Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Feb 20;46(9):3257–3266. doi: 10.1002/jat.70121

Effects of Perfluorobutane Sulfonate (PFBS) on Development and Bone Mineralization in Zebrafish Larvae

Feng Qi 1, Jingying Hu 2,✉, Qian Yao 3,4,5, Minjie Xia 2, Fang Tian 2, Mingjun Yang 2, Weihua Li 2,✉
PMCID: PMC13432749  PMID: 41721489

ABSTRACT

Perfluorobutane sulfonate (PFBS), a short‐chain perfluoroalkyl substance (PFAS) and a common substitute for legacy PFAS, has been detected in human cord serum, raising concerns about its potential developmental toxicity. However, its effects on skeletal development remain inadequately characterized. Zebrafish embryos were exposed to environmentally relevant concentrations of PFBS (0.05, 0.2, and 0.8 ng/mL) until 8 days postfertilization (dpf). A dexamethasone (DEX, 10 μg/mL) group served as a positive control for osteotoxicity. Developmental endpoints were monitored, and bone mineralization was assessed via calcein staining. The expression of osteogenesis‐related (alp, runx2, and bmp2b) and osteoclastogenesis‐related (acp5, ctsk, and mmp9) genes was analyzed by qRT‐PCR. PFBS exposure did not significantly affect survival or hatching rates but induced subtle morphological abnormalities, including tail curvature and pericardial edema in a small subset of larvae. A significant, dose‐dependent decrease in heart rate was observed at 72 hpf. Calcein staining revealed that PFBS significantly reduced cranial bone mineralization area and vertebral bone mineral density (BMD) in a concentration‐dependent manner. Gene expression analysis demonstrated that PFBS exposure downregulated key osteogenic markers (alp, runx2, and bmp2b) and upregulated osteoclastogenic markers (acp5, ctsk, and mmp9), suggesting a disruption of the bone remodeling balance. Environmental levels of PFBS can induce cardiotoxicity and disrupt bone mineralization in developing zebrafish larvae. The underlying mechanism may involve the inhibition of osteogenesis and promotion of osteoclastogenesis. These findings highlight the potential skeletal developmental risks associated with PFBS exposure.

Keywords: bone mineralization, developmental toxicity, gene expression, osteotoxicity, perfluorobutane sulfonate (PFBS), zebrafish

Short abstract

Perfluorobutane sulfonate (PFBS), a common perfluoroalkyl substance, was evaluated for developmental toxicity in zebrafish. Exposure to environmental concentrations (0.05–0.8 ng/mL) did not affect survival but induced cardiotoxicity and significantly impaired bone mineralization. Mechanistically, PFBS disrupted bone remodeling by downregulating osteogenic genes and upregulating osteoclastogenic markers. These findings reveal that PFBS poses a potential skeletal developmental risk.

1. Introduction

Per‐ and polyfluoroalkyl substances (PFASs) are synthetic organic compounds widely used in industrial and consumer products. They exhibit high surface activity, hydrophobicity, lipophobicity, and thermal stability (Buck et al. 2011; Prevedouros et al. 2006). Due to their extensive use and environmental persistence, PFASs have been detected worldwide in the environment, wildlife, and humans (Dickman and Aga 2022). A growing body of animal studies and epidemiological evidence indicates that PFAS exposure leads to adverse health effects. With increasingly stringent regulations on PFAS in developed countries, production has shifted to developing nations, including China. By 2006, annual PFAS production in China had reached 200 t, and PFAS‐related industries are now a major source of environmental contamination across the country (Xie 2013).

Previous animal studies have demonstrated the toxicity of common PFAS compounds and their substitutes. For example, perfluorooctanoic acid (PFOA) induces excessive macrophage activation and splenic atrophy in mice (Guo et al. 2021). Hexafluoropropylene oxide trimer acid (HFPO‐TA), a PFOA alternative, caused hepatotoxicity in mice (Xie et al. 2022) and zebrafish, and impairs embryonic liver and biliary system development in the latter (Sun et al. 2023). Perfluorooctane sulfonate (PFOS), another common PFAS, leads to reproductive toxicity in Japanese medaka, altering reproduction‐related genes and peptides and reducing egg production in females (Kang et al. 2019). PFOS also induces significant oxidative stress in the zebrafish liver (Huang, Wang, et al. 2022), disrupts gut microbiota, and upregulates immune‐related gene expression (Huang, Wang, et al. 2022). A study in mice exposed to 6:2 chlorinated polyfluorinated ether sulfonate (6:2 Cl‐PFESA), a PFOS substitute, reported reduced testicular and epididymis weights, though testosterone levels and sperm counts were unaffected (Zhou et al. 2018).

As human toxicological studies of environmental contaminants are not ethically feasible, therefore, human toxicity is inferred from epidemiological, in silico, and in vitro studies. Computational and machine learning approaches have been used to investigate PFAS interactions with human receptors. One study simulated over 5000 PFAS compounds and found that 23 interacted with the human androgen receptor (Tachachartvanich et al. 2022). In vitro cell‐based assays have evaluated PFAS toxicity, particularly through metabolomic profiling. PFAS exposure led to significant changes in metabolite profiles in liver, lung, and intestinal cells (Zhang et al. 2021). In another study, low‐dose PFOA treatment in Leydig cells disrupted fatty acid metabolism and affected proteins involved in testicular steroidogenesis, consistent with findings in rats (Shi et al. 2007), suggesting a mechanism for PFOA‐induced male reproductive toxicity (Huang, Luo, et al. 2022).

Several epidemiological studies evaluated prenatal exposure of PFAS on children development. Strong correlations were observed between prenatal PFOS exposure and reduced birth weight and body mass index (Xu et al. 2019). Some associations between PFAS exposure and children's memory and verbal skills were noted, though not statistically significant (Carrizosa et al. 2021). PFAS exposure has also been linked to delayed puberty, earlier menopause, and altered serum levels of estradiol and thyroid hormones (Knox et al. 2011; Lewis et al. 2015; Liu et al. 2021; Lopez‐Espinosa et al. 2011), both of which are involved in osteoblast and osteoclast activity. Multiple epidemiological studies report that PFASs are negatively associated with bone mineral density (BMD) (Banjabi et al. 2020; Khalil et al. 2016; Koskela et al. 2017; Lin et al. 2014). Both human and animal studies indicate that PFOA accumulates in bone and exerts persistent adverse effects on bone health (Jeddy et al. 2018; Koskela et al. 2017; Scinicariello et al. 2020). Prenatal PFAS exposure has been associated with reduced bone mass (Jeddy et al. 2018; Lin et al. 2014). In the national health and nutrition examination survey (NHANES) 2013–2014 cohort, elevated PFAS levels were correlated with decreased height in boys aged 3–11 years (Scinicariello et al. 2020). While developmental and endocrine disruptions caused by PFAS are consistently reported in human, in vitro, and in vivo studies, bone‐related toxicity has been primarily identified in epidemiological studies, with limited in vivo experimental validation.

