Investigating the Antiviral Mechanism of Kaempferol Against Grouper Iridovirus: Combined Evaluation of In Vitro Activity and In Vivo Efficacy

ABSTRACT

Singapore grouper iridovirus (SGIV) is one of the major pathogens that pose significant threats to the aquaculture industry. Kaempferol is a flavonoid compound extracted from Illicium verum Hook.f. (star anise), a material that is both edible and used in traditional medicine. In this study, we evaluated the antiviral effects of kaempferol against SGIV in vitro and in vivo, and elucidated the antiviral mechanism. Our study found that kaempferol could effectively resist SGIV infection in vitro and in vivo. Kaempferol might destroy the SGIV envelope and interfere with the attachment, invasion, and replication stages of SGIV infection. Transcriptomic analysis showed that differentially expressed genes regulated by kaempferol were enriched in ribosome, NF‐κB, and phospholipase D signalling pathways. Further screening of immunity‐related genes and pathway analysis revealed that antiviral immune responses were mainly governed by the JAK–STAT, PI3K‐Akt, and TNF signalling pathways. This study demonstrated that kaempferol exhibited significant antiviral effects against SGIV through multiple mechanisms and had the potential to become an anti‐SGIV fishery drug. These findings provide a theoretical basis for the development of effective drugs for the prevention and treatment of SGIV.

1. Introduction

Groupers (Epinephelus spp.) constitute a crucial mariculture species in China, with farming production reaching 241,500 tons in 2023 (2024 China Fishery Statistical Yearbook), ranking among the top cultivated marine fish species. While advancements in artificial breeding and aquaculture technologies have driven rapid industry expansion, concurrent challenges including germplasm degradation, deteriorating aquatic environments and pathogen proliferation have precipitated frequent infectious disease outbreaks. Among them, iridovirus is one of the most harmful pathogens in the grouper aquaculture industry (Qing et al. 2019). The Singapore grouper iridovirus (SGIV) is an icosahedral, enveloped DNA virus (154–176 nm in diameter) that was first isolated from diseased groupers in Singapore (Liu, Yu, et al. 2020). Formally classified as a novel species within the genus Ranavirus (10th ICTV Report, 2017), SGIV is characterised by rapid cross‐species transmission and extreme lethality. Infected groupers typically manifest clinical signs including anorexia, lethargy, darkened pigmentation, and gill haemorrhaging, culminating in mass mortality within days (Liu, Yu, et al. 2020; Qin et al. 2022). Although vaccination effectively prevents SGIV infection—with Ou‐yang et al. (2012) reporting two vaccine formulations yielding > 90% survival in fry via intraperitoneal injection—practical limitations including stringent storage requirements, demanding viral inactivation protocols, and exclusive pre‐exposure prophylactic efficacy hinder widespread aquaculture application (Lan et al. 2024). Consequently, developing therapeutic aquacultural chemotherapeutics against SGIV is imperative for sustainable industry development.

Chinese herbal medicines (CHMs), recognised as ‘green pharmaceuticals’, yield abundant and eco‐friendly bioactive compounds (Lin et al. 2022). Amid escalating viral disease outbreaks in aquaculture, increasing research focuses on applying CHM‐derived active constituents in aquatic disease management. Notable examples include magnolol from Magnolia officinalis exhibiting anti‐grass carp reovirus (GCRV) activity (Chen et al. 2017). Flavonoid extracts from Toxicodendron verticillium (Stokes) F.A.Barkl. bark demonstrating efficacy against viral hemorrhagic septicemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV) (Kang et al. 2012). Arctigenin from Arctium lappa L. effectively inhibiting micropterus salmoides rhabdovirus (MSRV) infection (Zhang 2019). Regarding SGIV control, multiple CHM constituents have demonstrated antiviral potential: Li et al. (2021) reported Morus alba leaves and their primary active component quercitrin effectively preventing SGIV infection. Wang et al. (2023) confirmed the anti‐SGIV activity of curcumin from turmeric. Jiang et al. (2024) identified berberine‐a bioactive constituent in numerous medicinal plants‐as possessing anti‐SGIV properties. Illicium verum Hook.f. (star anise), a renowned dual‐purpose medicinal and culinary herb, is primarily cultivated in southern and western Guangxi‐China's premier star anise‐producing region, which is acclaimed as the ‘Home of Chinese Star Anise’ This herb possesses a range of bioactive properties, including antimicrobial, antioxidant, antiviral, and immunomodulatory effects. Research has identified several bioactive components in Illicium verum with diverse functions. Salem et al. (2021) demonstrated that its extracts have potent antioxidant and antibacterial activities through integrated in vitro and in vivo studies. Liu, Xiao, et al. (2020) found the constituent quercetin to be effective against SGIV infection. Peng et al. (2016) established its ability to activate adaptive immune responses. Among these, kaempferol is an active constituent derived from Illicium verum , which is characterised by a diphenyl propane skeleton (C6‐C3‐C6) bearing multiple phenolic hydroxyl groups. This compound exhibits pleiotropic pharmacological activities, including but not limited to anticancer, anti‐inflammatory, antioxidant, and immunomodulatory effects (Bangar et al. 2022). Substantial research confirms its antiviral efficacy against both DNA viruses (e.g., hepatitis B virus [HBV], pseudorabies virus [PRV]) and RNA viruses (e.g., dengue virus [DENV], human immunodeficiency virus [HIV]) (Periferakis et al. 2023), its mechanisms of action are also diverse, such as reducing viral DNA in cells, interfering with the cycle of viral action on cells, inhibiting cytokine expression required for viral replication, and inhibiting viral neuraminidase and reverse transcriptase (Park et al. 2022).

To date, investigations on kaempferol have predominantly focused on human and terrestrial animal virology, while its application in aquatic disease control has received scant attention. Thus, this study investigated the mechanism by which kaempferol counteracts SGIV in vitro and in vivo, aiming to uncover novel drug candidates and precise therapeutic targets for SGIV infection.

