetin control Untreated AlCl3 group Quercetin-treated AlCl3 group
Serum ALT (U/L) 34.0 ± 2.51 36.37 ± 1.06 65.50ab ± 2.51 49.25abc ± 1.28
Serum AST (U/L) 122.5 ± 1.77 124.5 ± 1.93 188.0ab ± 3.34 160.0abc ± 2.73
Serum ALP (U/L) 82.0 ± 4.0 76.50a ± 2.07 99.75ab ± 3.24 74.0ac ± 2.67

Total bilirubin

(mg/dl)

0.41 ± 0.02 0.37a ± 0.03 0.62ab ± 0.02 0.44abc ± 0.02

n= 8 replicas in each groupData was expressed using Mean ± SD.

By using One way ANOVA test, pairwise comparison between each 2 groups were done using Post Hoc Test (Tukey)

p: p value for comparing between the studied groups

*: Statistically significant at p ≤ 0.05

a: Significant with Control

b: Significant with Quercetin control

c: Significant with AlCl3 (untreated).

Kidney function tests

As shown in (Table 4), AlCl3 exposure significantly raised urea and creatinine levels (p ≤ 0.05). Quercetin treatment reduced these levels significantly compared to untreated AlCl3-exposed rats, though levels remained elevated compared to the control group (p ≤ 0.05). Quercetin alone showed no adverse effects on kidney function.

Table 4.

Statistical analysis of serum kidney function tests in the different studied groups.

Groups Control Quercetin control Untreated AlCl3 Quercetin-treated AlCl3 group
Urea (mg/dl) 26.0 ± 1.07 28.0 ± 1.60 44.25ab ± 2.25 31.50abc ± 0.93
Creatinine (mg/dl) 0.39 ± 0.02 0.34a ± 0.01 0.69ab ± 0.03 0.52abc ± 0.04

n= 8 replicas in each groupData was expressed using Mean ± SD.

By using One way ANOVA test, pairwise comparison bet. each 2 groups were done using Post Hoc Test (Tukey)

p: p value for comparing between the studied groups

*: Statistically significant at p ≤ 0.05

a: Significant with Control

b: Significant with Quercetin control

c: Significant with AlCl3 (untreated).

Lipid profile parameters

As seen in (Table 5), Total cholesterol, triglycerides, and LDL-C levels were significantly elevated in AlCl3-exposed rats, while HDL-C levels were significantly decreased (p ≤ 0.05). Quercetin treatment significantly reduced cholesterol, triglycerides, and LDL-C levels while improving HDL-C levels, restoring parameters closer to control values (p ≤ 0.05).

Table 5.

Statistical analysis of lipid profile parameters in the different studied groups.

Groups Control Quercetin control Untreated AlCl3 Quercetin-treated AlCl3 group
Total cholesterol (mg/dl) 71.50 ± 1.31 73.0 ± 1.07 97.25ab ± 3.15 69.0bc ± 2.07
Triglycerides (mg/dl) 87.0 ± 2.73 87.0 ± 5.81 108.6ab ± 3.85 95.0c ± 9.34
HDL- cholesterol (mg/dl) 42.37 ± 1.06 43.0 ± 1.07 26.50ab ± 1.51 38.75abc ± 2.38
LDL- cholesterol (mg/dl) 11.85 ± 0.89 12.60 ± 1.15 50.0ab ± 3.99 15.25c ± 2.86

n= 8 replicas in each groupData was expressed using Mean ± SD.

By using One way ANOVA test, pairwise comparison bet. each 2 groups were done using Post Hoc Test (Tukey)

p: p value for comparing between the studied groups

*: Statistically significant at p ≤ 0.05

a: Significant with Control

b: Significant with Quercetin control

c: Significant with AlCl3 (untreated).

Serum advanced oxidation protein products (AOPPs)

As seen in (Table 6), The AlCl3 exposed group exhibited a significantly higher AOPPs level as compared to control groups (p ≤ 0.05). Quercetin treatment significantly reduced AOPPs though it remained higher than the control group (p ≤ 0.05).

Table 6.

Statistical analysis of serum AOPPs levels (nmol/ml) in the different studied groups.

Groups Control Quercetin control Untreated AlCl3 Quercetin-treated AlCl3 group
AOPPs (nmol/ml) 110.0 ± 6.19 103.5a ± 4.81 224.8ab ± 4.40 142.8abc ± 2.82

n= 8 replicas in each groupData was expressed using Mean ± SD.

By using One way ANOVA test, pairwise comparison bet. each 2 groups were done using Post Hoc Test (Tukey)

p: p value for comparing between the studied groups

*: Statistically significant at p ≤ 0.05

a: Significant with Control

b: Significant with Quercetin control

c: Significant with AlCl3 (untreated).

Hepatic and renal Malondialdehyde (MDA)

As seen in (Table 7), The AlCl3 exposed group exhibited a significantly higher MDA level as compared to control groups (p ≤ 0.05). Quercetin treatment significantly reduced MDA though it remained higher than the control group (p ≤ 0.05).

Table 7.

Statistical analysis of MDA contents (nmol/mg protein) in the different studied groups.

Groups Control Quercetin control Untreated AlCl3 Quercetin-treated AlCl3 group
MDA (nmol/mg protein) Liver 21.25 ± 3.15 14.25a ± 2.55 59.0ab ± 3.59 34.0abc ± 4.21
Kidney 2.65 ± 0.40 2.33 ± 0.28 4.28ab ± 0.40 3.18abc ± 0.25

n= 8 replicas in each groupData was expressed using Mean ± SD.

By using One way ANOVA test, pairwise comparison bet. each 2 groups were done using Post Hoc Test (Tukey)

p: p value for comparing between the studied groups

*: Statistically significant at p ≤ 0.05

a: Significant with Control

b: Significant with Quercetin control

c: Significant with AlCl3 (untreated).

Hepatic and renal 8-hydroxy guanosine (8-OHdG) in rats

As seen in (Table 8), The AlCl3 exposed group exhibited a significantly higher 8-OHdG level as compared to control groups (p ≤ 0.05). Quercetin treatment significantly reduced 8-OHdG though it remained higher than the control group (p ≤ 0.05).