The zebrafish is a well‐established small freshwater model for studying human development, toxicity, and disease. The transparency of zebrafish embryos and larvae allows direct observation of developmental processes and bone alterations following toxic exposure. Another advantage is genomic similarity: up to 82% of human disease‐related genes have orthologues in zebrafish (Howe et al. 2013). Comparative analyses of human and zebrafish skeletal systems reveal similarities in bone types, skeletal cell types, ossification processes, and fracture repair mechanisms (Tonelli et al. 2020; Weigele and Franz‐Odendaal 2016; Witten et al. 2001). Both species share the same skeletal cell types, including chondrocytes, osteoblasts, multinucleated osteoclasts, and osteocytes (Weigele and Franz‐Odendaal 2016; Witten et al. 2001). Ossification type in both species is the same, including endochondral ossification, intramembranous ossification, and perichondral ossification (Tonelli et al. 2020; Weigele and Franz‐Odendaal 2016). Fracture repair (Geurtzen et al. 2014) and ossification loading direction (Newham et al. 2019) are also comparable. In recent years, zebrafish have been widely used to study bone health, including bone disease‐related genes and signaling pathways (Zhao et al. 2020), osteoporosis and drug treatments (Yang et al. 2023; Zuo et al. 2024), the relationship between bone health and metabolism (Carnovali et al. 2019), and the effects of environmental pollutants on bone development (Pu et al. 2020; Zhu et al. 2021).

In 2019, the US EPA identified perfluorobutane sulfonate (PFBS), a short‐chain perfluoroalkyl sulfonic acid, as a contaminant of concern in drinking water. Compared to long‐chain PFAS, PFBS crosses the placenta more readily, resulting in higher fetal exposure (Cai et al. 2020). Studies in Shandong Province, China, detected PFBS in most of the cord serum samples, at concentrations ranging from 0.01 to 0.98 ng/mL (Yao et al. 2022). PFBS exposure has been associated with neurodevelopmental disorders, thyroid hormone changes, and female reproduction in either humans or laboratory animals (Feng et al. 2017; Mellouk et al. 2025; Yao et al. 2022), its impact on skeletal development remains uninvestigated. In this study, zebrafish embryos were exposed to PFBS to evaluate its effects on embryonic and skeletal development, with the aim of elucidating the embryonic toxicity and osteotoxicity of PFBS.

2. Materials and Methods

2.1. Animals

Zebrafish (AB strain) were obtained from China Zebrafish Research Center (Wuhan, China) and all maintained according to standard protocols described in Zebrafish Book (Westerfirld 2000). Adult males and females were housed separately in a recirculating water system (tank water) at 28°C ± 1°C, pH 7.3 ± 0.3, under a 14/10‐h light/dark cycle. Fish were fed live brine shrimp twice daily.

The day before breeding, adults were well fed and placed in breeding tanks at a female‐to‐male ratio of 1:2. Fertilized eggs were collected half an hour after the onset of light on the breeding day. At 3‐h postfertilization (hpf), fertilized eggs were observed under a microscope to make sure the development stage is literately normal. Normally developed embryos were selected for exposure experiments.

2.2. Chemicals and Experimental Design

PFBS (CAS No. 29420‐49‐3) was purchased from Sigma‐Aldrich (St Louis, USA). Dexamethasone (DEX, CAS No. 50‐02‐2) and Dimethyl sulfoxide (DMSO, CAS No. 67‐68‐5) were obtained from Titan Exploration Platform (Shanghai, China). PFBS stock solutions were prepared in ultrapure water at a concentration of 0.05, 0.2, and 0.8 μg/mL and kept at room temperature, respectively. DEX stock solution was prepared in DMSO at a concentration of 10 mg/mL. All stock solutions were diluted 1:1000 in tank water. The final exposure concentrations for PFBS were set at 0.05, 0.2, and 0.8 ng/mL to mimic environmental levels, while DEX was used at a final concentration of 10 μg/mL to induce an osteoporotic model (Wei et al. 2013).

A total of 150 normally developed 3‐hpf embryos were randomly assigned to five groups (30 per group). Each group was placed in a 10‐cm Petri dish containing 20 mL of the respective solution: tank water (control), 10‐μg/mL DEX (positive control), or 0.05, 0.2, or 0.8‐ng/mL PFBS (exposure groups). The exposure lasted 7 days, with 10 mL of the solution replaced daily.

Developmental parameters, including edema, pigmentation, heart rate, spontaneous contraction, tail distortion, survival, and hatching rate, were observed under a Leica MZ75 microscope (Germany) at 24, 48, and 72 hpf, and images were captured with a Leica EC3 CCD camera. Breeding, exposure, and morphological observations were performed in triplicate.

2.3. Calcein Staining and Observation

Calcein is a green fluorescent dye, which is used for calcium detection. After 7 days of exposure, 8dpf zebrafish larvae were collected into tubes and euthanized with 0.04‐g/L tricaine solution, stained in 0.2% calcein (CAS No. 1461‐15‐0, purchased from Titan Exploration Platform) for 1 h in dark, washed in PBS for 5 min, three times, dehydrated in 50% glycerol for 10 min, followed by 80% glycerol for 30 min, and kept in glycerol in dark. The stained larvae were transferred to Petri dishes and observed under the Olympus florescent microscope (Olympus SZX12, Japan) with a GFP filter, then photographed with Olympus CCD (Olympus DP73, Japan). The florescent image was analyzed by Image J. The area of green plots represented the area of the ossified bone, and the mean integrated density reflected the BMD. The staining and observation were repeated three times.