2. Materials and Methods

2.1. Experimental Materials

The grouper spleen cells (GS) used in this study were previously isolated from healthy hybrid grouper ( Epinephelus. fuscoguttatus♀ × E. lanceolatus♂) and established in our laboratory. SGIV was isolated from hybrid grouper and propagated in GS cells. A stock solution of kaempferol (#k812226‐1g) was purchased from MACKLIN (Shanghai, China), catalogue was prepared in dimethyl sulfoxide (DMSO) at 100 mg/mL and stored at −20°C.

2.2. Determination of the Safe Concentration of Kaempferol for GS Cells

The study included a control group and several experimental groups. The experimental groups were exposed to serially diluted concentrations of kaempferol (1, 0.5, 0.25, 0.125, and 0.0625 mg/mL). After 48 h, cellular morphology was examined using an optical microscope. Subsequently, CCK‐8 solution (Beyotime, Shanghai, China) was added to the cells, and the plates were incubated at room temperature in the dark for 4 h. The absorbance was then measured at 450 nm using a microplate reader (Thermo, Waltham, MA, USA). The safe concentration of kaempferol was determined based on integrated analysis of microscopic observations and viability results.

Cell viability was calculated using the following formula: C (%) = OD₀/OD₁ × 100%, where C represents cell viability, OD₀ denotes the absorbance of the experimental group, and OD₁ indicates the absorbance of the control group.

2.3. Cytotoxicity Analysis of Kaempferol at Safe Concentration in GS Cells

GS cells were seeded in 96‐well plates (Corning, New York, USA) and treated with the predetermined safe concentration of kaempferol (as determined in Section 2.2), with quadruplicate wells per group. After 24, 48, and 72 h of incubation, cellular morphology was observed using optical microscopy. Cell viability was assessed by adding CCK‐8 solution, followed by a 4 h incubation at room temperature in the dark. The absorbance was then measured at 450 nm.

To further verify the non‐cytotoxicity of the chosen kaempferol concentration, cytoskeletal integrity was evaluated by immunofluorescence staining. Briefly, GS cells (1.5 × 10⁶ cells/mL) were plated in 35 mm glass‐bottom dishes (1.8 mL/dish). The control group received 1.8 mL of L15 medium, while the experimental group received 1.8 mL of the safe kaempferol concentration in L15 medium. After 48 h, the supernatants were discarded, and the cells were processed as follows: fixation with 300 μL of 4% paraformaldehyde at 4°C for 1 h, followed by three washes with PBS, then permeabilisation with 300 μL of ice‐cold absolute ethanol at −20°C for 7 min, and subsequently another three washes with PBS. After that, the cells were blocked with 300 μL of PBS containing 2% BSA (Sangon Biotech, Shanghai, China) for 1 h at room temperature. Next, 150 μL of primary antibody (anti‐cytokeratin antibody, Abcam, UK, diluted 1:100 in PBS containing 2% BSA) was added and incubated at room temperature for 1.5 h. Following washing with PBS, the cells were incubated with 150 μL of FITC‐conjugated secondary antibody (Solarbio, Beijing, China, diluted 1:100 in PBS containing 2% BSA) for 1.5 h at room temperature in the dark. Nuclear staining was performed by incubating with 150 μL of Hoechst 33,342 (Beytime, Shanghai, China) in the dark for 30 min. Finally, a final series of three PBS washes was performed, and the samples were preserved in 200 μL of PBS and imaged by confocal laser scanning microscopy (LSCM, Nikon, C2, Japan, Tokyo Metropolis).

2.4. Evaluation of the Anti‐SGIV Activity of Kaempferol at Various Concentrations In Vitro

GS cells at a density of 0.9 × 10⁶ cells/mL were seeded into 12‐well plates at 800 μL per well and cultured at 28°C for 18 h. Following this, mixtures of SGIV with the safe concentration, 1/2 safe concentration, and 1/4 safe concentration of kaempferol were added to the experimental groups. After 48 h of infection, cells were collected for real‐time quantitative polymerase chain reaction (RT‐qPCR) analysis. For parallel assessment, cells were passaged into 24‐well plates and subjected to the same infection procedure. After 48 h, cells were fixed with 4% paraformaldehyde at room temperature for 1 h, followed by staining with 300 μL of 0.1% crystal violet solution for 4 h at room temperature. The dye was then removed, and plates were air‐dried inverted to evaluate cell viability based on staining intensity, with documented photographic records.

Cells in 12‐well plates were allocated to the following treatment regimens: a negative control group (cells were treated with fresh medium only), a positive control group (cells were infected with SGIV alone), an experimental group (cells were incubated with the safe concentration of kaempferol for 2, 4, 6 and 8 h, after which the supernatant was discarded and cells were washed twice with PBS before SGIV infection), and a post‐infection treatment group (cells were initially infected with SGIV for 2 h, followed by supernatant removal, PBS washing, and incubation with the safe concentration of kaempferol). At 48 h post‐infection, the anti‐SGIV effects of kaempferol were analysed via optical microscopy, crystal violet staining, RT‐qPCR and western blot.

2.5. Evaluation of the Anti‐SGIV Effect of Kaempferol In Vivo

Grouper were divided into three groups. Both the negative control group and positive control group received an intraperitoneal injection of 60 μL of L15 medium, while the experimental group was injected with 60 μL of kaempferol solution at a concentration determined as safe at the cellular level. Four hours later, the negative control group was injected with 60 μL of L15 medium, whereas both the positive control group and the experimental group received 60 μL of SGIV stock solution. At 24 and 48 h post‐injection, liver tissue, the primary target organ of SGIV, was collected from three fish per group. RNA was subsequently extracted, and the expression of the SGIV MCP and VP19 genes was detected by RT‐qPCR.

2.6. RNA Extraction and RT‐qPCR Analysis

Total RNA of cells was extracted using an RNA extraction kit following the instructions (CWBIO, Beijing, China). A 200‐ng aliquot of RNA was reverse‐transcribed into cDNA with a commercial reverse‐transcription kit. The resulting cDNA was diluted five‐fold and used as the template for RT‐qPCR. Reactions were prepared following the instructions of the 2× UltraSYBR Mixture kit (Jena, Germany), with β‐actin serving as the reference gene. The mRNA expression levels of the major capsid protein (MCP) and viral protein 19 (VP19) genes of SGIV were determined by RT‐qPCR. All samples were run in quadruplicate.