Table 8.

Statistical analysis of hepatic and renal 8-OHdG contents (ng/mg protein) in the different studied groups.

Groups Control Quercetin control Untreated AlCl3 Quercetin-treated AlCl3 group
8-OHdG (ng/mg protein) Liver 90.0 ± 4.66 82.75a ± 3.65 160.5ab ± 3.74 127.5abc ± 3.16
Kidney 119.3 ± 4.71 118.0 ± 3.21 180.3ab ± 4.62 132.3abc ± 3.0

n= 8 replicas in each groupData was expressed using Mean ± SD.

By using One way ANOVA test, pairwise comparison bet. each 2 groups were done using Post Hoc Test (Tukey)

p: p value for comparing between the studied groups

*: Statistically significant at p ≤ 0.05

a: Significant with Control

b: Significant with Quercetin control

c: Significant with AlCl3 (untreated).

Hepatic and renal peroxisome proliferator activator receptor gamma-coactivator 1α (PGC-1α) contents in rats

As shown in (Table 9), the AlCl3 exposed group exhibited a significantly hepatic and renal lower PGC-1α contents as compared to control and quercetin control groups (p ≤ 0.05). Quercetin control rats showed a statistically significant hepatic reduction but renal elevation in PGC-1α contents as compared to control rats (p ≤ 0.05). AlCl3 exposed group treated with quercetin showed a statistically significant hepatic elevation in PGC-1α contents as compared to untreated AlCl3 exposed rats but statistically significant decline in hepatic PGC-1α as compared to control and quercetin control groups (p ≤ 0.05). In case of renal tissue, there was statistically significant elevation in PGC-1α contents in quercetin treated AlCl3 group as compared to untreated AlCl3 group (p ≤ 0.05), but not significant difference compared to control and quercetin control groups.

Table 9.

Statistical analysis of hepatic and renal PGC-1α content (ng/mg protein) in the different studied groups.

Groups Control Quercetin control Untreated AlCl3 Quercetin-treated AlCl3 group
PGC-1α (ng/mg protein) Liver 8.70 ± 0.72 7.23a ± 0.30 3.80ab ± 0.36 5.78abc ± 0.25
Kidney 10.57 ± 0.89 12.03a ± 1.07 5.72ab ± 0.64 11.13c ± 0.18

n= 8 replicas in each groupData was expressed using Mean ± SD.

By using One way ANOVA test, pairwise comparison bet. each 2 groups were done using Post Hoc Test (Tukey)

p: p value for comparing between the studied groups

*: Statistically significant at p ≤ 0.05

a: Significant with Control

b: Significant with Quercetin control

c: Significant with AlCl3 (untreated).

Hepatic and renal tumor necrosis factor alpha (TNF-α) contents in rats

As shown in (Table 10), the AlCl3 exposed group exhibited a significantly hepatic and renal higher TNF-α contents as compared to control and quercetin control groups (p ≤ 0.05). AlCl3 exposed group treated with quercetin showed a statistically significant hepatic and renal reduction in TNF-α contents as compared to untreated AlCl3 exposed rats but statistically significant increased compared with control and quercetin control group (p ≤ 0.05).

Table 10.

Statistical analysis of hepatic and renal TNF-α contents (pg/mg protein) in the different studied groups.

Groups Control Quercetin control Untreated AlCl3 Quercetin-treated AlCl3 group
TNF-α (pg/mg protein) Liver 22.75 ± 2.12 18.75 ± 3.33 68.0ab ± 4.0 35.75abc ± 2.87
Kidney 13.25 ± 1.49 15.0 ± 1.60 29.0ab ± 2.73 17.88abc ± 1.81

n= 8 replicas in each groupData was expressed using Mean ± SD.

By using One way ANOVA test, pairwise comparison bet. each 2 groups were done using Post Hoc Test (Tukey)

p: p value for comparing between the studied groups

*: Statistically significant at p ≤ 0.05

a: Significant with Control

b: Significant with Quercetin control

c: Significant with AlCl3 (untreated).

Hepatic and renal expression of PGC-1α, mtTFA, Nrf2, and TNF-α

As shown in (Figs. 1,2,3,4,5,6,7,8), AlCl3 exposure led to significant downregulation of genes related to mitochondrial function, such as PGC-1α, mtTFA, and Nrf2, while upregulating TNF-α expression (p ≤ 0.05). Quercetin treatment significantly restored the expression of these genes toward control levels (p ≤ 0.05), indicating its role in mitigating mitochondrial dysfunction and inflammation.

Fig. 1.

Fig. 1

Hepatic PGC-1 α content (ng/mg protein) in the different studied groups.

Fig. 2.

Fig. 2

Renal PGC-1 α content (ng/mg protein) in the different studied groups.

Fig. 3.

Fig. 3

Hepatic mtTFA gene expression (Fold change) in the different studied groups.

Fig. 4.

Fig. 4

Renal mtTFA gene expression (Fold change) in the different studied groups.

Fig. 5.

Fig. 5

Hepatic Nrf2 gene expression (Fold change) in the different studied groups.

Fig. 6.

Fig. 6

Renal Nrf2 gene expression (Fold change) in the different studied groups.

Fig. 7.

Fig. 7

Hepatic TNF-α gene expression (Fold change) in the different studied groups.

Fig. 8.

Fig. 8

Renal TNF-α gene expression (Fold change) in the different studied groups.

As shown in (Figs. 9,10), Mitochondrial DNA copy number (mtDNA-CN) was significantly reduced in AlCl3-exposed rats (p ≤ 0.05), but treatment with quercetin significantly increased mtDNA-CN levels (p ≤ 0.05).

Fig. 9.

Fig. 9

Hepatic mtDNA-CN in the different studied groups.

Fig. 10.

Fig. 10

Renal mtDNA-CN in the different studied groups.