2.4. Gene Expression Analysis

At 8 dpf, 10 zebrafish larvae of each group were collected in clean tubes, washed with PBS three times, and homogenized in Trizol (Thermo Fisher Scientific). Total RNA was extracted according to the manufacturer's protocol. cDNA was synthesized using QuantiNova Reverse Transcription Kit (Qiagen). Primers (Table 1) were designed with online software PRIMER3. Quantitative RT‐PCR was performed on the SteponePlus Real‐Time PCR System using QuantiNova SYBR Green PCR Kit. Measurement was normalized to elf1a expression. Fold changes were calculated with the formula 2−ΔΔCt.

TABLE 1.

Primers used in real‐time‐PCR.

Name of mRNA Forward sequence (5′‐3′) Reverse sequence (5′‐3′)
elf1a AGGCTGACTGTGCTGTGCTGA CCAGGGTGAAAGCCAGGAGG
alp GGCCTTACATGAAGCTGTGG GTTTCCTCGTGGTGTGTAGC
runx2 GTGGAGATCATAGCGGACCA CTCCCAGAGCCACAACCTTA
bmp2b CGGTCAACTCCAACATTCCC ATTGTTCTCATCGGCAACCG
acp5 GGCGAAGTCCAAAGCTGATT CGGATATGGACCACACTGGA
ctsk CGTCACTTCGGTGAAGAACC ACAGTCCACCAGGTTCTGAG
mmp9 ACCTAGAACTGGCCCTGAAC CTGAAGGGACCACCTGAGTT
Open in a new tab

2.5. Statistical Analysis

All data are presented as x ± s (mean ± standard deviation). GraphPad Prism 8 software was used in data analysis. T‐test was used in comparison between two groups, while one‐way ANOVA was used in multiple group comparisons. p‐value less than 0.05 was considered as statistically significant.

3. Results

3.1. Effects of PFBS on the Early Embryonic Development

At 24 hpf, most PFBS‐exposed embryos exhibited no significant abnormalities, though a few of them exhibited shortened tails (Figure 1A,D). Spontaneous contractions, which occur in bursts due to nervous system development, were counted in 10 well‐developed embryos per group. Slight increases in contraction frequency were observed, but these were not statistically significant (Figure 1G). At 48 hpf, pigmentation and morphology appeared normal in both control and PFBS groups, except for previously observed tail curvature (Figure 1B,E). By 72 hpf, most of the zebrafish larvae had hatched, with a fully looped strongly beating heart. The anomalies and hatching rate were not significantly affected by PFBS exposure. A few larvae exhibited short trunks and pericardial edema (Figure 1C,F). Heart rate was counted in well‐developed normal larvae. The heart rate was significantly reduced with the increasing concentration of PFBS exposure. The heart rates were 151.53 ± 8.22 per minute in the control group, 133.67 ± 11.20 per minute in positive control, and 137.40 ± 8.99, 125.33 ± 6.77, 112.27 ± 9.74 in the low, medium, and high‐dose PFBS exposure groups, respectively (Figure 1H).

FIGURE 1.

FIGURE 1

Open in a new tab

The developmental morphology of zebrafish after exposure to different dose of PFBS. (A, B, and C) show the photographs of normal developed zebrafish embryos, which serve as control for (D, E, and F) at the same developmental time point. (A) is taken at 24 hpf, the embryo is well elongated from early curvature around yolk, circulation can be observed, pigmentation begin, and spontaneous contraction bursts occasionally. (B) is 48‐hpf embryo, which is well pigmented along the trunk. (C) is a dechorionated larva of 72‐hpf with looped heart, the pectoral fin bud begin to sway for swimming. (D, E, and F) show the photographs of abnormal developed zebrafish embryos. (D) The embryo showed unclear head and curved trunk. (E) The embryo showed few melanin and curved trunk. (F) The larva showed mild pericardial edema and curved tail. (G) Statistical graph of spontaneous contraction at 24 hpf. The data of spontaneous contraction counts was slightly increased after PFBS exposure, but the change was not statistically significant. (H) Statistical graph of heartbeat at 72 hpf. The data of heartbeats were statistically–significantly decreased after PFBS exposure, especially in the high‐dose group (p < 0.01).

3.2. Effects of PFBS on Cranial Bone Mineralization of Zebrafish Larvae

Calcein is a low‐toxicity, calcium‐dependent fluorescent dye which can be used for in vivo bone mineralization staining. The stained extent represents the calcification area of mineralized bone. To avoid differences caused by malformation, all larvae involved in the staining experiment were well‐developed with normal morphology.

To assess the impact of PFBS exposure on cranial bone mineralization in zebrafish larvae, calcein staining was performed on 8‐dpf larvae, and fluorescence pixels were analyzed with software Image J. Compared to the control group, the cranial bone mineralization area in the positive control group zebrafish larvae was significantly reduced (p < 0.01, Figure 2), which is consistent with results from previous osteoporosis models (Wei et al. 2013). PFBS exposure also reduced cranial mineralization in a dose‐dependent manner. The fluorescence pixels of each group were 48,362 ± 8972 in the control group, 20,227 ± 9060 in the DEX group, and 46,621 ± 11,547, 41,846 ± 6717, 31,850 ± 6794 in the low‐, medium‐, and high‐dose PFBS exposure groups, respectively. The fluorescence pixels of photographs shown in figure were similar to the average pixels of this group (Figure 2).

FIGURE 2.

FIGURE 2

Open in a new tab

Fluorescence images of the larval zebrafish cranium and quantification of the fluorescence area post‐exposure. All images were acquired with the larvae positioned in a dorsal recumbency orientation, head to the right. (A) A light photograph of a control larva, outlining the imaging field. (B) Fluorescence image of control larva. (C) Fluorescence image of positive control (DEX group) larva. (D) Fluorescence image of low PFBS exposure larva. (E) Fluorescence image of median PFBS exposure larva. (F) Fluorescence image of high PFBS exposure larva. (G) The quantitative analysis of the cranial fluorescence area. Data are presented as mean ± SEM; *p < 0.05 and **p < 0.01.