RT‐qPCR primers are listed in Table 1. Each 20 μL reaction contained 10 μL of 2× UltraSYBR Mixture, 1 μL each of forward and reverse primers, 1 μL of diluted cDNA, and 7 μL of nuclease‐free water. Amplification and detection were carried out on a qTOWER3G IVD system (Jena, Germany) using the following programme: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Every experiment included four technical replicates.

TABLE 1.

Primers sequences used for this study.

Primers	Sequence (5′–3′)
β‐Actin‐F	TACGAGCTGCCTGACGGACA
β‐Actin‐R	GGCTGTGATCTCCTTCTGCA
MCP‐F	GCACGCTTCTCTCACCTTCA
MCP‐R	AACGGCAACGGGAGCACTA
VP19‐F	TCCAAGGGAGAAACTGTAAG
VP19‐R	GGGGTAAGCGTGAAGACT
Egr2b‐F	GTGCATCCAGAGAGCGTGTA
Egr2b‐R	CGGAGTAAGGGGAGAGTTCC
Kmt2d‐F	GAGCCCTGACAGAGAAGGTG
Kmt2d‐R	CATCCGTGTGTGACACTTCC
Tnfaip2b‐F	GGAAGGCTGCTTTGTCAGTC
Tnfaip2b‐R	CTGGCTGTTGGGTTTGTTTT
Creb1b‐F	TTATCCAGTCCCCACAGGTC
Creb1b‐R	CTCCTCAGCCTTTTCCTCCT
Cxcl10‐F	CAAGGACAACAGGACCCTTC
Cxcl10‐R	CCGAGTGGTGACTTTGGATT
IL1‐β‐F	AACCTCATCATCGCCACACA
IL1‐β‐R	AGTTGCCTCACAACCGAACAC
H2a‐F	TGGAAAGACCGCAGTGAAG
H2a‐R	GGGGATGATCCTGGTCTTCT

2.7. Western Blot Analysis

To further analyse the antiviral activity of kaempferol, the protein level of SGIV MCP gene in each group was evaluated by western blot analysis. Cells were seeded into 6‐well plates, and experimental procedures were consistent with those described in Section 2.4. After 48 h infection, medium was discarded, cells were washed once with ice‐cold PBS, then PBS was aspirated, followed by adding 100 μL RIPA lysis buffer (Thermo, USA) to each well; the cells were scraped, transferred to 1.5 mL tubes. After lysing on ice for 30 min, the lysis was mixed with 5× SDS loading buffer and boiled for 10 min at 100°C. Finally, the mixture was centrifuged at 12,000 rpm for 1 min to obtain loading samples. For SDS‐PAGE, 40 μL of each sample was loaded. The stacking gel was run at 70 V for 1 h, and the separating gel at 110 V for 2 h until bromophenol blue reached the bottom. After electrophoresis, PVDF membranes cut to gel size were activated for 15 s in anhydrous methanol, equilibrated in 1× transfer buffer, and assembled into the transfer cassette; then submerged in an ice‐water bath and subjected to electrophoresis at 110 V for 1 h. Membranes were blocked 1 h at room temperature with 5% skim milk in PBST, then added SGIV MCP antibody (Beyotime, Shanghai, China) diluted 1:5000 in PBST containing 1% skim milk, overnight at 4°C, the membranes were washed three times with PBST (each time was 5 min), followed by incubated with HRP‐conjugated secondary antibody (CWBIO, Beijing) diluted 1:5000 in PBST containing 1% skim milk, for 1 h at room temperature in the dark. After washing with PBST for three times, the membranes were imaged using a gel documentation system.

2.8. Research on the Antiviral Mechanism of Kaempferol Against SGIV

2.8.1. Effect of Kaempferol on SGIV Particle Structure

GS cells (0.9 × 10⁶ cells/mL) were seeded into 12‐well plates and incubated at 28°C for 18 h. In parallel, cells from the negative control group (only L15 medium), positive control group (20 μL SGIV+L15 medium), and experimental group (20 μL SGIV+kaempferol) were collectively incubated at 4°C for 2 h. The mixtures of each group were then subjected to high‐speed refrigerated centrifugation at 4°C and 25,000× g for 1 h. After that, the supernatants were carefully aspirated, and the SGIV particles were resuspended in 100 μL of TN Buffer per group. To assess the relative mRNA levels of SGIV‐MCP and SGIV‐VP19, cells were treated with 20 μL of each group suspension for 48 h, collected, and subjected to RNA extraction and RT‐qPCR analysis.

To evaluate the disruptive effect of kaempferol on the viral envelope, we performed a SYBR Green I‐based fluorescence‐permeation assay. Briefly, purified SGIV virions were mixed with an equal volume of kaempferol solution and incubated at 4°C for 2 h. Parallel controls were set up: a background control (virus plus buffer only) and a complete‐lysis control (virus plus 1% Triton X‐100). Immediately after incubation, SYBR Green I dye (diluted from a 10 × DMSO stock) was added to each sample to a final 1 × working concentration. After thorough mixing and 10 min of room‐temperature incubation in the dark, fluorescence intensity was measured by flow cytometry. The envelope‐disruption percentage was calculated as: Envelope disruption (%) = (F _sample – F _{virus control})/(F _{complete lysis} – F _{virus control}) × 100%, where F denotes fluorescence intensity.

2.8.2. Effect of Kaempferol on SGIV Adsorption

GS cells were seeded into 12‐well plates and cultured overnight. Control wells received L‐15 medium alone, while experimental wells were treated with kaempferol + SGIV mixture. Cells were incubated at 4°C for 30 min, then washed twice with fresh L‐15 medium. Cells were harvested 12 h later for RNA extraction and viral gene detection. To further verify kaempferol's effect during the attachment phase, purified SGIV virions were labelled with Cy5 (SGIV‐Cy5). Then the cells in six‐well plates were added SGIV‐Cy5 and SGIV + kaempferol, respectively. After 2 h incubation, the medium was removed, cells were gently washed three times with PBS, and detached with 300 μL PBS. Cell suspensions were analysed immediately by flow cytometry to quantify Cy5 fluorescence. Cells treated without anything were used as a negative control.