Correlation studies

Correlation between different parameters in hepatic tissues in quercetin-treated AlCl3 group

  • Tumer necrosis factor-α (TNF-α) gene expression was positively correlated with Nrf2 gene expression (r= 0.886, p<0.003) (Fig. 11A), mtDNA-CN levels (r= 0.834, p<0.010) (Fig. 11B), PGC-1α gene expression (r= 0.887, p<0.003) (Fig. 11C) and mtTFA gene expression (r= 0.890, p<0.003) (Fig. 11D)

  • Peroxisome proliferator activator receptor gamma-coactivator 1α (PGC-1α) gene expression was positively correlated with mtDNA-CN expression (r= 0.859, p<0.006) (Fig. 11E) and mtTFA gene expression (r= 0.723, p<0.043) (Fig. 11F)

Fig. 11.

Fig. 11

Hepatic correlation studies.

Correlation between different parameters in renal tissues in quercetin-treated AlCl3 group

  • Tumer necrosis factor-α (TNF-α) gene expression was positively correlated with PGC-1α gene expression (r= 0.934, p<0.001) (Fig. 12A) and Nrf2 gene expression (r= 0.849, p<0.008) (Fig. 12B)

  • Peroxisome proliferator activator receptor gamma-coactivator 1α (PGC-1α) gene expression was positively correlated with renal Nrf2 gene expression (r= 0.904, p<0.002) (Fig. 12C)

Fig. 12.

Fig. 12

Renal correlation studies.

Histopathological analysis

Group I (Control group)

In liver tissue: Examination of sections obtained from liver of the control group showed normal histological structure. It was made up of traditional hepatic lobules with roughly hexagonal cells in shape with prominent nucleus and nucleolus observed, the nuclear cytoplasmic ratio was normal. Also, portal regions with connective tissue stroma appeared normal in structure. Moreover, normal visible central veins that are enlarged in some samples are observed (Fig. 13A). In kidney tissue: Examination of sections obtained from kidney of the control group showed a thin connective tissue capsule with underlying renal cortex which contains a glomerulus and surrounding tubules with cuboidal epithelium. The majority of the cells in the proximal and distal convoluted tubules were of normal morphology (Fig. 14A).

Fig. 13.

Fig. 13

A: Microphotographs of liver tissue sections (H&E staining 400X, Bar 50μm). (A) control group showing normal histological structure of the liver with enlarged central vein (CV) and traditional hepatic lobules (B) Quercetin control group showing a well preserved hepatic architecture and dilatation of sinusoids observed ( ) (C) AlCl3 group (untreated) showing severe damage of hepatic architecture with observed cytoplasmic Inline graphic vacuolation ( Inline graphic ) and formation of fibrous septa infiltrated with inflammatory cells (Circle) (D) AlCl3 group (treated) showing restoration of the normal histological structure of the liver with observed congestion of portal vein (PV) and dilatation of sinusoids ( Inline graphic). B: Histological score of hepatocyte vacuolation and degeneration. AlCl3​ exposure significantly increased liver damage compared to the control, while Quercetin co-treatment (AlCl3​ + Quercetin) markedly reduced the histological score, showing its hepatoprotective effect.

Fig. 14.

Fig. 14

Microphotographs of kidney tissue sections (H&E staining 400X, Bar 50μm). (A) control group showing normal histological structure of the kidney with normal glomerulus size(GL) and intact bowman capsule space (Inline graphic ) (B) Quercetin control group showing preserved histological structure of the kidney with normal GL size and intact bowman space ( Inline graphic) (C) AlCl3 group (untreated) showing severe damage of kidney histological architecture with observed atrophied Glomerulus (star) with increased bowman capsule space (Inline graphic) and dilatation of the tubules (Inline graphic) (D) AlCl3 group (treated) showing restoration of the normal histological structure of the kidney with normal GL size and intact bowman space (Inline graphic) with observed dilatation of kidney tubules (Inline graphic). B: Histological score of glomerular distortion and congestion in kidney. AlCl3​ exposure significantly increased kidney damage compared to the control, while Quercetin co-treatment (AlCl3​ + Quercetin) markedly reduced the histological score, showing its renal protective effect.

Group II (Quercetin control group)

In liver tissue: Examination of sections obtained from liver of the quercetin control group did not show any sign of liver damage. The hepatic cells appeared normal with well-preserved cytoplasm. Hepatocytes were arranged in anatomizing cords, radiating outward from the center of each classic hepatic lobule (Fig. 13B). In kidney tissue: Examination of sections obtained from kidney of the quercetin control group showed normal histological structure. Of note, no prominent lesions in renal tubules are observed (Fig. 14B).

Group III (Untreated AlCl3)

In liver tissue: examination of sections obtained from liver of untreated AlCl3 group showed loss of hepatic architecture with prominent multinodular area of coagulative necrosis. Also, vacuolated cytoplasm with pyknotic nuclei and karyolitic cells observed. Moreover, significant haemorrhage with inflammatory cell infiltration in the portal and central vein area was also observed. What is perhaps more interesting is the appearance of fibrous septa with a shape of slender connective tissue band containing inflammatory cells indicating that AlCl3 induced fibrosis (Fig. 13C). In kidney tissue: microscopic examination of the kidney tissue of untreated AlCl3 group revealed severe damage and loss of normal kidney structure. There was a significant buildup of inflammatory cells in the interstitial spaces, and the glomeruli were significantly shrunken with obvious increase in Bowman’s capsule space (Fig. 14C).

Group IV (Quercetin-treated AlCl3 group)

In liver tissue: examination of sections obtained from liver of AlCl3 group treated with quercetin showed a marked reduction of morphological alteration and inflammation observed in untreated AlCl3 group. Moreover, a decline in cytoplasmic vacuolation is observed. Of note, no fibrous septa reported in the treated group indicating that quercetin attenuate the effect of AlCl3 in inducing necroinflammatory injury and fibrosis in the liver of treated rats (Fig. 13D). In kidney tissue: microscopic examination of the kidney tissue of AlCl3 group treated with quercetin showed remarkable histological improvement in the glomerular size observed along with a substantial reduction in interstitial infiltration of inflammatory cells. Of note, the tubular dilatation is reduced as well as the normal Bowman’s capsule space is restored (Fig. 14D).

Discussion

Aluminum is a heavily utilized industrial and agricultural metal that is easily absorbed via the gastrointestinal system29. where it disrupts the intestinal barrier, increasing permeability and triggering apoptosis. Upon systemic absorption, AlCl3 acts as a potent hepatorenal toxin30,9.