3.3. Effects of PFBS on Vertebral Mineralization of Zebrafish Larvae

In zebrafish, vertebral formation follows a specific sequence. Vertebrae 3 and 4 are mineralized first, encircling the notochord. Then, other vertebrae are mineralized bidirectionally (Bird and Mabee 2003). To determine the effect of PFBS exposure on the mineralization of zebrafish larvae vertebrae, we photographed and measured the vertebral BMD of Vertebrae 3 and 4.

The mean BMD of Vertebrae 3 and 4 in DEX group was significantly lower than that in control group(p < 0.01). The BMD in DEX group was 9.44 ± 7.96, while the BMD in control group was 191.58 ± 29.64. All the BMD of PFBS exposure groups were significantly lower than that of the control group (p < 0.05). The BMD in PFBS exposure groups were 131.03 ± 18.14, 115.08 ± 20.64, and 95.36 ± 13.39, respectively. The photographs shown in figure were represented the similar mean BMD in each group (Figure 3).

FIGURE 3.

FIGURE 3

Open in a new tab

Fluorescence images of the larval zebrafish vertebrae centrum and the mean fluorescent density of Centrum 3 and 4 post‐exposure. All images were captured with zebrafish larvae positioned in lateral recumbency, head oriented to the left and dorsal side up. (A) A light photograph of a control larva delineated by a black frame, outlining the imaging field. (A′). The magnified light field of the black frame. (B) Fluorescence image of control larva. (C) Fluorescence image of positive control (DEX group) larva. (D) Fluorescence image of low PFBS exposure larva. (E) Fluorescence image of median PFBS exposure larva. (F) Fluorescence image of high PFBS exposure larva. (G) The quantitative analysis of the mean fluorescent density of Centrum 3 and 4. Data are presented as mean ± SEM; *p < 0.05 and **p < 0.01.

3.4. Effect of PFBS on Osteogenesis/Osteoclastogenesis‐Related Gene Expression of Zebrafish Larvae

To understand the possible mechanism of the decreased mineralization in cranial and the increased number of vertebra, we analyzed the expression of genes related to osteogenesis/osteoclastogenesis. In previous studies, several proteins related to osteogenesis, such as alkaline phosphatase (ALP), runt‐related transcription factor 2 (RUNX2), and bone morphogenetic protein 2b (BMP2b), as well as proteins associated with osteoclastogenesis, including tartrate‐resistant acid phosphatase (TRACP/ACP5), cathepsin K (CTSK), and matrix metalloproteinase 9 (MMP9). All these genes identified as molecular markers for osteogenesis and osteoclastogenesis.

We analyzed the expression levels of these markers to preliminarily assess the molecular mechanisms underlying PFBS effects on mineralization. The results showed that, compared to the control groups, the expression of osteogenic markers in the positive control DEX group reduced significantly, while the expression of osteoclast markers increased significantly.

In the PFBS exposure groups, all the expression of osteoclast markers increased with the exposure concentration of PFBS increasing. Compared to the positive DEX group, the expression of acp5 was increased, the expression of ctsk was comparable, while the expression of mmp9 was decreased. The expression levels of osteogenic markers, such as alp, bmp2b, and runx2, all exhibited a concentration‐dependent decrease. The decreased level of alp and bmp2b was similar to the DEX group in 0.8‐ng/mL PFBS group, and the level of runx2 was similar to the DEX group in 0.2‐ng/mL group. The expression levels of osteogenesis marker, such as alp, bmp2b, and runx2, all exhibited a concentration‐dependent decrease. The reduction in alp and bmp2b was comparable to the positive control (DEX group) only at the high concentration, whereas the decrease in runx2 paralleled that of the positive control starting from the medium concentration. The relative gene expression levels are shown in Figure 4.

FIGURE 4.

FIGURE 4

Open in a new tab

Relative gene expression level of osteogenesis/osteoclastogenesis in zebrafish larval exposed to PFBS.

4. Discussion

Numerous reports are published on the effects of environmental pollutants on human and animal health. This study demonstrates that PFBS exposure impairs development and bone mineralization in zebrafish larvae, notably reducing cranial bone mineralization in morphologically normal individuals. These findings align with previous epidemiological studies and reinforce concerns regarding the skeletal risks posed by PFBS.

Although some embryos exhibited tail curvature, the overall malformation rate was below 5% and not statistically significant. Concern should be focused on the abnormal spontaneous contraction at 24 hpf and lower heart rate at 72 hpf. Spontaneous contractions reflect nervous system development and are a sensitive indicator of neurotoxicity. Similar neurobehavioral alterations have been reported in zebrafish exposed to PFOS, which showed hyperactivity in adulthood (Chen et al. 2012), suggesting persistent neurodevelopmental effects.

Lower heart rate indicating that PFBS exposure affected the cardiac function of the zebrafish. This result corroborates the toxic effects of perfluorinated compounds on zebrafish cardiac function that were observed in other studies (Chen et al. 2022; Li et al. 2024; Zhao et al. 2024). Multiple studies have demonstrated that PFAS can act as thyroid endocrine–disrupting chemicals, impairing thyroid hormone (TH) homeostasis and the hypothalamic–pituitary–thyroid (HPT) axis (Coperchini et al. 2017; Coperchini et al. 2020; Du et al. 2024). Thyroid hormones are critical regulators of cardiac development, pacemaker activity, and myocardial contractility during early‐life stages. Disruptions in TH levels have been consistently associated with bradycardia and impaired cardiac performance in zebrafish embryos and larvae (Zhao et al. 2024). Notably, parental or early‐life exposure to PFAS alternatives has been shown to reduce heart rate in offspring, accompanied by altered TH levels and dysregulation of HPT‐axis–related genes, suggesting a strong endocrine‐mediated mechanism (Zhao et al. 2025). In addition to endocrine disruption, accumulating evidence indicates that PFAS may directly interfere with intracellular calcium homeostasis (Harada et al. 2005; Li et al. 2024). Calcium signaling plays a central role in excitation–contraction coupling, cardiac rhythmicity, and osteogenic differentiation. PFAS exposure has been reported to alter the expression or function of calcium channels and calcium‐dependent signaling pathways, leading to reduced heart rate and abnormal cardiac output (Harada et al. 2005). Recent studies have shown that PFAS‐induced cardiotoxicity in zebrafish is associated with disrupted calcium channel activity and altered cardiomyocyte calcium handling, further supporting a calcium‐mediated mechanism underlying heart rate reduction (Li et al. 2024). Taken together, these findings suggest that the observed decrease in heart rate following PFBS exposure in our study may result from the combined effects of thyroid endocrine disruption and calcium signaling interference.