2.8.3. Effect of Kaempferol on SGIV Invasion

After adsorption of SGIV (4°C, 30 min) and removal of the inoculum, the cell monolayer was washed twice with L‐15 medium. Cells were subsequently incubated with kaempferol at 28°C for 2 h, followed by washing twice with L‐15 and culturing for an additional 10 h at 28°C. Cells were then harvested for total RNA extraction and viral gene expression analysis. The untreated cells were served as control. Flow cytometry analysis of parallel wells provided additional confirmation, and the negative control was the cells treated with nothing.

2.8.4. Effect of Kaempferol on SGIV Replication

Cells were first infected with SGIV and kept at 4°C for 30 min to allow viral attachment, then shifted to 28°C for 2 h to permit virus entry. After two washes with L‐15 medium, the cells were incubated with kaempferol for 8 h. Following two additional washes, cells were maintained at 28°C for a further 2 h of cultivation. After that, the cells in each group were harvested to extract RNA and detect the expression of viral genes. The cells treated without kaempferol were used as control.

2.9. Library Construction and High‐Throughput Sequencing

High‐quality RNA with good integrity and purity was extracted from each sample; only those that passed quality control (QC) were used for library preparation. Strand‐specific cDNA libraries were generated with the Hieff NGS Ultima Dual‐mode mRNA Library Prep Kit for Illumina (Yeasen Biotechnology) and sequenced on an Illumina NovaSeq 6000 platform.

2.10. Sequence Alignment and Differential Expression Analysis

Clean reads were mapped to the orange‐spotted grouper genome using HISAT2. For samples with biological replicates, differentially expressed genes (DEGs) were identified with DESeq2, for unreplicated samples, edgeR was used. Genes with p < 0.05 and |log2(fold‐change)| > 1 were defined as DEGs, a partial list is provided in Table 2. GO and KEGG enrichment analyses were performed with the Gene Ontology Consortium (http://geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (http://www.kegg.jp/) databases, respectively.

TABLE 2.

Immune‐related DEGs.

Gene_id	Symbol	Log2FoldChange
Tnfaip8l2b	TNF alpha induced protein 8	3.4651
Tnfaip3	TNF alpha induced protein 3	1.7008
Atf2	activating transcription factor 2	−1.5979
Jun	Jun proto‐oncogene, AP‐1 transcription factor subunit	2.0167
Junbb	JunB proto‐oncogene, AP‐1 transcription factor subunit B	−1.7309
Nfkb2	Nuclear factor kappa B subunit 2	−1.1342
Nfkb1	Nuclear factor kappa B subunit 1	−1.1722
Noxred1	NADP dependent oxidoreductase domain containing 1	7.0381
Cpne2	Copine 2	7.3157
Ankrd33ba	Ankyrin repeat domain 33Ba	7.2191
Rag2	Recombination activating gene 2	−6.1902
Lrrc38b	Leucine rich repeat containing 38B	−5.9188
Cdkn1a	Cyclin dependent kinase inhibitor 1A	3.4985
Igv	IgV region	4.9371
Il1‐β	Interleukin‐1 beta	6.162
Creb1b	CAMP responsive element binding protein 1b	−3.7839
Kmt2d	Lysine methyltransferase 2D	−5.8858
Tnfaip2b	TNF alpha induced protein 2B	−5.3301
Egr2b	Early growth response 2b	−6.1633
Cxcl10	C‐X‐C motif chemokine ligand 10	3.7449
H2a	H2A histone	4.6681

Seven DEGs related to antiviral immunity were selected for RT‐qPCR validation. Primers were designed with Primer 3 against reference sequences (Table 1). Using the sample prepared in Section 2.4, RNA was extracted and reverse‐transcribed to obtain cDNA as a template, with β‐actin as the internal reference, relative expression levels were calculated by the 2^−ΔΔCt method.

2.11. Statistical Analysis

All experiments were performed with a minimum of three biological replicates, and the data are presented as mean ± SD. Statistical analyses and figure preparation were conducted using GraphPad Prism 8 and Excel 2019. Differences between groups were evaluated by one‐way ANOVA followed by Student's t‐test in SPSS 16.0, with a significance level set at p < 0.05.

3. Result

3.1. Determination of Kaempferol Safe Working Concentration on GS Cells

Light microscopy observation showed that GS cells treated with the indicated kaempferol dilutions exhibited no cytopathic changes and were indistinguishable from untreated controls (Figure 1A), cell viability detection confirmed that the cell viability in groups exposed to kaempferol ≤ 1 mg/mL did not differ significantly from the control (Figure 1B). Notably, the absorbance of kaempferol at 1 mg/mL was markedly elevated, likely due to intrinsic colour interference from the compound. Among all doses, kaempferol at the concentration of 0.25 mg/mL yielded an absorbance closest to the control and produced cellular morphology most similar to untreated cells. Therefore, 0.25 mg/mL was selected for subsequent cytotoxicity assays of kaempferol.

FIGURE 1.

Effects of different concentrations of kaempferol on GS cell viability and morphology. (A) Representative light micrographs of GS cell morphology after 48 h treatment with various concentrations of kaempferol. (B) Effects of different kaempferol concentrations on GS cell viability after 48 h treatment as determined by CCK‐8 assay. Results demonstrated that kaempferol at concentrations ≤ 1 mg/mL exhibits no cytotoxic effects on GS cells. Data are presented as mean ± SD (n = 3). *, p < 0.05. NS indicates no significant difference.

To assess the cytotoxicity of kaempferol at 0.25 mg/mL, cells were treated with this concentration for 24, 48, and 72 h light‐microscopy showed no cytopathic changes, cell viability remained unaffected (Figure 2). Immunofluorescence further demonstrated that kaempferol at 0.25 mg/mL did not damage the cytoskeleton (Figure 3). Consequently, 0.25 mg/mL was adopted as the safe working concentration for kaempferol in all subsequent experiments.

FIGURE 2.

Evaluation of long‐term cytotoxicity of kaempferol at safe concentration in GS cells. (A) Representative light micrographs of GS cell morphology after treatment with the safe concentration (0.25 mg/mL) of kaempferol for 24–48–72 h. (B) Viability of GS cells treated with the safe concentration of kaempferol for varying durations, as determined by CCK‐8 assay. Data are presented as mean ± standard deviation (n = 3). NS indicates no significant difference.