In the present study, rats treated with AlCl3 solution exhibited a significant increase in serum ALT, ALP, AST activities, as well as urea, creatinine, and total bilirubin levels. Elevated serum ALP, ALT, and AST, alongside total bilirubin, serve as hallmark biomarkers of hepatotoxicity, with elevated bilirubin and ALP specifically indicating hepatobiliary injury and cholestasis31. The high serum activities of ALT and AST point to severe hepatocellular inflammation and injury; AlCl3 accumulation in hepatic tissue induces tissue necrosis, allowing these intracellular enzymes to escape into circulation31be2 Concurrently, elevated serum creatinine and urea reflect compromised renal function32. This aligns with previous reports that AlCl3 exposure damages the glomerulus, renal tubules, and renal cortex, thereby reducing glomerular filtration33,34.

Furthermore, AlCl3 administration disrupted lipid metabolism - a consequence of hepatic disease-induced metabolic alterations - leading to hyperglycemia, hypoproteinemia, hyperlipidemia, hypercholesterolemia, and hypertriglyceridemia35,36. The liver is central to lipid homeostasis, and its impairment here resulted in decreased HDL-C levels alongside increased triglycerides (TG), total cholesterol, and LDL-C37.

The present study suggests that Al exposure disrupts lipid metabolism, leading to increased serum triglycerides and total cholesterol levels in rats. This rise in cholesterol and ahypoactivity37 .

Quercetin treatment effectively reversed these pathologies, restoring liver function, reducing serum ALT, AST, ALP, and total bilirubin38. and decreasing serum urea and creatinine via oxidative stress reduction and the mitigation of renal injury pathways39–41. Quercetin also corrected the lipid profile by scavenging free radicals and normalizing lipid metabolism, significantly decreasing total cholesterol and TGs while increasing HDL-C42.

The underlying mechanism of AlCl3-induced hepatorenal toxicity relies heavily on the generation of reactive oxygen species (ROS) and subsequent oxidative stress, which severely compromises cellular and tissue health2. 43. In this study, AlCl3 exposure disrupted redox balance and induced profound lipid peroxidation, evidenced by a significant increase in malondialdehyde (MDA) content within both hepatic and renal tissues. This results line with previous studies44. This oxidative environment caused extensive macromolecular damage, indicated by significantly elevated serum advanced oxidation protein products (AOPPs)45. and increased hepatic and renal 8-hydroxy-2'-deoxyguanosine (8-OHdG) levels, confirming oxidant-mediated protein and DNA damage that impairs host antioxidant defenses46.

As a powerful natural dietary flavonoid, quercetin demonstrated robust hepatoprotective and nephroprotective effects against this acute organ damage10,47–49 . Quercetin’s unique chemical structure, featuring two benzene rings (specifically an active B ring), allows it to directly react with and scavenge excess ROS50–53. Moreover, it acts as a potent metal ion chelator, forming covalent bonds with Al ions to neutralize their charge, sequestering them within a stable complex, and preventing initial ROS generation51,52,54,55. Consequently, quercetin therapy markedly reduced MDA tissue content56–59, and60. diminished serum AOPPs61 and lowered 8-OHdG levels62,63 , thereby mitigating lipid peroxidation, safeguarding polyunsaturated fatty acids, and protecting cellular DNA

At the molecular level, AlCl3 exposure significantly downregulates the expression of the nuclear factor erythroid 2-related factor 2 (Nrf2) gene in both hepatic and renal tissues, that line with45. As a master transcription factor, Nrf2 preserves cellular homeostasis by encoding detoxification enzymes and activating vital antioxidant genes, including glutathione peroxidase (GPx), superoxide dismutase (SOD), and heme oxygenase-16,64,65. The downregulation of Nrf2 by Al ions may stem from abnormalities in membrane receptors leading to intracellular ion accumulation44, which ultimately cripples the tissue’s antioxidant capacity. Depleted antioxidant defenses and elevated ROS further triggered inflammation, manifested by a significant increase in tissue tumor necrosis factor-alpha (TNF-α)66.

Conversely, quercetin treatment significantly upregulated Nrf2 expression and promoted its nuclear translocation in hepatic and renal tissues67,68 . While TNF-α-induced intracellular ROS caelhn naturally influence Nrf2 activation depending on ROS bioavailability under physiological conditions69. Quercetin acts as a targeted pharmacological activator of the Nrf2 signaling pathway70. By stimulating glutathione synthesis 70 and promoting the expression of antioxidant enzymes like catalase, GPx, and SOD, quercetin neutralizes ROS and re-establishes redox defenses.71,72.

Simultaneously, quercetin exhibited potent anti-inflammatory properties by markedly decreasing TNF-α expression in both liver and kidney tissues, protecting these vital organs from inflammatory damage67,73.

Mitochondrial dysfunction is another critical facet of AlCl3 toxicity. In this study, rats exposed to aluminum showed a marked downregulation of peroxisome proliferator-activated receptor-gamma coactivator 1-alpha (PGC-1α) and mitochondrial transcription factor A (mtTFA), culminating in a significant decrease in mitochondrial DNA copy number (mtDNA-CN)74. PGC-1α is the master regulator of mitochondrial biogenesis; it activates nuclear respiratory factors 1 and 2 (NRF-1/NRF-2) to initiate mtDNA transcription and replication, while simultaneously inhibiting oxidative damage75. By suppressing PGC-1α, AlCl3 aggravated the inflammatory response—causing a sharp increase in TNF-α expression—and severely destabilized the cellular redox balance75.

Our findings demonstrate that quercetin therapy in rats successfully counteracted this mitochondrial decay by upregulating PGC-1α mRNA and protein levels, mtTFA, and mtDNA-CN expression3,76. This can be explained in the light of previous studies which reported that, by reducing ROS, quercetin enhances PGC-1α expression, which activates NRF-1 and NRF-2. These factors prompt the expression of mtTFA, which translocate to the mitochondria, binds to mtDNA, and drives replication, thereby preserving mitochondrial morphology and density3. Furthermore, PGC-1α positively interacts with Nrf2 to regulate downstream antioxidant genes77,78.