Zebrafish larvae exposed to PFBS exhibited symptoms of osteopenia, including decreased ossification area in the cranial bones and reduced ossification intensity in vertebrae (Dietrich et al. 2020). Literature reports that zebrafish bones are formed by three types of ossification: intramembranous ossification, which is the main form of mineralization in the zebrafish skeleton, occurring in the cranial vault, gill covers, and most vertebrae; endochondral ossification, where cartilage plates are sequentially replaced by bone, occurring only in the neural arches of Vertebrae 1 to 5; and perichondral ossification, occurring on the surface of cartilage but not replacing the cartilage template, as seen in the zebrafish mandible (Dietrich et al. 2020). We infer that PFBS reduces the area and density of both the cranial bones and vertebrae centrum by disrupting intramembranous ossification, the process responsible for their formation.

Multiple genes from many signaling pathways may be involved in the decreased bone mass caused by PFBS exposure. bmp2b, a member of the TGF‐β family, plays a crucial role in osteoblast differentiation from mesenchymal stem cells and in promoting osteoblast deposition of bone matrix during the initiation of bone formation (Wu et al. 2024). PFOA may interfere with the TGF‐β signaling pathway by downregulating BMP2b expression, which in turn downregulates the expression of the key transcription factor RUNX2, affecting the maturation and function of osteoblasts, thus inhibiting bone formation. CTSK is a protease secreted by osteoclasts, regulated by the RANK signaling pathway. During bone resorption, CTSK can degrade type I collagen in the bone matrix (Kafienah et al. 1998), cleave and activate MMP9 (Christensen and Shastri 2015), another protease involved in bone matrix degradation. These processes are essential for bone resorption. PFBS may upregulate CTSK expression by interfering with the RANK signaling pathway, thereby activating MMP9 and promoting bone resorption, which leads to a reduction in ossification.

Zebrafish share many skeletal features with humans and serve as a valuable model for bone research. Our study underscores the adverse effects of PFBS on embryonic and skeletal development and confirms the value of zebrafish in bone health research. However, this study has many limitations. Zebrafish model cannot fully replicate human bone development, particularly during specific periods such as puberty and menopause when bone changes are more remarkable. Future studies could extend the exposure duration or explore mixed exposure to various PFAS to obtain a more comprehensive understanding of PFAS on environmental and health risks. Due to technical constraints of our laboratory, we were unable to quantify the actual PFBS concentrations in the exposure solutions. We implemented several measures to minimize concentration deviations: freshly prepared stock solutions, diluted strictly according to the experimental design, and replacement of 50% exposure solution as recommended for zebrafish larval exposure studies (OECD 2025). We acknowledge that nominal concentrations may not perfectly reflect actual exposure levels, especially for low‐concentration PFBS. Future studies will incorporate analytical confirmation of exposure concentrations using LC–MS/MS to address this limitation.

Given its presence in environmental and human samples (including cord serum and breast milk), PFBS poses a credible exposure risk during critical developmental windows. Our study used environmentally relevant concentrations (0.05–0.8 ng/mL), which align with reported levels in human cord serum (Yao et al. 2022). The observed disruptions in bone formation and gene expression at these low concentrations suggest that developing skeletons may be vulnerable. Thus, our findings offer important in vivo support for epidemiological observations associating PFAS with reduced bone density in humans. Although translation to humans requires further validation, this work highlights the potential developmental skeletal toxicity of PFBS and calls for targeted studies in mammalian models and human cohorts to define public health risks.

Funding

Policy Research of Shanghai Municipal Bureau of Disease Control and Prevention (No. 2025JZ40), National Natural Science Foundation of China (Grant No. 31900607).

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgments

We would like to thank Shanghai Jiuting Hospital, Shanghai Institute for Biomedical and Pharmaceutical Technologies, and for the laboratory and the technical assistant. This study was funded by the Policy Research of Shanghai Municipal Bureau of Disease Control and Prevention (No.2025JZ40) and the National Natural Science Foundation of China (Grant No. 31900607).

Contributor Information

Jingying Hu, Email: hujingying@aliyun.com.

Weihua Li, Email: iamliweihua@foxmail.com.

Data Availability Statement

Data sharing not applicable to this article as no datasets were generated or analyzed during the current study.