FIGURE 3.

Effect of the safe concentration of kaempferol on the cytoskeleton of GS cells. Immunofluorescence staining showed that treatment with the safe concentration (0.25 mg/mL) of kaempferol for 48 h did not cause any adverse effects on the GS cell cytoskeleton.

3.2. Evaluation of Kaempferol on SGIV Infection In Vitro

3.2.1. Evaluation of Kaempferol on SGIV Infection in Different Concentrations

After 48 h of treatment with graded kaempferol concentrations (0.25, 0.125, and 0.0625 mg/mL), crystal‐violet staining showed that all kaempferol‐treated wells exhibited deeper purple than the virus‐only wells, the intensity increasing with concentration—indicative of higher viable‐cell counts (Figure 4A). RT‐qPCR revealed that the relative mRNA levels of both SGIV‐MCP and SGIV‐VP19 in the experimental group declined sharply and significantly compared with the positive control group (Figure 4B). Western‐blot analysis confirmed a corresponding marked reduction in MCP protein in kaempferol‐treated cells compared to the positive control group (Figure 4C). Collectively, these data demonstrated that kaempferol suppressed SGIV infection in a concentration‐dependent manner.

FIGURE 4.

Evaluation of the anti‐SGIV effects of kaempferol at different concentrations. (A) Crystal violet staining showing the inhibitory effects of varying concentrations of kaempferol on SGIV‐induced cytopathic effects. (B) RT‐qPCR analysis of the effects of different kaempferol concentrations on the transcription levels of key SGIV genes (MCP, VP19). (C) Western blotting detection of the effects of different kaempferol concentrations on the expression of the SGIV major capsid protein (MCP). Data demonstrated that kaempferol significantly inhibited SGIV infection in a concentration‐dependent manner. Data are presented as mean ± SD (n = 3). **, p < 0.01.

3.2.2. Evaluation of Kaempferol on SGIV Infection Under Different Treatment Modalities

When cells were treated with kaempferol before or after viral challenge, light microscopy revealed markedly fewer cytopathic effects than in the positive control group (Figures 5 and 6A), and crystal‐violet staining was substantially deeper (Figures 5 and 6B). Viral gene and protein expression levels were significantly reduced (Figures 5 and 6C,D), with the most pronounced antiviral effect observed when kaempferol was administered 4 h prior to infection. These findings indicated that kaempferol exerted strong antiviral activity when applied at various time points relative to SGIV exposure, suggesting its potential for both prevention and treatment of SGIV infection.

FIGURE 5.

Preventive effect of kaempferol pretreatment against SGIV infection. (A) Cytopathic effects in SGIV‐infected cells under different treatment schemes were observed by optical microscopy. (B) Cell viability was assessed by crystal violet staining. (C) Transcription levels of SGIV MCP and VP19 genes were analysed by RT‐qPCR. (D) Expression of SGIV MCP protein was detected by western blot. Data demonstrated that kaempferol effectively inhibits SGIV infection under all treatment conditions. Data are presented as mean ± SD (n = 3). **, p < 0.01.

FIGURE 6.

Therapeutic effect of kaempferol post‐infection treatment on SGIV infection. (A) Light microscopy observation showed that kaempferol treatment significantly alleviated SGIV‐induced cytopathic effects. (B) Crystal violet staining further confirmed that kaempferol treatment effectively maintained the integrity of the cell monolayer. (C) RT‐qPCR analysis demonstrated that kaempferol significantly reduced the transcription levels of SGIV MCP and VP19 genes. (D) Western blot detection revealed a marked decrease in SGIV MCP protein expression after kaempferol treatment. All data are presented as mean ± SD (n = 3). **, p < 0.01.

3.3. Evaluation of the Anti‐SGIV Effect of Kaempferol In Vivo

The anti‐SGIV activity of kaempferol was validated in vivo. As shown in Figure 7, the expression levels of SGIV MCP and VP19 genes in liver tissues from the experimental group (injected 4 h before viral infection) were significantly lower than those in the positive control group. These results indicate that kaempferol also exerts an anti‐SGIV effect in vivo.

FIGURE 7.

Evaluation of the concentration‐dependent anti‐SGIV effect of kaempferol in vivo. Grouper were pre‐injected with kaempferol or L15 medium, followed by SGIV challenge 4 h later. SGIV MCP and VP19 genes from the liver tissue in each group were detected by RT‐qPCR at 24 and 48 h post‐infection. All data are presented as mean ± SD (n = 3). **, p < 0.01.

3.4. Mechanism of Action of Kaempferol Against SGIV

3.4.1. Effect of Kaempferol on SGIV Particles

The observation that GS cells exposed to SGIV pre‐incubated with kaempferol for 2 h exhibited markedly fewer cytopathic foci and significantly reduced viral gene expression—compared to cells only infected with SGIV—suggested that kaempferol reduced SGIV infectivity by impairing virion integrity (Figure 8A,B).

FIGURE 8.

Direct effect of kaempferol on SGIV virion structure. (A) Light microscopy images showed significantly reduced cytopathic effects in cells infected with SGIV that had been pre‐incubated with kaempferol, compared to the control group. (B) RT‐qPCR analysis demonstrated that kaempferol treatment significantly reduced the transcriptional level of the SGIV MCP and VP19 genes in host cells. (C) Flow cytometry analysis using a fluorescent dye (SYBR Green) indicated that kaempferol treatment increased viral envelope permeability or disrupted its integrity, as shown by enhanced fluorescence signal. Collectively, these results suggested that kaempferol directly disrupted the structural integrity of SGIV virions, thereby reducing viral infectivity. Data are presented as mean ± SD (n = 3). *, p < 0.05, **, p < 0.01.

To determine if kaempferol's impairment of viral particles involves direct disruption of the SGIV envelope., we performed a SYBR Green I‐based fluorescence assay to detect the extent of viral envelope disruption in each group. As expected, the positive control (SGIV treated with 1% Triton X‐100) yielded the strongest fluorescence, and the positive control group (SGIV without treatment with either 1% Triton X‐100 or kaempferol) produced only a weak background signal; the experimental group (SGIV treated with kaempferol) produced an intermediate signal. Thereby demonstrating that kaempferol disrupted the envelope of SGIV (Figure 8C).