Our biochemical and molecular findings are strongly corroborated by the histopathological alterations observed in both organs. In liver tissues, AlCl3-induced coagulative necrosis and inflammatory fibrous septa formation directly account for the leakage of ALT and AST into the serum, a structural damage driven by Nrf2 downregulation and TNF-alpha hyperactivation2,45. Quercetin treatment effectively restored hepatic architecture and eliminated fibrotic bands by upregulating the Nrf2 antioxidant pathway and suppressing inflammation42. Similarly, in renal tissues, the atrophied glomeruli, widened Bowman’s space, and tubular dilatation mirror the elevated serum urea and creatinine, resulting from mitochondrial decay and depressed PGC-1 α /mtTFA Pathways. Notably, Quercetin successfully reversed these renal cellular defects, confirming its role as a metabolic and structural stabilizer against aluminum-induced cytotoxicity10.

In the present study, there is a significant positive correlation of hepatic PGC-1α gene expression with hepatic mtTFA gene expression and hepatic mtDNA-CN. There is also a significant positive correlation of renal PGC-1α gene expression with renal Nrf2. Suggesting that quercetin triggers a highly coordinated, adaptive metabolic response that simultaneously upregulates mitochondrial biogenesis, suppresses inflammation, and neutralizes protein and oxidative damage under the stress of aluminum toxicity.

Conclusion

This study demonstrates that quercetin effectively mitigates aluminum chloride-induced hepatorenal toxicity by reducing oxidative stress, inflammation, and mitochondrial dysfunction. The restoration of mitochondrial biogenesis markers and the improvement in histopathological outcomes highlight quercetin’s potential as a therapeutic agent in rats. These findings provide a strong foundation for future research aimed at developing quercetin-based interventions for aluminum-induced organ toxicity.

Abbreviations

8-OHdG

8-Hydroxy-2'-deoxyguanosine

AOPPs

Advanced oxidation protein products

ALP

Alkaline phosphatase

ALT

Alanine transaminase

AST

Aspartate transaminase

MDA

Malondialdehyde

mtDNA-CN

Mitochondrial DNA copy number

mtTFA

Mitochondrial transcription factor A

Nrf2

Nuclear factor-erythroid 2-related factor 2

PGC-1α

Peroxisome proliferator activator receptor gamma-coactivator 1α

TNF- α

Tumor necrosis factor-α

Author contributions

T.N.: performed practical work, acquisition of data, data analysis and interpretation, and writing the manuscript. M.A.: Proposed research plan, analyzed and interpreted the results, edited and reviewed the manuscript. B.F. : proposed research plan, analyzed and interpreted the results, edited and reviewed the manuscript. M.S. : performed the histopathological examination and writing their comments. N.A. : supervised the practical part, data analysis and interpretation, and writing of the manuscript. All authors read and approved the final manuscript.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

Data will be available by request to the corresponding authors.

Declarations

Competing interests

The authors declare no competing interests.

Ethics

The study was approved by The Institutional Animal Care and Use Committee (IACUC)-Alexandria University, Egypt (Approval No.: AU01223101512).