References

  1. Banjabi, A. A. , Li A. J., Kumosani T. A., Yousef J. M., and Kannan K.. 2020. “Serum Concentrations of Perfluoroalkyl Substances and Their Association With Osteoporosis in a Population in Jeddah, Saudi Arabia.” Environmental Research 187: 109676. 10.1016/j.envres.2020.109676. [DOI] [PubMed] [Google Scholar]
  2. Bird, N. C. , and Mabee P. M.. 2003. “Developmental Morphology of the Axial Skeleton of the Zebrafish, Danio rerio (Ostariophysi: Cyprinidae).” Developmental Dynamics 228, no. 3: 337–357. 10.1002/dvdy.10387. [DOI] [PubMed] [Google Scholar]
  3. Buck, R. C. , Franklin J., Berger U., et al. 2011. “Perfluoroalkyl and Polyfluoroalkyl Substances in the Environment: Terminology, Classification, and Origins.” Integrated Environmental Assessment and Management 7, no. 4: 513–541. 10.1002/ieam.258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cai, D. , Li Q.‐Q., Chu C., et al. 2020. “High Trans‐Placental Transfer of Perfluoroalkyl Substances Alternatives in the Matched Maternal‐Cord Blood Serum: Evidence From a Birth Cohort Study.” Science of the Total Environment 705: 135885. 10.1016/j.scitotenv.2019.135885. [DOI] [PubMed] [Google Scholar]
  5. Carnovali, M. , Luzi L., Terruzzi I., Banfi G., and Mariotti M.. 2019. “Liquiritigenin Reduces Blood Glucose Level and Bone Adverse Effects in Hyperglycemic Adult Zebrafish.” Nutrients 11, no. 5: 1042. 10.3390/nu11051042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Carrizosa, C. , Murcia M., Ballesteros V., et al. 2021. “Prenatal Perfluoroalkyl Substance Exposure and Neuropsychological Development Throughout Childhood: The INMA Project.” Journal of Hazardous Materials 416: 125185. 10.1016/j.jhazmat.2021.125185. [DOI] [PubMed] [Google Scholar]
  7. Chen, H. , Qiu W., Yang X., et al. 2022. “Perfluorooctane Sulfonamide (PFOSA) Induces Cardiotoxicity via Aryl Hydrocarbon Receptor Activation in Zebrafish.” Environmental Science & Technology 56, no. 12: 8438–8448. 10.1021/acs.est.1c08875. [DOI] [PubMed] [Google Scholar]
  8. Chen, J. , Das S., La Du J., et al. 2012. “Chronic PFOS Exposures Induce Life Stage–Specific Behavioral Deficits in Adult Zebrafish and Produce Malformation and Behavioral Deficits in F1 Offspring.” Environmental Toxicology and Chemistry 32, no. 1: 201–206. 10.1002/etc.2031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Christensen, J. , and Shastri V. P.. 2015. “Matrix‐Metalloproteinase‐9 is Cleaved and Activated by Cathepsin K.” BMC Research Notes 8, no. 1: 322. 10.1186/s13104-015-1284-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Coperchini, F. , Awwad O., Rotondi M., Santini F., Imbriani M., and Chiovato L.. 2017. “Thyroid Disruption by Perfluorooctane Sulfonate (PFOS) and Perfluorooctanoate (PFOA).” Journal of Endocrinological Investigation 40, no. 2: 105–121. 10.1007/s40618-016-0572-z. [DOI] [PubMed] [Google Scholar]
  11. Coperchini, F. , Croce L., Ricci G., et al. 2020. “Thyroid Disrupting Effects of Old and New Generation PFAS.” Front Endocrinol (Lausanne). 11: 612320. 10.3389/fendo.2020.612320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dickman, R. A. , and Aga D. S.. 2022. “A Review of Recent Studies on Toxicity, Sequestration, and Degradation of Per‐ and Polyfluoroalkyl Substances (PFAS).” Journal of Hazardous Materials 436: 129120. 10.1016/j.jhazmat.2022.129120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dietrich, K. , Fiedler I. A. K., Kurzyukova A., et al. 2020. “Skeletal Biology and Disease Modeling in Zebrafish.” Journal of Bone and Mineral Research 36, no. 3: 436–458. 10.1002/jbmr.4256. [DOI] [PubMed] [Google Scholar]
  14. Du, X. , Wu Y., Tao G., et al. 2024. “Association Between PFAS Exposure and Thyroid Health: A Systematic Review and Meta‐Analysis for Adolescents, Pregnant Women, Adults and Toxicological Evidence.” Science of the Total Environment 953: 175958. 10.1016/j.scitotenv.2024.175958. [DOI] [PubMed] [Google Scholar]
  15. Feng, X. , Cao X., Zhao S., et al. 2017. “Exposure of Pregnant Mice to Perfluorobutanesulfonate Causes Hypothyroxinemia and Developmental Abnormalities in Female Offspring.” Toxicological Sciences 155, no. 2: 409–419. 10.1093/toxsci/kfw219. [DOI] [PubMed] [Google Scholar]
  16. Geurtzen, K. , Knopf F., Wehner D., Huitema L. F., Schulte‐Merker S., and Weidinger G.. 2014. “Mature Osteoblasts Dedifferentiate in Response to Traumatic Bone Injury in the Zebrafish Fin and Skull.” Development 141, no. 11: 2225–2234. 10.1242/dev.105817. [DOI] [PubMed] [Google Scholar]
  17. Guo, H. , Zhang H., Sheng N., Wang J., Chen J., and Dai J.. 2021. “Perfluorooctanoic Acid (PFOA) Exposure Induces Splenic Atrophy via Overactivation of Macrophages in Male Mice.” Journal of Hazardous Materials 407: 124862. 10.1016/j.jhazmat.2020.124862. [DOI] [PubMed] [Google Scholar]
  18. Harada, K. , Xu F., Ono K., Iijima T., and Koizumi A.. 2005. “Effects of PFOS and PFOA on L‐Type Ca2+ Currents in Guinea‐Pig Ventricular Myocytes.” Biochemical and Biophysical Research Communications 329, no. 2: 487–494. 10.1016/j.bbrc.2005.01.163. [DOI] [PubMed] [Google Scholar]
  19. Howe, K. , Clark M. D., Torroja C. F., et al. 2013. “The Zebrafish Reference Genome Sequence and Its Relationship to the Human Genome.” Nature 496, no. 7446: 498–503. 10.1038/nature12111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Huang, J. , Wang Q., Liu S., Lai H., and Tu W.. 2022. “Comparative Chronic Toxicities of PFOS and Its Novel Alternatives on the Immune System Associated With Intestinal Microbiota Dysbiosis in Adult Zebrafish.” Journal of Hazardous Materials 425: 127950. 10.1016/j.jhazmat.2021.127950. [DOI] [PubMed] [Google Scholar]