3.4.2. Inhibitory Effect of Kaempferol on SGIV Adsorption on Cell Surface

The relative mRNA levels of SGIV MCP and VP19 (Figure 9A) genes and the Cy5 fluorescence intensity in the experimental group (Figure 9B) were significantly lower than that in the group treated with SGIV only, indicating that kaempferol might block SGIV attachment to host‐cell surface receptors.

FIGURE 9.

Effect of kaempferol on SGIV adsorption during infection. (A) The expression of SGIV MCP and VP19 genes detection by RT‐qPCR. (B) Quantitative analysis of viral adsorption by flow cytometry. The results indicated that kaempferol effectively inhibited the adsorption of SGIV to GS cells. Data are presented as mean ± SD (n = 3). **, p < 0.01.

3.4.3. Inhibitory Effect of Kaempferol on SGIV Invading Into Cells

Compared with the control group, the experimental group exhibited significantly lower SGIV MCP and VP19 expression and a reduction in Cy5 fluorescence intensity (Figure 10A,B), implying that kaempferol could interfere with the SGIV entry stage into host cells.

FIGURE 10.

Effect of kaempferol on SGIV entry into GS cells. (A) The expression of SGIV MCP and VP19 gene detection by RT‐qPCR. (B) Quantitative analysis of viral entry by flow cytometry. These results indicated that kaempferol effectively inhibited the entry of SGIV into GS cells. Data are presented as mean ± SD (n = 3). **, p < 0.01.

3.4.4. Inhibition of Kaempferol on SGIV Replication in Cells

As shown in Figure 11, the transcription levels of SGIV MCP and VP19 in the experimental group were significantly lower than those in the control group treated without kaempferol. These results suggested that kaempferol had the ability to inhibit the replication stage of SGIV infection.

FIGURE 11.

Effect of kaempferol on SGIV replication in GS cells. The expression of SGIV MCP and VP19 genes was detected by RT‐qPCR. After the completion of viral entry, kaempferol treatment significantly inhibited the transcription levels of SGIV MCP and VP19 genes. Data are presented as mean ± SD (n = 3). **, p < 0.01.

3.5. Transcriptome Analysis of Kaempferol‐Treated GS Cells

To further elucidate the antiviral mechanism of kaempferol, we performed transcriptomic profiling and focused on antiviral‐related DEGs. RNA‐seq revealed 5315 DEGs, of which 2432 were up‐regulated and 2883 were down‐regulated (Figure 12). GO enrichment indicated that these DEGs were primarily involved in biological processes such as system development, cellular response to stimulus, and regulation of gene expression; molecular functions including transferase activity transferring phosphorus‐containing groups, sequence‐specific DNA binding and catalytic activity; and cellular components such as the proteasome complex, nuclear protein‐containing complex and plasma membrane (Figure 13). KEGG pathway analysis further highlighted enrichment in ribosome, NF‐κB signalling pathway, intestinal immune network for IgA production, B‐cell receptor signalling pathway and cytosolic DNA‐sensing pathway (Figure 14). Among these, the JAK–STAT, PI3K‐Akt and TNF signalling pathways might be the key antiviral‐immune‐related cascades. Collectively, these results suggested that another mechanism by which kaempferol acted against SGIV was through the modulation of the host immune response.

FIGURE 12.

Volcano plot of differentially expressed genes. Comparison of gene expression profiles between the negative control group and the experimental group. Each point represents a gene: Red indicates significantly upregulated genes (p < 0.05 and log₂ FC > 1), blue denotes significantly downregulated genes (p < 0.05 and log₂ FC < −1), and grey represents non‐significant genes. The x‐axis shows the log₂‐transformed fold change (log₂ FC) in gene expression, while the y‐axis displays the negative logarithm of the p‐value (−log₁₀ p‐value). Results demonstrate that kaempferol treatment induces significant transcriptomic reprogramming in host cells.

FIGURE 13.

GO enrichment analysis of differentially expressed genes (DEGs). Depicts the Gene Ontology (GO) enrichment analysis of differentially expressed genes identified between the negative control group and the experimental group. The results are presented according to the three main ontology domains: Biological Process (BP), Cellular Component (CC), and Molecular Function (MF). The y‐axis shows the significantly enriched GO terms, and the x‐axis represents the enrichment factor or gene count. The size of the dots corresponds to the number of differentially expressed genes, and the colour intensity indicates the significance level of the enrichment analysis (−log₁₀ (adjusted p‐value)).

FIGURE 14.

KEGG pathway enrichment analysis of differentially expressed genes (DEGs). Shows the KEGG pathway enrichment analysis of differentially expressed genes between the negative control group and experimental group. The y‐axis displays the significantly enriched KEGG pathway terms, while the x‐axis represents the enrichment factor. The dot size corresponds to the number of differentially expressed genes mapped to the respective pathway, and the colour intensity reflects the significance level of enrichment (−log₁₀ (adjusted p‐value)). The analysis reveals significant enrichment of DEGs in pathways related to antiviral immune response and cellular metabolic processes.

3.6. RT‐qPCR Was Used to Verify the Expression of DEGs

Key genes enriched in antiviral‐related pathways were selected for RT‐qPCR validation; primer sequences are listed in Table 1. As shown in Figure 15, the changes in the detected genes were consistent with the changes in the transcriptomic genes listed in Table 2, indicating that the transcriptomic data is reliable.

FIGURE 15.

Validation of selected differentially expressed genes by RT‐qPCR. Key differentially expressed genes identified by transcriptome sequencing were validated using RT‐qPCR. The selected genes are involved in relevant functions such as immune response, inflammatory response, and antiviral signalling pathways. Data are presented as mean ± SD (n = 3). *, p < 0.05, **, p < 0.01. The verification results are consistent with the trends observed in the transcriptomic sequencing data, confirming the reliability of the sequencing results.

4. Discussion

The grouper, known for its rapid growth, large size and tender flesh, is highly nutritious and economically valuable, earning the reputation of a delicacy (Huang et al. 2024). However, as the aquaculture of groupers has expanded, viral diseases such as those caused by SGIV have become increasingly prevalent, leading to significant economic losses (Yu et al. 2024). Vaccination can prevent viral infections, but its application in large‐scale farming is limited by stringent storage requirements and dosage uncertainties. Therefore, the development of novel green drugs for the prevention and control of SGIV infections holds great potential. The use of plant‐based remedies has a history spanning thousands of years, with many natural compounds and active ingredients proven to possess potent antiviral properties (Huang et al. 2025). The inhibitory effect of curcumin against SGIV increases in a concentration‐dependent manner and has been validated both in in vitro and in vivo models. (Wang et al. 2023). When GS cells were infected with SGIV 4 h after eugenol treatment, the cytopathic effects, mRNA levels of SGIV‐MCP, SGIV‐VP19 and SGIV‐LITAF, and the SGIV‐MCP protein expression were all markedly reduced (Wang et al. 2024). Berberine pretreatment of GS cells for 2 h also produced an anti‐SGIV effect in a concentration‐dependent manner (Jiang et al. 2024). Kaempferol, a flavanol with extensive pharmacological activities, shows dose‐dependent suppression against african swine fever virus (ASFV), and Arabyan et al. (2021) further identified 0 and 2 h after viral infection as the optimal time points for kaempferol addition. Park et al. (2022) found that kaempferol pretreatment (0–2 h) significantly inhibited varicella‐zoster virus (VZV) gene expression, whereas administration ≥ 6 h post‐infection had no effect. Chen et al. (2021) demonstrated that kaempferol treatment 1 h before or after PRV infection yielded the best outcomes. Studies have also shown that kaempferol effectively suppresses PRV replication and improves survival in a mouse model (Xu et al. 2021), and it also inhibits largemouth bass virus (LMBV) in largemouth bass (Liao et al. 2024). Our findings indicated that kaempferol exhibited concentration‐dependent anti‐SGIV activity in vitro, it remained effective when administered at various time points relative to SGIV infection. Kaempferol also limited virus infection in vivo. These results implied that kaempferol could be used for both prevention and treatment of grouper iridovirus disease.

The structural integrity of the virus is essential for its ability to infect cells. CHMs exert broad‐spectrum antiviral activity through multiple mechanisms. These include blocking clathrin‐mediated endocytosis to prevent influenza virus entry, suppressing viral proteases and integrases to hinder assembly and release (Dimas et al. 2019). A central mechanism is the disruption of virion structural integrity, thereby aborting viral spread within the host. Huang et al. (2025) demonstrated that epicatechin interacts with SGIV particles, blocking viral infection. Similarly, Liu, Xiao, et al. (2020) reported that quercetin damages viral particles to inhibit SGIV infection. Disrupting the viral envelope is another well‐documented antiviral strategy. Liu et al. (2023) reported that an ethanol extract from Artemisia argyi leaves (AEE) blocks herpes simplex virus type 1 (HSV‐1) infection by destroying the integrity of the viral envelope. Likewise, Sun et al. (2025) demonstrated that carnosol, a bioactive constituent of rosemary, exerts anti‐influenza A virus (IAV) activity through envelope disruption, thereby impairing viral entry into host cells. In the present study, co‐incubation of kaempferol with SGIV virions significantly reduced viral infectivity and caused envelope rupture, indicating that kaempferol may exert its antiviral effect by destroying the SGIV envelope. The viral life cycle comprises sequential steps including adsorption, entry, replication, assembly and release, and agents can be antiviral by blocking one or more of these stages. Previous studies have shown that active components of medicinal plants inhibit viral infection at multiple steps. Liu et al. (2008) found that kaempferol suppresses influenza virus by inhibiting neuraminidase synthesis. Hao et al. (2023) showed that kaempferol blocks entry of channel catfish virus (CCV). Huang et al. (2013) reported that kaempferol induces cell‐cycle arrest and suppresses autophagy, thereby hindering viral entry. Here we observed that kaempferol effectively inhibited SGIV by acting on several stages (adsorption, entry and replication). However, whether kaempferol can inhibit SGIV infection in cells by influencing the synthesis of viral kinases or the processes of viral assembly and release is worth further investigation.

When the host is infected by pathogens, pattern recognition receptors of the innate immune system are activated, leading to overexpression of inflammatory factors and triggering chronic inflammation, which ultimately causes damage to the organism (Sullivan et al. 2021; Kumar and Achutha 2020). Interleukins (ILs) and tumour necrosis factor‐α (TNF‐α) are key inflammatory factors secreted by various cell types and possess anti‐inflammatory, pro‐inflammatory, and immunomodulatory functions (Wang et al. 2024). Among them, TNF‐α is one of the earliest cytokines produced in response to viral infection and can directly inhibit the replication of certain viruses. IL‐1β is primarily generated through cleavage by activated NLRP3 inflammasomes and plays a ‘pioneer’ role in antiviral immunity. Accumulating evidence shows that kaempferol can exert antiviral effects by modulating host immune responses. Chen et al. (2021) demonstrated that kaempferol counteracts PRV by regulating the NF‐κB and MAPK pathways, thereby altering the expression of inflammatory cytokines (IL‐1α, IL‐1β, IL‐2). Li et al. (2021) demonstrated in murine studies that PRV infection elevates levels of pro‐inflammatory cytokines, including IL‐1β, IL‐6, TNF‐α, and IFN‐γ. Kaempferol treatment initially increased these cytokine levels above those in the infection control group at 3 days post‐infection (dpi), but subsequently reduced them to nearly baseline levels by 5 dpi. This suggests that kaempferol may potentiate the inflammatory response during the early stage of infection to suppress viral replication, followed by a return to homeostasis to prevent excessive inflammation. Zhang et al. (2017) established an in vivo mouse model and found that kaempferol reduces ROS, MDA, TNF‐α, IL‐1β and IL‐6 levels while increasing superoxide dismutase (SOD) activity; it also suppresses H9N2 influenza virus–induced inflammation via inhibition of the TLR4/MyD88‐mediated NF‐κB and MAPKs pathways. Our current study revealed that kaempferol could modulate the expression of inflammatory cytokines TNF‐α and IL‐1β; we therefore hypothesise that kaempferol exerts its antiviral effects through immunomodulation, though the precise underlying mechanisms require further in‐depth investigation.

High‐throughput transcriptomic analysis can identify candidate genes through DEGs and provide comprehensive insights into host‐virus and host‐drug interactions, thus elucidating the dynamic changes in host immune responses (Sudhagar et al. 2018). Sima (2023) revealed that theaflavin‐3′‐gallate inhibits influenza A virus infection via the TLR4/MAPK/p38 pathway, reducing inflammatory cytokine expression. Shen (2022) showed via transcriptomics that EGCG interferes with viral infection by activating the FoxO pathway, thereby attenuating inflammation and enhancing host immunity. In this study, to clarify how kaempferol modulates the host's immune response against SGIV, we performed RNA‐seq and identified 5315 DEGs. These DEGs were enriched in ribosome, NF‐κB, and phospholipase D signalling pathways. Further screening revealed that antiviral‐related immune pathways were predominantly enriched in the JAK–STAT, PI3K‐Akt and TNF signalling pathways. The JAK–STAT pathway represents a direct signal transduction route from membrane receptors to the nucleus, activated by cytokines. Chasity (2022) demonstrated that targeting insulin signalling through repurposed small‐molecule drugs leads to activation of both RNAi and JAK/STAT antiviral pathways. The PI3K‐Akt pathway serves as a central signalling cascade regulating cell survival, proliferation, metabolism, and motility. Qian et al. (2024) found that tetrandrine (TET) inhibits micropinocytosis by suppressing the PI3K/Akt pathway, thereby effectively restricting ASFV during internalisation. The TNF pathway primarily mediates inflammation, cell survival, and programmed cell death, with TNF‐α being its principal ligand. To our surprise, we found that in addition to modulating the expression of inflammation‐related factors, kaempferol also regulated the expression of cAMP‐responsive element‐binding protein 1b (Creb1b), histone‐lysine N‐methyltransferase 2D (Kmt2d), tumour necrosis factor alpha‐induced protein 2 (Tnfaip2b), early growth response protein 2b (Egr2b), C‐X‐C motif chemokine 10 (Cxcl10), and histone H2A‐like (H2a). Traditionally, Creb is recognised as a crucial transcription factor playing a central role in cellular responses to external stimuli. Furthermore, research by Zheng et al. (2024) demonstrated that during SARS‐CoV‐2 infection, PKA‐phosphorylated Creb1 directly binds to the viral helicase nsp13, thereby inhibiting the function of the viral replication complex and directly restricting viral proliferation. Kmt2d, also known as Mixed‐Lineage Leukaemia 4 (MLL4), encodes a histone methyltransferase that functions as a mediator of cellular signal transduction and thereby modulates signalling pathways (Golden et al. 2023). For example, studies have revealed crosstalk between the Notch pathway and Kmt2d: Oswald (2016) showed in zebrafish that loss of Kmt2d increases expression of the Notch effector Rbpj, resulting in endocardial‐patterning defects, ventricular hypoplasia, and ectopic vascular sprouting. Tumour necrosis factor‐α‐induced protein 2 (Tnfaip2b) is regulated by miR‐145‐5p and promotes cancer‐cell proliferation, migration, and invasion (Li et al. 2020). Egr2b is the zebrafish orthologue of mammalian and a key transcription factor that binds specific DNA sequences to control downstream target‐gene transcription; studies indicate that during viral infection EGR2 modulates pro‐inflammatory cytokine expression and thereby influences antiviral responses (Wei et al. 2025). Cxcl10 is a chemokine whose primary function involves recruiting immune cells expressing the Cxcr3 receptor. Research by Todd et al. (2008) confirmed that Cxcl10 precisely regulates Cxcr3 signalling to coordinate effective innate and adaptive immune responses, which is essential for controlling viral replication and clearing infections. The antiviral role of H2a is primarily manifested through its function as a fundamental component of chromatin structure and the specialised functions of specific variants. Wu (2021) discovered that nuclear histone H2a can shuttle into the cytoplasm, where it acts as a critical ‘brake’ molecule that negatively regulates the innate antiviral immune pathway by facilitating the degradation of key signalling proteins TBK1 and IRF3. Therefore, we hypothesise that kaempferol likely exerts its anti‐SGIV activity by regulating the expression of these antiviral‐related genes. However, the mechanism by which kaempferol interacts with these genes warrants further investigation.

5. Conclusion

In summary, our work demonstrated that kaempferol significantly inhibits SGIV infection in vitro and in vivo, likely through: (1) disruption of the viral envelope structure, (2) interference with the phases of adsorption, entry, and replication in SGIV infection and (3) modulation of the host's immune responses. This work constitutes the first report on the anti‐SGIV activity of kaempferol, laying the groundwork for new approaches to prevent and control the virus.

Author Contributions

Nijia Xue: performed the major of the experiments, analysed data, wrote the manuscript and revised the manuscript. Lin Huang: performed the major of the experiments and revised the manuscript. Jieying Yu: performed the major of the experiments. Jia Cai, Zhengzhao Liu, Yibing Wang and Shu Cheng: analysed data and contributed to experimental suggestions. Junxiang Lai, Ying Pan and Qing Yu: contributed to experimental suggestions. Wenhong Li and Pengfei Li: designed the experiments and provided project funding support.

Funding

This work was supported by grants from the National Natural Science Foundation of China (32373175), Natural Science Foundation of Guangxi (2024GXNSFFA010017, 2022JJA130074), Guangxi Science and Technology Program (GUIKEFA[2024]102‐2), Laibin Science and Technology Program (Laikechan 241519), Guangxi Innovation Team Project of National Modern Agricultural Industrial Technology System (nycytxgxcxtd‐2021‐08‐02), Postgraduate Education Innovation Project of Guangdong Ocean University (202422).

Ethics Statement

Procedures involving fish were performed in accordance with the ARRIVE (Animal Research: Reporting in vivo experiments guidelines for reporting animal research) and approved by the Ethical Committee of the Guangxi Academy of Sciences, Nanning, China (Ethical Protocol Code: No20210101‐F001).

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data supporting this study's findings are available from the corresponding author upon reasonable request.