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.El-Shazly, S. A. et al. Protective effect of magnetic water against AlCl3-induced hepatotoxicity in rats. Sci Rep.14(1), 24999. 10.1038/s41598-024-70391-w (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kadhim, A., Ben Slima, A., Alneamah, G. & Makni, M. Assessment of histopathological alterations and oxidative stress in the liver and kidney of male rats following exposure to aluminum chloride. J. Toxicol.2024(1), 3997463. 10.1155/2024/3997463 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chodari, L. et al. Targeting mitochondrial biogenesis with polyphenol compounds. Oxid. Med. Cell. Longev.2021(1), 4946711. 10.1155/2021/4946711 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Middleton, P. & Vergis, N. Mitochondrial dysfunction and liver disease: role, relevance, and potential for therapeutic modulation. Ther Adv Gastroenterol.14, 17562848211031394. 10.1177/17562848211031394 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang, X., Agborbesong, E. & Li, X. The role of mitochondria in acute kidney injury and chronic kidney disease and its therapeutic potential. Int. J. Mol. Sci.22(20), 11253. 10.3390/ijms222011253 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Olcekci, O. B. & Adiguzel, C. Resveratrol regulates nickel oxide-induced kidney damage by targeting the PERK/ATF-6/IRE1 and Nrf2/HO1 pathways. Naunyn Schmiedebergs Arch. Pharmacol.399(8), 11403–11419. 10.1007/s00210-026-05107-0 (2026). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gureev, A. P., Shaforostova, E. A. & Popov, V. N. Regulation of mitochondrial biogenesis as a way for active longevity: Interaction between the Nrf2 and PGC-1α signaling pathways. Front. Genet.10, 435. 10.3389/fgene.2019.00435 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Soliman, M. M. et al. Gibberellic acid-induced hepatorenal dysfunction and oxidative stress: Mitigation by quercetin through modulation of antioxidant, anti-inflammatory, and antiapoptotic activities. J. Food Biochem.46(2), e14069. 10.1111/jfbc.14069 (2022). [DOI] [PubMed] [Google Scholar]
  • 9.Ali, A. A., Ahmed, H. I. & Abu, K. Modeling stages mimic alzheimer’s disease induced by different doses of aluminum in rats: focus on progression of the disease in response to time. J. Alzheimer’s Parkinsonism Dement.1(1), 2 (2016). [Google Scholar]
  • 10.Al-Sawasany, A. S., Fayed, H. M., Mahmoud, B. F., Elblehi, S. S. & Ghazal, N. A. Evaluation of the neurotherapeutic effect of quercetin on neuronal miR-124 and β-site amyloid precursor protein cleaving enzyme 1 (BACE1) in an experimental Alzheimer’s disease model. J. Biochem. Mol. Toxicol.39(5), e70290. 10.1002/jbt.70290 (2025). [DOI] [PubMed] [Google Scholar]
  • 11.Bancroft, J. D. & Gamble, M. Hematoxylin and eosin staining. In Theory and Practice of Histological Techniques 7th ed (eds Suvarna, S. K. et al.) 179–220 (Churchill Livingstone, 2013). [Google Scholar]
  • 12.Huang, X. J. et al. Aspartate aminotransferase (AST/GOT) and alanine aminotransferase (ALT/GPT) detection techniques. Sensors6(7), 756–782. 10.3390/s6070756 (2006). [Google Scholar]
  • 13.Schlebusch, H., Rick, W., Lang, H. & Knedel, M. Standards in the activities of clinically important enzymes. Dtsch Med. Wochenschr.99(15), 765–766. 10.1055/s-0028-1107840 (1974). [DOI] [PubMed] [Google Scholar]
  • 14.Malloy, H. T. & Evelyn, K. A. The determination of bilirubin with the photoelectric colorimeter. J. Biol. Chem.119(2), 481–490. 10.1016/S0021-9258(18)74392-5 (1937). [Google Scholar]
  • 15.Hansen, B. A. & Vilstrup, H. A method for determination of the capacity of urea synthesis in the rat. Scand. J. Clin. Lab. Invest.45(4), 315–320. 10.3109/00365518509161013 (1985). [DOI] [PubMed] [Google Scholar]
  • 16.Keppler, A. et al. Plasma creatinine determination in mice and rats: an enzymatic method compares favorably with a high-performance liquid chromatography assay. Kidney Int.71(1), 74–78. 10.1038/sj.ki.5001988 (2007). [DOI] [PubMed] [Google Scholar]
  • 17.Allain, C. C., Poon, L. S., Chan, C. S., Richmond, W. & Fu, P. C. Enzymatic determination of total serum cholesterol. Clin. Chem.20(4), 470–475 (1974). [PubMed] [Google Scholar]
  • 18.Williams, P., Robinson, D. & Bailey, A. High-density lipoprotein and coronary risk factors in normal men. Lancet Lond Engl.1(8107), 72–75. 10.1016/s0140-6736(79)90063-1 (1979). [DOI] [PubMed] [Google Scholar]
  • 19.Sacks, D. B. et al. Linee Guida e Raccomandazioni per le Analisi di Laboratorio nella Diagnosi e nella Gestione del Diabete Mellito. Biochim Clin.30(5–6), 499–536 (2006). [Google Scholar]
  • 20.Abdel-Magied, N. & Elkady, A. A. Possible curative role of curcumin and silymarin against nephrotoxicity induced by gamma-rays in rats. Exp. Mol. Pathol.111, 104299. 10.1016/j.yexmp.2019.104299 (2019). [DOI] [PubMed] [Google Scholar]
  • 21.Draper, H. H. & Hadley, M. Malondialdehyde determination as index of lipid peroxidation. Methods Enzymol.186, 421–431. 10.1016/0076-6879(90)86135-i (1990). [DOI] [PubMed] [Google Scholar]
  • 22.Hancı, H. et al. The effect of prenatal exposure to 900-MHz electromagnetic field on the 21-old-day rat testicle. Reprod. Toxicol.42, 203–209. 10.1016/j.reprotox.2013.09.006 (2013). [DOI] [PubMed] [Google Scholar]
  • 23.Mahmoud, S. A. et al. The pre-conception maternal exposure to Sofosbuvir affects the mitochondrial biogenesis in prenatal fetal tissues: experimental study on rats. Mol. Med.29(1), 71. 10.1186/s10020-023-00666-x (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hassan, N. F., Hassan, A. H. & El-Ansary, M. R. Cytokine modulation by etanercept ameliorates metabolic syndrome and its related complications induced in rats administered a high-fat high-fructose diet. Sci. Rep.12(1), 20227. 10.1038/s41598-022-24593-9 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.OliverH, Lowry, NiraJ, Rosebrough, Farr, A. L. & RoseJ, Randall. Protein measurement with the folin phenol reagent. J. Biol. Chem.193(1), 265–275. 10.1016/S0021-9258(19)52451-6 (1951). [PubMed] [Google Scholar]
  • 26.Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods25(4), 402–408. 10.1006/meth.2001.1262 (2001). [DOI] [PubMed] [Google Scholar]