  21. Huang, Q. , Luo L., Han X., Li F., Zhang X., and Tian M.. 2022. “Low‐Dose Perfluorooctanoic Acid Stimulates Steroid Hormone Synthesis in Leydig Cells: Integrated Proteomics and Metabolomics Evidence.” Journal of Hazardous Materials 424, no. Pt D: 127656. 10.1016/j.jhazmat.2021.127656. [DOI] [PubMed] [Google Scholar]
  22. Jeddy, Z. , Tobias J. H., Taylor E. V., Northstone K., Flanders W. D., and Hartman T. J.. 2018. “Prenatal Concentrations of Perfluoroalkyl Substances and Bone Health in British Girls at Age 17.” Archives of Osteoporosis 13, no. 1: 84. 10.1007/s11657-018-0498-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kafienah, W. , Bromme D., Buttle D. J., Croucher L. J., and Hollander A. P.. 1998. “Human Cathepsin K Cleaves Native Type I and II Collagens at the N‐Terminal End of the Triple Helix.” Biochemical Journal 331, no. Pt 3: 727–732. 10.1042/bj3310727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kang, J. S. , Ahn T. G., and Park J. W.. 2019. “Perfluorooctanoic Acid (PFOA) and Perfluooctane Sulfonate (PFOS) Induce Different Modes of Action in Reproduction to Japanese Medaka (Oryzias latipes).” Journal of Hazardous Materials 368: 97–103. 10.1016/j.jhazmat.2019.01.034. [DOI] [PubMed] [Google Scholar]
  25. Khalil, N. , Chen A., Lee M., et al. 2016. “Association of Perfluoroalkyl Substances, Bone Mineral Density, and Osteoporosis in the U.S. Population in NHANES 2009‐2010.” Environmental Health Perspectives 124, no. 1: 81–87. 10.1289/ehp.1307909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Knox, S. S. , Jackson T., Javins B., Frisbee S. J., Shankar A., and Ducatman A. M.. 2011. “Implications of Early Menopause in Women Exposed to Perfluorocarbons.” Journal of Clinical Endocrinology & Metabolism 96, no. 6: 1747–1753. 10.1210/jc.2010-2401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Koskela, A. , Koponen J., Lehenkari P., Viluksela M., Korkalainen M., and Tuukkanen J.. 2017. “Perfluoroalkyl Substances in Human Bone: Concentrations in Bones and Effects on Bone Cell Differentiation.” Scientific Reports 7, no. 1: 6841. 10.1038/s41598-017-07359-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lewis, R. C. , Johns L. E., and Meeker J. D.. 2015. “Serum Biomarkers of Exposure to Perfluoroalkyl Substances in Relation to Serum Testosterone and Measures of Thyroid Function Among Adults and Adolescents From NHANES 2011‐2012.” International Journal of Environmental Research and Public Health 12, no. 6: 6098–6114. 10.3390/ijerph120606098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li, J. , Hu C., Zhao B., Li J., and Chen L.. 2024. “Proteomic and Cardiac Dysregulation by Representative Perfluoroalkyl Acids of Different Chemical Speciation During Early Embryogenesis of Zebrafish.” Science of the Total Environment 926: 172000. 10.1016/j.scitotenv.2024.172000. [DOI] [PubMed] [Google Scholar]
  30. Lin, L. Y. , Wen L. L., Su T. C., Chen P. C., and Lin C. Y.. 2014. “Negative Association Between Serum Perfluorooctane Sulfate Concentration and Bone Mineral Density in US Premenopausal Women: NHANES, 2005‐2008.” Journal of Clinical Endocrinology & Metabolism 99, no. 6: 2173–2180. 10.1210/jc.2013-3409. [DOI] [PubMed] [Google Scholar]
  31. Liu, H. , Pan Y., Jin S., et al. 2021. “Associations Between Six Common Per‐ and Polyfluoroalkyl Substances and Estrogens in Neonates of China.” Journal of Hazardous Materials 407: 124378. 10.1016/j.jhazmat.2020.124378. [DOI] [PubMed] [Google Scholar]
  32. Lopez‐Espinosa, M. J. , Fletcher T., Armstrong B., et al. 2011. “Association of Perfluorooctanoic Acid (PFOA) and Perfluorooctane Sulfonate (PFOS) With Age of Puberty Among Children Living Near a Chemical Plant.” Environmental Science & Technology 45, no. 19: 8160–8166. 10.1021/es1038694. [DOI] [PubMed] [Google Scholar]
  33. Mellouk, N. , Marchese M. J., Gao F., Liang S., and Feng L.. 2025. “Effects of Perfluorobutane Sulfonate (PFBS) on Female Reproduction, Pregnancy, and Birth Outcomes.” Obstetrical & Gynecological Survey 80, no. 10: 657–672. 10.1097/OGX.0000000000001440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Newham, E. , Kague E., Aggleton J. A., Fernee C., Brown K. R., and Hammond C. L.. 2019. “Finite Element and Deformation Analyses Predict Pattern of Bone Failure in Loaded Zebrafish Spines.” Journal of the Royal Society Interface 16, no. 160: 20190430. 10.1098/rsif.2019.0430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. OECD . 2025. “Test No. 236: Fish Embryo Acute Toxicity (FET) Test.”
  36. Prevedouros, K. , Cousins I. T., Buck R. C., and Korzeniowski S. H.. 2006. “Sources, Fate and Transport of Perfluorocarboxylates.” Environmental Science & Technology 40, no. 1: 32–44. 10.1021/es0512475. [DOI] [PubMed] [Google Scholar]
  37. Pu, S. Y. , Hamid N., Ren Y. W., and Pei D. S.. 2020. “Effects of Phthalate Acid Esters on Zebrafish Larvae: Development and Skeletal Morphogenesis.” Chemosphere 246: 125808. 10.1016/j.chemosphere.2019.125808. [DOI] [PubMed] [Google Scholar]
  38. Scinicariello, F. , Buser M. C., Abadin H. G., and Attanasio R.. 2020. “Perfluoroalkyl Substances and Anthropomorphic Measures in Children (Ages 3‐11 Years), NHANES 2013‐2014.” Environmental Research 186: 109518. 10.1016/j.envres.2020.109518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Shi, Z. , Zhang H., Liu Y., Xu M., and Dai J.. 2007. “Alterations in Gene Expression and Testosterone Synthesis in the Testes of Male Rats Exposed to Perfluorododecanoic Acid.” Toxicological Sciences 98, no. 1: 206–215. 10.1093/toxsci/kfm070. [DOI] [PubMed] [Google Scholar]
  40. Sun, S. , Li X., Zhang L., et al. 2023. “Hexafluoropropylene Oxide Trimer Acid (HFPO‐TA) Disturbs Embryonic Liver and Biliary System Development in Zebrafish.” Science of the Total Environment 859, no. Pt 1: 160087. 10.1016/j.scitotenv.2022.160087. [DOI] [PubMed] [Google Scholar]
  41. Tachachartvanich, P. , Singam E. R. A., Durkin K. A., Furlow J. D., Smith M. T., and La Merrill M. A.. 2022. “In Vitro Characterization of the Endocrine Disrupting Effects of Per‐ and Poly‐Fluoroalkyl Substances (PFASs) on the Human Androgen Receptor.” Journal of Hazardous Materials 429: 128243. 10.1016/j.jhazmat.2022.128243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tonelli, F. , Bek J. W., Besio R., et al. 2020. “Zebrafish: A Resourceful Vertebrate Model to Investigate Skeletal Disorders.” Frontiers in Endocrinology 11: 489. 10.3389/fendo.2020.00489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wei, Y. , Wang C., Cai X., Zhan Y., and Jia X.. 2013. “Establishment of Zebrafish Osteopenia Model Induced by Dexamethasone.” Acta Pharmaceutica Sinica 48, no. 2: 6. [PubMed] [Google Scholar]
  44. Weigele, J. , and Franz‐Odendaal T. A.. 2016. “Functional Bone Histology of Zebrafish Reveals Two Types of Endochondral Ossification, Different Types of Osteoblast Clusters and a New Bone Type.” Journal of Anatomy 229, no. 1: 92–103. 10.1111/joa.12480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Westerfirld, M. 2000. The Zebrafish Book:A Guide for the laboratory Use of Zebrafish (Danio rerio). 4th ed. University of Onegon Press. [Google Scholar]
  46. Witten, P. E. , Hansen A., and Hall B. K.. 2001. “Features of Mono‐ and Multinucleated Bone Resorbing Cells of the Zebrafish Danio rerio and Their Contribution to Skeletal Development, Remodeling, and Growth.” Journal of Morphology 250, no. 3: 197–207. 10.1002/jmor.1065. [DOI] [PubMed] [Google Scholar]
  47. Wu, M. , Wu S., Chen W., and Li Y.. 2024. “The Roles and Regulatory Mechanisms of TGF‐β and BMP Signaling in Bone and Cartilage Development, Homeostasis and Disease.” Cell Research 34, no. 2: 101–123. 10.1038/s41422-023-00918-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Xie, S. 2013. “Source Identification and Emission Estimation of Perfluorooctane Sulfonate in China. (Master), Chinese Academy of Sciences.” https://d.wanfangdata.com.cn/thesis/Y2369754 Available from Wanfang Data. [DOI] [PubMed]
  49. Xie, X. , Zhou J., Hu L., et al. 2022. “Oral Exposure to a Hexafluoropropylene Oxide Trimer Acid (HFPO‐TA) Disrupts Mitochondrial Function and Biogenesis in Mice.” Journal of Hazardous Materials 430: 128376. 10.1016/j.jhazmat.2022.128376. [DOI] [PubMed] [Google Scholar]
  50. Xu, C. , Yin S., Liu Y., et al. 2019. “Prenatal Exposure to Chlorinated Polyfluoroalkyl Ether Sulfonic Acids and Perfluoroalkyl Acids: Potential Role of Maternal Determinants and Associations With Birth Outcomes.” Journal of Hazardous Materials 380: 120867. 10.1016/j.jhazmat.2019.120867. [DOI] [PubMed] [Google Scholar]
  51. Yang, X. Y. , Wu D. D., Zhuang C. C., and Ma C. M.. 2023. “Anti‐Osteoporosis Effects of Mammalian Lignans and Their Precursors From Flaxseed and Safflower Seed Using Zebrafish Model.” Journal of Food Science 88, no. 12: 5278–5290. 10.1111/1750-3841.16816. [DOI] [PubMed] [Google Scholar]
  52. Yao, Q. , Vinturache A., Lei X., et al. 2022. “Prenatal Exposure to Per‐ and Polyfluoroalkyl Substances, Fetal Thyroid Hormones, and Infant Neurodevelopment.” Environmental Research 206: 112561. 10.1016/j.envres.2021.112561. [DOI] [PubMed] [Google Scholar]
  53. Zhang, R. , Yao Y., Tu L., Luan T., and Chen B.. 2021. “Non‐Targeted Metabolomics of Multiple Human Cells Revealing Differential Toxic Effects of Perfluorooctanoic Acid.” Journal of Hazardous Materials 409: 125017. 10.1016/j.jhazmat.2020.125017. [DOI] [PubMed] [Google Scholar]
  54. Zhao, X. , Meng X., Yang D., et al. 2024. “Thyroid Disrupting Effects and the Developmental Toxicity of Hexafluoropropylene Oxide Oligomer Acids in Zebrafish During Early Development.” Chemosphere 361: 142462. 10.1016/j.chemosphere.2024.142462. [DOI] [PubMed] [Google Scholar]
  55. Zhao, X. , Yang D., Kamstra J. H., et al. 2025. “Parental Exposure to Hexafluoropropylene Oxide Trimer Acid Induces Transgenerational Developmental Toxicity and Thyroid Endocrine Disruption Effects in Zebrafish.” Ecotoxicology and Environmental Safety 307: 119476. 10.1016/j.ecoenv.2025.119476. [DOI] [PubMed] [Google Scholar]
  56. Zhao, Y. , Wang H. L., Li T. T., Yang F., and Tzeng C. M.. 2020. “Baicalin Ameliorates Dexamethasone‐Induced Osteoporosis by Regulation of the RANK/RANKL/OPG Signaling Pathway.” Drug Design Development and Therapy 14: 195–206. 10.2147/DDDT.S225516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zhou, X. , Wang J., Sheng N., Cui R., Deng Y., and Dai J.. 2018. “Subchronic Reproductive Effects of 6:2 Chlorinated Polyfluorinated Ether Sulfonate (6:2 Cl‐PFAES), an Alternative to PFOS, on Adult Male Mice.” Journal of Hazardous Materials 358: 256–264. 10.1016/j.jhazmat.2018.07.004. [DOI] [PubMed] [Google Scholar]
  58. Zhu, F. , Wang J., Jiao J., and Zhang Y.. 2021. “Exposure to Acrylamide Induces Skeletal Developmental Toxicity in Zebrafish and Rat Embryos.” Environmental Pollution 271: 116395. 10.1016/j.envpol.2020.116395. [DOI] [PubMed] [Google Scholar]
  59. Zuo, Y. , Chen C., Liu F., et al. 2024. “Pinoresinol Diglucoside Mitigates Dexamethasone‐Induced Osteoporosis and Chondrodysplasia in Zebrafish.” Toxicology and Applied Pharmacology 484: 116884. 10.1016/j.taap.2024.116884. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data sharing not applicable to this article as no datasets were generated or analyzed during the current study.

Articles from Journal of Applied Toxicology are provided here courtesy of Wiley

RESOURCES