  • 27.Alsenousy, A. H. A. et al. The anti-obesity potential of superparamagnetic iron oxide nanoparticles against high-fat diet-induced obesity in rats: Possible involvement of mitochondrial biogenesis in the adipose tissues. Pharmaceutics14(10), 2134. 10.3390/pharmaceutics14102134 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Puri, B. K. SPSS in Practice: An Illustrated Guide 2. ed. (Arnold, 2002). [Google Scholar]
  • 29.Hassan, S. A. & Kadry, M. O. Neurodegenerative and hepatorenal disorders induced via aluminum chloride in murine system: impact of β-Secretase, MAPK, and KIM. Biol. Trace Elem. Res.199(1), 227–236. 10.1007/s12011-020-02132-9 (2021). [DOI] [PubMed] [Google Scholar]
  • 30.Hao, W., Hao, C., Wu, C., Xu, Y. & Jin, C. Aluminum induced intestinal dysfunction via mechanical, immune, chemical and biological barriers. Chemosphere288, 132556. 10.1016/j.chemosphere.2021.132556 (2022). [DOI] [PubMed] [Google Scholar]
  • 31.Thakur, S., Kumar, V., Das, R., Sharma, V. & Mehta, D. K. Biomarkers of hepatic toxicity: an overview. Curr. Ther. Res.100, 100737. 10.1016/j.curtheres.2024.100737 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Gounden V, Bhatt H, Jialal I. Renal function tests. In: StatPearls [Internet]. StatPearls Publishing Accessed April 21, 2026. https://www.ncbi.nlm.nih.gov/sites/books/NBK507821/ (2026). [PubMed]
  • 33.Irnidayanti, Y., Fatona, D. & Rizkawati, V. Histological changes in liver and kidney of male mice by age after exposure to aluminum chloride. Toxicol. Ind. Health39(8), 441–450. 10.1177/07482337231180955 (2023). [DOI] [PubMed] [Google Scholar]
  • 34.Jackson JS, Rout P. Aluminum Toxicity. In: StatPearls. StatPearls Publishing Accessed April 21, 2026. http://www.ncbi.nlm.nih.gov/books/NBK609094/ (2026). [PubMed]
  • 35.Belaïd-Nouira, Y., Bakhta, H., Haouas, Z., Flehi-Slim, I. & Cheikh, H. B. Fenugreek seeds reduce aluminum toxicity associated with renal failure in rats. Nutr. Res. Pract.7(6), 466–474. 10.4162/nrp.2013.7.6.466 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Heeren, J. & Scheja, L. Metabolic-associated fatty liver disease and lipoprotein metabolism. Mol. Metab.50, 101238. 10.1016/j.molmet.2021.101238 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ghosh, S., Gaur, A., Sengupta, T., Banerjee, M. & Nayak, P. Effect of aluminium on lipid profile and atherogenic index in prepubertal and young adult female rats: a pilot study. Indian J. Physiol. Pharmacol.67(2), 92–99. 10.25259/IJPP_338_2022 (2023). [Google Scholar]
  • 38.Abdulkareem SM, Nanakali NM. Ameliorating Potential of Quercetin on Liver Function, Genotoxicity and Oxidative Damage Induced by 2,3,7,8- Tetrachlorodibenzo-P-Dioxin in Liver of Male Rats. Pak J Zool. 2020;52(2). 10.17582/journal.pjz/20190708100752
  • 39.Han, S. J. & Lee, H. T. Mechanisms and therapeutic targets of ischemic acute kidney injury. Kidney Res. Clin. Pract.38(4), 427–440. 10.23876/j.krcp.19.062 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Karuppagounder, V. et al. Molecular targets of quercetin with anti-inflammatory properties in atopic dermatitis. Drug Discov. Today21(4), 632–639. 10.1016/j.drudis.2016.02.011 (2016). [DOI] [PubMed] [Google Scholar]
  • 41.Yazdanpanah, Z., Sobhani, H., Navabi, M., Jalali, J. & Ghasemzadeh Rahbardar, M. Quercetin and nephrotoxicity: a narrative review of cellular pathways and therapeutic possibilities. J. Biochem. Mol. Toxicol.40(6), e70927. 10.1002/jbt.70927 (2026). [DOI] [PubMed] [Google Scholar]
  • 42.Jiang, L., Yi, R., Chen, H. & Wu, S. Quercetin alleviates metabolic-associated fatty liver disease by tuning hepatic lipid metabolism, oxidative stress and inflammation. Anim. Biotechnol.36(1), 2442351. 10.1080/10495398.2024.2442351 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Abu-Elfotuh, K. et al. The protective effects of sesamol and/or the probiotic, Lactobacillus rhamnosus, against aluminum chloride-induced neurotoxicity and hepatotoxicity in rats: modulation of Wnt/β-catenin/GSK-3β, JAK-2/STAT-3, PPAR-γ, inflammatory, and apoptotic pathways. Front. Pharmacol.10.3389/fphar.2023.1208252 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Karami, E. et al. The aqueous extract of Artemisia absinthium L. stimulates HO-1/MT-1/Cyp450 signaling pathway via oxidative stress regulation induced by aluminium oxide nanoparticles (α and γ) animal model. BMC Complement. Med. Ther.23(1), 310. 10.1186/s12906-023-04121-6 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Rai, R., Ahmad, Z., Jain, S. K., Jat, D. & Mishra, S. K. Naringenin suppresses aluminum-induced experimental hepato-nephrotoxicity in mice through modulation of oxidative stress and inflammation. Toxicol. Res.40, 97–110. 10.1007/s43188-023-00209-w (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Salem, F. E. H. Syzygium cumini (L) extract ameliorates aluminium chloride-induced acute hepatic and renal toxicity in rats. Egypt Acad. J. Biol. Sci. C Physiol. Mol. Biol.13(2), 73. 10.21608/EAJBSC.2021.196250 (2021). [Google Scholar]
  • 47.Seydi, E., Mehrpouya, L., Sadeghi, H., Rahimi, S. & Pourahmad, J. Luteolin attenuates Fipronil-induced neurotoxicity through reduction of the ROS-mediated oxidative stress in rat brain mitochondria. Pestic. Biochem. Physiol.173, 104785. 10.1016/j.pestbp.2021.104785 (2021). [DOI] [PubMed] [Google Scholar]
  • 48.Kalantari, H. et al. Antioxidant and hepatoprotective effects of Capparis spinosa L. fractions and quercetin on tert-butyl hydroperoxide- induced acute liver damage in mice. J. Tradit. Complement. Med.8(1), 120–127. 10.1016/j.jtcme.2017.04.010 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ghafarifarsani, H., Hoseinifar, S. H., Javahery, S. & Van Doan, H. Effects of dietary vitamin C, thyme essential oil, and quercetin on the immunological and antioxidant status of common carp (Cyprinus carpio). Aquaculture.553, 738053. 10.1016/j.aquaculture.2022.738053 (2022). [Google Scholar]
  • 50.Kawata, K., Yokoo, H., Shimazaki, R. & Okabe, S. Classification of heavy-metal toxicity by human DNA microarray analysis. Environ. Sci. Technol.41, 3769–3774. 10.1021/es062717d (2007). [DOI] [PubMed] [Google Scholar]
  • 51.Lee A. Unlocking quercetin’s therapeutic potential:: the use of innovative drug delivery strategies to remedy neurodegenerative disorders. Master’s thesis. University of Pennsylvania (2023).
  • 52.Tang J, Diao P, Shu X, Li L, Xiong L. Quercetin and Quercitrin Attenuates the Inflammatory Response and Oxidative Stress in LPS-Induced RAW264.7 Cells: In Vitro Assessment and a Theoretical Model. BioMed Res Int. 2019;2019:1-8. 10.1155/2019/7039802 [DOI] [PMC free article] [PubMed]
  • 53.Kaushik, A., Chauhan, K. & Singh, S. Chapter 33 - Neuroprotective potential of quercetin as a nutraceutical targeting fused neuroinflammation in neurological disease. In Treatments, Nutraceuticals, Supplements, and Herbal Medicine in Neurological Disorders (eds Martin, C. R. et al.) 623–637 (Academic Press, 2023). 10.1016/B978-0-323-90052-2.00029-9. [Google Scholar]
  • 54.Al-Zharani, M. et al. Quercetin as a dietary supplementary flavonoid alleviates the oxidative stress induced by lead toxicity in male Wistar rats. Nutrients15(8), 1888. 10.3390/nu15081888 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Yang D, Wang T, Long M, Li P. Quercetin: Its Main Pharmacological Activity and Potential Application in Clinical Medicine. Quiles JL, ed. Oxid Med Cell Longev. 2020:1-13. 10.1155/2020/8825387 (2020). [DOI] [PMC free article] [PubMed]
  • 56.Tsai, C. F. et al. Regulatory effects of quercetin on M1/M2 macrophage polarization and oxidative/antioxidative balance. Nutrients14(1), 67. 10.3390/nu14010067 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Oh, W. Y., Ambigaipalan, P. & Shahidi, F. Preparation of quercetin esters and their antioxidant activity. J. Agric. Food Chem.67(38), 10653–10659. 10.1021/acs.jafc.9b04154 (2019). [DOI] [PubMed] [Google Scholar]
  • 58.Gibellini, L. et al. Quercetin and cancer chemoprevention. Evid. Based Complement. Alternat. Med.2011(1), 591356. 10.1093/ecam/neq053 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Bahar, E., Kim, J. Y. & Yoon, H. Quercetin attenuates manganese-induced neuroinflammation by alleviating oxidative stress through regulation of apoptosis, iNOS/NF-κB and HO-1/Nrf2 pathways. Int. J. Mol. Sci.18(9), 1989. 10.3390/ijms18091989 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Peng, J. et al. Quercetin reprograms immunometabolism of macrophages via the SIRT1/PGC-1α signaling pathway to ameliorate lipopolysaccharide-induced oxidative damage. Int. J. Mol. Sci.24(6), 5542. 10.3390/ijms24065542 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Senyigit, A. et al. Effects of quercetin on lipid and protein damage in the liver of streptozotocin-induced experimental diabetic rats. J. Med. Food22(1), 52–56. 10.1089/jmf.2018.0030 (2019). [DOI] [PubMed] [Google Scholar]
  • 62.Ansar, S., Siddiqi, N. J., Zargar, S., Ganaie, M. A. & Abudawood, M. Hepatoprotective effect of quercetin supplementation against acrylamide-induced DNA damage in wistar rats. BMC Complement. Altern. Med.16(1), 327. 10.1186/s12906-016-1322-7 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Sun, Q. Hsa‐mir‐27a genetic variant contributes to gastric cancer susceptibility through affecting miR‐27a and target gene expression. Cancer Sci.101(10), 2241–2247 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Barančík M, Grešová L, Barteková M, Dovinová I. Nrf2 as a key player of redox regulation in cardiovascular diseases. Physiol Res. Published online S1-S10. 10.33549/physiolres.933403 (2016). [DOI] [PubMed]
  • 65.Lu Y, Wu S, Xiang B, Li L, Lin Y. Curcumin attenuates oxaliplatin-induced liver injury and oxidative stress by activating the Nrf2 pathway. Drug Des Devel Ther. 14(null):73-85. 10.2147/DDDT.S224318 (2024). [DOI] [PMC free article] [PubMed]
  • 66.Khalifa, M., Safar, M. M., Abdelsalam, R. M. & Zaki, H. F. Telmisartan protects against aluminum-induced Alzheimer-like pathological changes in rats. Neurotox. Res.37(2), 275–285. 10.1007/s12640-019-00085-z (2020). [DOI] [PubMed] [Google Scholar]
  • 67.Li, X. et al. The flavonoid quercetin ameliorates liver inflammation and fibrosis by regulating hepatic macrophages activation and polarization in mice. Front. Pharmacol.10.3389/fphar.2018.00072 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Ashari, S. et al. Quercetin ameliorates Di (2-ethylhexyl) phthalate-induced nephrotoxicity by inhibiting NF-κB signaling pathway. Toxicol. Res.11(2), 272–285. 10.1093/toxres/tfac006 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Du, Y. et al. Knockdown of nrf2 exacerbates TNF-α-induced proliferation and invasion of rheumatoid arthritis fibroblast-like synoviocytes through activating JNK pathway. J. Immunol. Res.2020(1), 6670464. 10.1155/2020/6670464 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Namakkal-Soorappan, R. TNF-alpha is not a miscreant: a hero for basal Nrf2-antioxidant signaling. React Oxyg .Species Apex NC.4(11), 298–302. 10.20455/ros.2017.849 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Uzunhisarcikli, M., Apaydin, F. G., Bas, H. & Kalender, Y. The ameliorative effects of quercetin and curcumin against subacute nephrotoxicity of fipronil induced in Wistar rats. Toxicol. Res.12(3), 493. 10.1093/toxres/tfad034 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Tsai, C. F. et al. Regulatory effects of quercetin on M1/M2 macrophage polarization and oxidative/antioxidative balance. Nutrients14(1), 67. 10.3390/nu14010067 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Chen, Y. Q. et al. Protective effect of quercetin on kidney diseases: from chemistry to herbal medicines. Front. Pharmacol.10.3389/fphar.2022.968226 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Yousef, M. I. et al. Aluminum oxide and zinc oxide induced nanotoxicity in rat brain, heart, and lung. Physiol. Res.71(5), 677–694. 10.33549/physiolres.934831 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Rius-Pérez, S., Torres-Cuevas, I., Millán, I., Ortega, Á. L. & Pérez, S. PGC-1α, inflammation, and oxidative stress: an integrative view in metabolism. Oxid. Med. Cell. Longev.10.1155/2020/1452696 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Ventura-Clapier, R. et al. Mitochondria: a central target for sex differences in pathologies. Clin. Sci.131(9), 803–822. 10.1042/cs20160485 (2017). [DOI] [PubMed] [Google Scholar]
  • 77.Li, Y. et al. Songorine promotes cardiac mitochondrial biogenesis via Nrf2 induction during sepsis. Redox Biol.38, 101771. 10.1016/j.redox.2020.101771 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Naidu, S. D., Kostov, R. V. & Dinkova-Kostova, A. T. Transcription factors Hsf1 and Nrf2 engage in crosstalk for cytoprotection. Trends Pharmacol. Sci.36(1), 6–14. 10.1016/j.tips.2014.10.011 (2015). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be available by request to the corresponding authors.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES