ABSTRACT
Background
A traditional Chinese medicine Yi‐Qi‐Jian‐Pi‐Xiao‐Yu (YQJPXY) formula can potentially ameliorate chronic kidney disease (CKD), but its effect on renal fibrosis (RF), a prevalent pathological feature of CKD, remains unclear.
Methods
To mimic renal injury and fibrosis, a mouse unilateral ureteral obstruction (UUO) model was employed. Using hematoxylin–eosin and Masson's trichrome stains, enzyme‐linked immunosorbent assay, and immunofluorescence, the effects of YQJPXY on renal injury in UUO mice were evaluated. A series of bioinformatics analyses were then conducted to explore the key genes and immune cells involved in the therapeutic mechanism of YQJPXY. Finally, in vivo and in vitro studies provided multifaceted evaluations of YQJPXY against RF from the perspectives of macrophage dynamics and roles of HIF1A.
Results
YQJPXY treatment significantly reduced levels of TGF‐β1 and IL‐6, attenuated tubular damage, decreased extracellular matrix protein (FN and Col‐I) expressions, and modulated fibrosis and epithelial‐mesenchymal transition markers in UUO mice in a dose‐dependent manner. Bioinformatics analysis identified HIF1A as the key target of YQJPXY against RF. In vivo, HIF1A deficiency lessened RF and recruitment of CD45+ CD11b+ and CD45+ F4/80+ macrophages in fibrotic kidneys. During treatment, YQJPXY inhibited HIF1A expression and reduced M1 macrophage polarization. In vitro experiments confirmed that YQJPXY suppresses hypoxia‐induced M1 macrophage polarization and HK‐2 cell transdifferentiation via downregulating HIF1A.
Conclusion
YQJPXY alleviates RF by attenuating HIF1A‐mediated M1 macrophage polarization, providing a potential therapeutic approach for CKD.
Keywords: bioinformatic analysis, HIF1A, macrophage polarization, renal fibrosis, Yi‐Qi‐Jian‐Pi‐Xiao‐Yu formula
Short abstract
A traditional Chinese medicine formula, Yi‐Qi‐Jian‐Pi‐Xiao‐Yu (YQJPXY), was found to significantly improve renal injury in a mouse unilateral ureteral obstruction model. Trough integrated bioinformatics analysis, this study identified HIF1A as a key target of YQJPXY against renal fibrosis (RF). Subsequent mechanistic investigations both in vivo and in vitro revealed that YQJPXY alleviates RF by attenuating HIF1A‐mediated M1 macrophage polarization, providing a potential therapeutic approach for chronic kidney disease.
1. Introduction
Chronic kidney disease (CKD) represents a worldwide health issue impacting over 800 million individuals worldwide, comprising more than 10% of the general population [1]. Renal fibrosis (RF) is a common pathology of CKD and a key factor in end‐stage renal failure that is mainly characterized by glomerulosclerosis and renal interstitial fibrosis [2]. The pathological process of renal interstitial fibrosis is complex and associated with the action of the extracellular matrix (ECM), epithelial‐mesenchymal transition (EMT), oxidative stress, and various cytokines [2]. Modern medicine has been somewhat successful in improving RF; however, its clinical effects remain unsatisfactory. Therefore, developing more effective drugs to treat RF is necessary.
Traditional Chinese medicine (TCM), recognized for its numerous active compounds, has demonstrated effectiveness in the prevention and treatment of RF. Examples of such TCMs include the Taohe‐Chengqi decoction [3], hirudin [4], and astragalus [5]. Compared with current Western medical practices that rely primarily on supportive and replacement therapies, TCM offers a promising alternative strategy for treating RF due to its advantages in multitarget, multipathway, and multieffect regulation [6]. A meta‐analysis indicated that combination therapy with TCM and Western medicine confers greater benefits in managing RF among patients with chronic kidney disease than Western medicine alone [7]. TCM can delay or reverse the RF phenotype by modulating relevant signaling pathways and molecular targets involved in apoptosis, endoplasmic reticulum stress, and epithelial‐mesenchymal transition [8].
The Yi‐Qi‐Jian‐Pi‐Xiao‐Yu (YQJPXY) formula was formulated for vital qi restoration, spleen fortification, thrombolysis, and alleviation of damp turbidity. This formula was further refined by including three medicinal herbs, Codonopsis pilosula , Poria cocos, and Atractylodes macrocephala Koidz., to augment the foundational composition of the Xiaoyu Xiezhuo Drink (XXD). XXD comprises Astragalus membranaceus, Cyathula officinalis Kuan, Persicae Semen, Lumbricus terrestris , Rheum palmatum L., and Plantago asiatica L. [9]. Animal studies have shown that the XXD formula attenuates renal damage and reduces α‐SMA and TGF‐β1 expression [9, 10, 11, 12]. Additionally, a study by Zhao et al. indicated that Poria exhibited protective properties against RF [13]. Our previous investigations also demonstrated that the YQJPXY formula ameliorates muscle atrophy in CKD rats and human subjects [14, 15]. However, there remains little knowledge of the effects of the YQJPXY formula on RF and its mechanisms.
Recent studies have underscored the critical role of macrophage polarization in the development of RF [16, 17]. Generally, polarized macrophages are categorized into two main types: the classically activated M1 and the alternatively activated M2. M1 macrophages can increase iNOS expression and release inflammatory factors, such as TNF‐α, resulting in inflammation, renal damage, and fibrosis [18, 19, 20]. Oppositely, M2 macrophages promote the expression of Arg‐1 and anti‐inflammatory factors, such as IL‐10, which contribute to renal tissue repair [18, 20]. Nonetheless, the roles of macrophages in the development of RF are dynamic and heavily count on the local microenvironment [21]. Therefore, it is necessary to further ascertain the mechanisms of macrophage polarization in RF under the conditions of YQJPXY intervention.
This study aimed to elucidate the therapeutic efficacy and underlying mechanisms of action of YQJPXY in combating RF. We employed an integrative methodology, amalgamating bioinformatics analyses with conventional experimental procedures, to comprehensively investigate the antifibrotic effects and intrinsic mechanisms of YQJPXY. Our study found that YQJPXY effectively ameliorates kidney injury and fibrosis in a mouse unilateral ureteral obstruction (UUO) model. This therapeutic efficacy is attributed to hypoxia‐inducible factor 1α (HIF1A/HIF‐1α) targeting, resulting in a reduction in macrophage recruitment and a shift toward the M1 phenotype. These findings present a promising approach for treating CKD‐associated RF.
2. Methods
2.1. Materials
The nine herbs of the QJPXY formula: C. pilosula (30 g), Poria cocos (15 g), Atractylodes macrocephala Koidz. (15 g), Astragalus membranaceus (30 g), Cyathula officinalis Kuan (12 g), Persicae Semen (12 g), L. terrestris (12 g), R. palmatum L. (10 g), and P. asiatica L. (20 g) were supplied by Hangzhou Huadong Pharmaceutical Co. Ltd. (Hangzhou, China). The TGF‐β1 ELISA kit was acquired from Nanjing SenBeiJia Biological Technology Co. Ltd. (China; SBJ‐M0669). The interleukin (IL)‐6 ELISA kit was procured from Mlbio (Shanghai, China; ml063159). Primary antibodies, including α‐SMA (ab124964), N‐cadherin (N‐cad, ab98952), E‐cadherin (E‐cad, ab40772), fibronectin (FN, ab268020), collagen I (Col‐I, ab270993), HIF‐1α (ab179483), CD11b (ab184308), and glyceraldehyde‐3‐phosphate dehydrogenase (ab245355), were purchased from Abcam (Cambridge, UK). Additionally, F4/80 (DF6839) and CD68 (DF7518) primary antibodies were purchased from Affinity (OH, USA). Arginase I (93668) and inducible nitric oxide synthase (iNOS, 13120) primary antibodies were obtained from Cell Signaling Technology (MA, USA). The primary antibody against CD45 (AG3024) was purchased from Beyotime (Shanghai, China).
2.2. Experimental Animals and Ethics Statement
C57BL/6J mice (6–8 weeks; 20–30 g) were acquired from the Experimental Animal Center of Yangzhou University (Yangzhou, China). HIF1A‐deficient (HIF1A−/−) mice with a C57BL/6J genetic lineage were obtained from Cyagen (Suzhou, China). All the mice were accommodated at 22°C with a 12‐h light/dark cycle and were allowed ad libitum access to food and water. All the animal experiments were approved by the Laboratory Animal Ethics Committee of Yangzhou University (No. 202308011), which were in line with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals.
2.3. High‐Performance Liquid Chromatography Analysis
As our previous study described [14], the YQJPXY formula was prepared and high‐performance liquid chromatography (HPLC) analysis was performed. Through HPLC analysis, 12 active ingredient compounds were identified, namely amygdalin (0.0166 mg/g), calycosin‐7‐O‐β‐D‐glucoside (0.09 mg/g), lobetyolin (0.0147 mg/g), calycosin (0.1021 mg/g), astragaloside IV (0.0043 mg/g), astragaloside III (0.0218 mg/g), formononetin (0.0543 mg/g), aloe emodin (0.0677 mg/g), atracylenolide III (0.0288 mg/g), emodin (0.0443 mg/g), chrysophanol (0.0118 mg/g), and physcion (0.014 mg/g) [14]. This suggested that the quality of the YQJPXY formula fulfilled the pharmacopeia standards, ensuring reliability and control for the following experiments.
2.4. Preparation of Serum Containing YQJPXY
Twelve C57BL/6J mice were randomly allocated into YQJPXY and blank groups (n = 6/group). In the YQJPXY group, the mice were orally administered the YQJPXY formula via gavage at a dose of 15 g/kg twice daily for 5 consecutive days. Each administration contained 1.5 mL of the YQJPXY formula. Meanwhile, the mice in the blank group received an equivalent volume of distilled water via oral gavage. One hour after final administration, the mice were anesthetized and blood was extracted from the abdominal aorta. The blood samples were incubated at 4°C for a 2‐h period before undergoing centrifugation (12,000 rpm, 20 min). Subsequently, the serum was isolated, subjected to heat inactivation (56°C, 30 min), filtered through a 0.22‐μm filter, and stored at −80°C for subsequent use.
2.5. Cell Culture and Treatment
HK‐2 cells (CL‐0109, Procell, Wuhan, China) were propagated in DMEM (supplied by Gibco, California, USA) enriched with 10% FBS. Similarly, THP‐1 cells (CL‐0233, Procell, Wuhan, China) were cultivated in RPMI‐1640 medium that was likewise supplemented with 10% FBS. Both types of cell lines were incubated in a humid environment (37°C, 5% CO2).
In a Transwell apparatus, HK‐2 cells were seeded into the bottom chamber at a density of 1 × 104 cells for each well. In contrast, THP‐1 cells were allocated to the upper compartment at a cell density of 1 × 105 cells per milliliter. To initiate the M0 macrophage state, the THP‐1 cells were treated with phorbol 12‐myristate 13‐acetate at a concentration of 100 ng/mL for a 48‐h period. Following this, the cells underwent further stimulation using 100 ng/mL of lipopolysaccharide and 10 ng/mL of interferon‐gamma (IFN‐γ) for another 48 h to achieve the M1 macrophage polarization. After forming a monolayer, the medium from the lower chamber containing the HK‐2 cells was aspirated and replaced with fresh medium. THP‐1 cells in the upper chamber and HK‐2 cells in the lower chamber were then co‐cultured at a cell ratio of approximately 1:10.
The lentiviral vector packaging for overexpressing HIF1A (oe‐HIF1A, GeneChem, Shanghai, China) was transfected into THP‐1 cells using the HighGene transfection reagent (ABclonal, Wuhan, China). The cells were then exposed to hypoxic conditions for 48 h in the presence of serum containing 20% YQJPXY. The evaluation of cell viability was conducted employing the cell counting kit 8 (Beyotime, Shanghai, China), in alignment with the protocols specified by the manufacturer.
2.6. Key Compounds and Targets of the YQJPXY Formula Against RF
Gene targets implicated in RF were systematically identified using GeneCards [22], DisGeNET [23], and DigSee [24]. A comprehensive list of 899 RF‐associated genes was obtained after removing duplicates. Concurrently, active compounds in the YQJPXY formula were identified through the TCMSP [25], TCMID [26], and HIT [27] databases, yielding 503 unique active compounds with valid PubChem IDs.
Using the PubChem IDs of these active compounds, the targets of the active compounds were identified from the HIT database. Furthermore, only the targets corresponding to the active compounds that met the criterion of “the quantitative estimate of drug‐likeness (QED) value > 0.2” (calculated using Python's RDKit module) were selected.
Transcriptomic expression profile data for RF, specifically dataset GSE76882, were acquired from the GEO database. This dataset comprised 135 RF samples and 99 normal samples. Differential gene expression analyses were conducted using the limma package [28] and differentially expressed genes (DEGs) were defined at p value < 0.05 and |logFC| > 0.5. The potential targets of the YQJPXY formula against RF were determined by intersecting the identified DEGs, RF‐associated genes, and YQJPXY target genes.
2.7. Molecular Docking Analysis
The three‐dimensional structure of HIF1A was procured from the RCSB PDB. The SDF structure for the main compounds of YQJPXY (Calycosin: CID:5280448; Emodin: CID:3220) was obtained from PubChem. Both files were converted to the PDBQT format using OpenBabel GUI software. AutoDock software (Version 1.5.6) facilitated the optimization of the HIF1A protein using procedures including removal of the original ligand, dehydration, hydrogen addition, amino acid optimization, and charge calculation [29]. The localization of the docking binding pocket was based on the position of the original ligand in the protein receptor. Finally, the outcomes of the molecular docking experiments were rendered visible through the utilization of PyMOL software.
2.8. UUO Mouse Model Construction
Left kidney UUO mouse models were used as previously described by Liu et al. [30]. Isoflurane inhalation was used to anesthetize the C57BL/6J mice and HIF1A−/− mice with a C57BL/6J genetic lineage, after which the proximal segment of the left ureter was revealed and securely tied using 6‐0 silk stitching. Surgical operations for sham mice were the same as those for model mice, except that the ureter was not ligated.
For the YQJPXY treatment, C57BL/6J mice were randomly divided into five groups (n = 6): sham, model, low‐dose YQJPXY formula (5 g/kg/d), middle‐dose YQJPXY formula (10 g/kg/d), and high‐dose YQJPXY formula (15 g/kg/d). The oral gavage dose of YQJPXY in mice was calculated based on the adult human dose using the body surface area method (Meeh‐Rubner formula). After 14 days of continuous administration of YQJPXY via oral gavage, the mice were anesthetized using an intraperitoneal injection of sodium pentobarbital (50 mg/kg). Subsequently, euthanasia was carried out on mice using cervical dislocation.
2.9. Intrarenal Injection
Following previously reported methods, an intrarenal injection was employed to deliver the lentiviral vector for oe‐HIF1A into the kidneys of experimental mice [31]. Briefly, a precise volume of 100 μL of purified oe‐HIF1A (2 × 108 TU/mL) was carefully administered into the left kidney. An equivalent volume of the negative control lentivirus was injected. Anesthesia was induced in the mice using pentobarbital, preparing the animals for exposure of their left kidney. A 25‐mL syringe connected to a 1‐G needle was used to carefully extract the purified lentivirus. The needle was inserted along the longitudinal axis of the kidney and gently advanced to a depth of approximately 0.5 cm from the upper pole while avoiding the renal vein, artery, and ureter. Subsequently, the needle was slowly withdrawn while simultaneously infusing lentivirus. Postinjection blanching of the kidney signified the success of the procedure. After a brief pause of 2–3 s, the needle was carefully removed.
An RF model was established one week after injection, and the mice were subjected to 14 days of continuous oral gavage treatment with YQJPXY at a dose of 15 g/kg/d.
2.10. ELISA
The levels of TGF‐β1 and the inflammation indicator IL‐6 in mouse serum were detected using ELISA kits.
2.11. Histological Observation
As previously reported [32, 33], renal tissue sections (4 μm) embedded in paraffin were stained with hematoxylin–eosin (HE), periodic acid–Schiff (PAS), and Masson's trichrome. Histological images were obtained using a microscope (Olympus, Japan).
2.12. Transmission Electron Microscopy
Renal cortical slices were prefixed in 2.5% glutaraldehyde and 1% osmotic acid. They were then dehydrated with an acetone gradient (50%–100%) and embedded in Epon 812. The ultrathin sections were treated with uranium acetate and lead citrate for staining purposes. The images were captured using a transmission electron microscopy (TEM) microscope (Philips, the Netherlands).
2.13. TUNEL Assay
TUNEL assay was conducted to assess tubulointerstitial cell apoptosis in renal tissues obtained from murine models. Following conventional deparaffinization and rehydration processes, the kidney tissue sections underwent enzymatic treatment with proteinase K at a controlled temperature of 37°C for 30 min. Subsequently, the sections were exposed to a specially formulated TUNEL reaction mixture and incubated at 37°C for 60 min in the dark. This was followed by a brief 5‐min incubation with DAPI to stain the cell nuclei. To preserve the fluorescent signals, the tissue sections were meticulously sealed with an antifade fluorescence‐mounting medium. Fluorescence microscopy of high resolution was executed utilizing a microscope (Olympus).
2.14. Immunohistochemistry and Immunofluorescence
The procedures for immunohistochemistry and immunofluorescence were carried out in accordance with previously established protocols [3]. For immunohistochemistry, primary antibodies against α‐SMA (1:200), N‐cad (1:80,000), E‐cad (1:80,000), F4/80 (1:100), arginase I (1:150), and iNOS (1:1000) were used. For the immunofluorescence assay, primary antibodies against CD68 (1:100), CD11b (1:500), CD45 (1:50), F4/80 (1:100), arginase I (1:200), and iNOS (1:200) were used.
2.15. Quantitative Real‐Time Polymerase Chain Reaction and Western Blot Assays
The expression levels of mRNA and protein for particular genes were assessed through quantitative real‐time polymerase chain reaction (qRT‐PCR) and western blotting, following an established method previously documented [34]. PCR primers used for qRT‐PCR are listed in Table 1. Primary antibodies including anti‐HIF‐1α (1:1000), anti‐FN (1:1000), anti‐Col‐I (1:1000), anti‐α‐SMA (1:10,000), anti‐MMP‐9 (1:1000), anti‐c‐Jun (1:1000), anti‐VEGF (1:1000), anti‐ICAM‐1 (1:1000), anti‐IL‐1β (1:1000), anti‐CAT (1:1000), anti‐CCL2 (1:1000), anti‐PKC (1:1000), anti‐ACE (1:1000), anti‐CXCR4 (1:1000), anti‐EGR‐1 (1:1000), anti‐SOD2 (1:1000), anti‐TLR2 (1:1000), anti‐UCP2 (1:1000), and glyceraldehyde‐3‐phosphate dehydrogenase (1:2000) were used for western blot assay.
TABLE 1.
Primers used for qRT‐PCR.
| Gene | Sequence (5′‐3′) |
|---|---|
| IL‐10 | F: AGCTGAGAACCAAGACCCAG |
| R: AAGAAATCGATGACAGCGCC | |
| TNF‐α | F: GTGACAAGCCTGTAGCCCAT |
| R: CAGACTCGGCAAAGTCGAGA | |
| Arginase‐I | F: ACTTAAAGAACAAGAGTGTGATGTG |
| R: GTCCACGTCTCTCAAGCCAA | |
| iNOS | F: TCCAAGGTATCCTGGAGCGA |
| R: CAGGGACGGGAACTCCTCTA | |
| GAPDH | F: GTCAAGGCTGAGAACGGGAA |
| R: AAATGAGCCCCAGCCTTCTC |
2.16. Statistical Analysis
The data (mean ± standard deviation) were subjected to analysis utilizing GraphPad Prism 8.0 software. For contrasting two groups, an unpaired t‐test was employed, whereas the analysis of variance in conjunction with Tukey's test was used for the evaluation of multiple groups. A p value less than 0.05 indicates statistical significance.
3. Results
3.1. YQJPXY Formula Suppresses RF in UUO Mice
To verify whether YQJPXY alleviates RF, we constructed a UUO‐induced RF mouse model. ELISA results showed that, compared with sham mice, the levels of a fibrosis‐related factor (TGF‐β1) and inflammation indicator (IL‐6) in UUO mice increased by approximately 340% (p < 0.01) and 371% (p < 0.01), respectively, which were dose‐dependently decreased by the YQJPXY treatment (Figure 1A). HE and PAS staining showed that YQJPXY treatment dose‐dependently reduced renal damage. This included reduced atrophy of the tubular epithelium, dilatation of the tubular lumen, inflammatory infiltration, and thickening of the tubular basement membrane. Similarly, Masson's trichrome staining revealed that the UUO mice group had a large distribution of collagen fibers, which was improved by the administration of YQJPXY (Figure 1B). Moreover, TEM revealed necrosis of the mesangial cells, glomerular wall podocyte depletion, glomerular basement membrane thickening, and sclerosis in UUO mice. YQJPXY treatment decreased renal thylakoid cell necrosis and increased the number of podocytes (Figure 1C). Additionally, we examined the expression of molecular markers for RF and EMT, including α‐SMA as a marker for myofibroblasts and two cadherin family members, N‐cad and E‐cad. N‐cad is often upregulated during EMT and is associated with increased cell mobility and tissue fibrosis. E‐cad is vital for maintaining epithelial integrity and is generally downregulated during EMT, leading to cellular detachment and fibrosis. As shown in Figure 1D, UUO mice had increased α‐SMA and N‐cad levels and decreased E‐cad levels. After treatment with a high dose of YQJPXY, α‐SMA and N‐cadherin levels decreased by 83% and 74%, respectively, while E‐cadherin levels increased by 2500% (p < 0.01). Similarly, western blotting indicated that the levels of FN and Col‐I (key components of the ECM) were elevated in the model group (FN: 3.26‐fold increase; Col‐I: 3.28‐fold increase; p < 0.01) compared to the sham group (Figure 1E). This upregulation was attenuated by YQJPXY treatment, suggesting its potential role in mitigating RF.
FIGURE 1.

The Yi‐Qi‐Jian‐Pi‐Xiao‐Yu (YQJPXY) formula suppresses renal fibrosis (RF) in unilateral ureteral obstruction (UUO) mice. (A) The levels of transforming growth factor β1 (TGF‐β1) and interleukin‐6 (IL‐6) in mouse serum were detected using ELISA. (B) Representative images of hematoxylin–eosin (HE), periodic acid‐Schiff (PAS), and Masson's trichrome staining. Scale bar: 20 μm. HE images: Yellow arrows denote tubular epithelium atrophy; black arrows denote tubular lumen dilatation; PAS images: Red arrows denote renal interstitial edema; black arrows denote tubular lumen dilatation; Masson images: Black arrows denote collagen fibers. (C) Representative images of transmission electron microscopy (TEM). Scale bar: 2 μm. (D) Expression of α‐smooth muscle actin (α‐SMA), N‐cadherin (N‐cad), and E‐cadherin (E‐cad) was detected using immunohistochemistry. Scale bar: 20 μm. (E) Expression of hypoxia‐inducible factor (HIF)‐1α, fibronectin (FN), and collagen I (Col‐I) was detected using western blotting. **p < 0.01.
3.2. Key Targets of the YQJPXY Formula Against RF
After confirming the effectiveness of YQJPXY in treating RF, we conducted a bioinformatics analysis of YQJPXY to identify its candidate targets associated with RF progression. The intersection of three datasets (including 1595 DEGs, 899 RF‐associated genes, and 859 YQJPXY formula target genes) revealed 51 overlapping genes (Figure 2A). The herb‐compound‐target network constructed using Cytoscape further highlighted 15 key genes (Figure 2B). Among these genes, HIF1A exhibited the highest expression levels across all samples, highlighting its significance in renal lesions (Figure 2C). Subsequent expression validation of these 15 key genes was performed. Consistent with the predictions, protein levels of HIF‐1α, MMP‐9, c‐Jun, CCL2, and PKC were significantly upregulated in UUO model mice compared with the sham group, with HIF‐1α showing the most pronounced increase by 214% (Figure S1). Molecular docking analysis further revealed strong interactions between HIF1A and two key active components of YQJPXY, Calycosin and Emodin, with binding energies of −6.5 kcal/mol and −6.2 kcal/mol, respectively (Figure 2D). These results indicate that HIF1A may serve as the foremost target of the YQJPXY formula against RF, and thus, it was further analyzed both in vivo and in vitro. Additionally, analysis of the immune landscape revealed significant different infiltration abundance of seven immune cell types between RF and normal samples, with key macrophage subtypes (M1 and M2) showing markedly elevated infiltration in RF (Figure 2E).
FIGURE 2.

Key targets of the YQJPXY formula against RF. (A) Venn diagram showing the intersection of differentially expressed genes (DEGs), RF‐associated genes, and YQJPXY formula target genes. (B) Herb‐compound‐target network constructed using Cytoscape software. (C) Elevated expression levels of HIF1A in RF. (D) Molecular docking analysis showing binding affinity of key active components of YQJPXY (Calycosin and Emodin) to HIF1A. (E) Elevated infiltration of macrophage subtypes (M1 and M2) in RF. *p < 0.05, ***p < 0.001.
3.3. HIF1A Deficiency Attenuates RF and Reduces Macrophage Recruitment
Immune cell infiltration facilitates RF progression [35]. Our bioinformatic analyses also suggested a correlation between RF and macrophage infiltration. Combining immune cell infiltration results with prior research, we hypothesize that RF progression may be associated with the expression of HIF1A and macrophage recruitment. Therefore, we studied HIF‐1α expression and immune cell infiltration in mouse kidney tissues 3, 7, and 14 days after UUO surgery. Western blotting indicated that the expression of HIF‐1α, FN, and Col‐I was increased in correlation with time (Figure 3A). HE staining revealed a time‐dependent increase in immune cell infiltration in UUO mice compared with sham controls (Figure 3B). Immunofluorescence analysis revealed a corresponding increase in CD68+ macrophages on days 3 (66% increase, p < 0.05), 7 (140% increase, p < 0.01), and 14 (316% increase, p < 0.01) post‐UUO (Figure 3C). Concurrently, a substantial accumulation of F4/80+ macrophages (UUO‐14 d vs. sham: 10.48‐fold increase, p < 0.01) was observed in fibrotic kidneys (Figure 3D). Furthermore, the expression of arginase I (an M2 macrophage marker) and iNOS (an M1 macrophage marker) in UUO mice (14 d) increased markedly by 2025% and 1022% (p < 0.01), respectively, compared with sham mice (Figure 3D). These findings substantiate our hypothesis and highlight the role of HIF1A expression and macrophage recruitment in the progression of RF.
FIGURE 3.

Time‐course analysis of RF progression in UUO mice. (A) Expression of HIF‐1α, FN, and Col‐I was detected using western blotting. (B) HE staining at days 3, 7, and 14 post‐UUO. Scale bar: 20 μm. Yellow arrows denote tubular epithelium atrophy; black arrows denote tubular lumen dilatation. (C) Immunofluorescence staining of CD68 at 3, 7, and 14 days after UUO. Scale bar: 20 μm. (D) Expression of F4/80, arginase I, and iNOS at days 3, 7, and 14 post‐UUO was detected using immunohistochemistry. Scale bar: 20 μm. *p < 0.05, **p < 0.01.
To observe the effects of HIF1A on the progression of RF following UUO, we evaluated the extent of renal fibrotic changes in HIF1A wild‐type (WT) and knockout (HIF1A−/−) mice subjected to UUO for 14 days. Histological examination revealed a conspicuous absence of immune cell infiltration and renal inflammation in sham mice. In contrast, mice subjected to UUO exhibited a pronounced tubulointerstitial damage accompanied by robust immune cell infiltration; this pathological feature was attenuated in HIF1A knockout counterparts (Figure 4A). Masson's trichrome staining confirmed the absence of collagen fiber deposition in sham kidneys. A marked accumulation of collagen fibers was observed in WT mice subjected to UUO, which was mitigated in HIF1A‐deficient mice (Figure 4A). As shown in Figure 4B, UUO led to a substantial upregulation of α‐SMA (8.87‐fold increase, p < 0.05) in the renal tissue of WT mice. However, this increase was mitigated in mice with HIF1A knockout (2.02‐fold change, p < 0.01). Furthermore, levels of FN and Col‐I in fibrotic kidneys of HIF1A−/− mice decreased by 35% and 41% (p < 0.01), respectively (Figure 4C). These data suggest that the absence of HIF1A lessens RF in fibrotic kidneys.
FIGURE 4.

HIF1A deficiency attenuates RF and modulates immune cell infiltration. (A) Representative images of HE and Masson's trichrome staining in wild‐type (WT) and HIF1A−/− mice. HE images: Yellow arrows denote tubular epithelium atrophy; black arrows denote tubular lumen dilatation; Masson images: Black arrows denote collagen fibers. Scale bar: 20 μm. (B) Immunohistochemistry showing the expression of α‐SMA. Scale bar: 20 μm. (C) Western blot results for FN and Col‐I expression. (D–E) Immunofluorescence results showing macrophage recruitment (CD45+CD11b+ and CD45+F4/80+ expression) in fibrotic kidneys. Scale bar: 20 μm. *p < 0.05, **p < 0.01.
Additionally, to elucidate the role of HIF1A in reducing macrophage recruitment, immunofluorescence assays were conducted using specific antibodies targeting CD45, CD11b, and F4/80 on kidney tissues of WT and HIF1A−/− mice at 14 days post‐UUO. In WT mice kidneys, the numbers of CD45+CD11b+ and CD45+F4/80+ cells markedly increased (Figure 4D–E). This increase was attenuated in the kidneys of HIF1A‐deficient mice (Figure 4D–E). These observations strongly suggest that HIF1A reduces the recruitment of CD45+CD11b+ and CD45+F4/80+ macrophages in fibrotic kidneys.
3.4. YQJPXY Formula Reduces M1 Macrophage Polarization by Targeting HIF1A in the Kidneys of UUO Mice
Furthermore, we studied the effect of YQJPXY administration on HIF1A expression and macrophage recruitment in UUO mice kidneys. As illustrated in Figure 5A, treatment with the YQJPXY formula significantly inhibited the expression of HIF‐1α (3.29‐fold decrease, p < 0.01), FN (1.54‐fold decrease, p < 0.01), and Col‐I (1.42‐fold decrease, p < 0.01) in the kidneys of UUO mice. Overexpression of HIF1A hindered these reductions and led to respective 2.8‐, 1.28‐, and 1.19‐fold increases of HIF‐1α, FN, and Col‐I in the kidneys of UUO mice. Furthermore, administration of YQJPXY markedly attenuated macrophage infiltration in UUO mice, as evidenced by a reduction in immune cell infiltration and downregulation of CD68+ (1.68‐fold decrease, p < 0.01) and F4/80+ cells (2.23‐fold decrease, p < 0.01) in the fibrotic kidneys of UUO mice (Figure 5B–D). The addition of oe‐HIF1A significantly ameliorated these effects in the fibrotic kidneys of UUO mice (Figure 5B–D). The overexpression of HIF1A diminished the YQJPXY‐induced changes of these markers, resulting in a 1.30‐fold decrease of arginase I expression (p < 0.05), 1.44‐fold increase of iNOS expression (p < 0.01), and 1.83‐fold increase of apoptosis rate (p < 0.01) in UUO mouse kidneys (Figure 5D–E). These findings substantiate that the YQJPXY formula alleviates immune cell infiltration and reduces M1 macrophage polarization in the kidneys of UUO mice by downregulating HIF1A expression.
FIGURE 5.

YQJPXY mitigates immune cell infiltration and inhibits M1 macrophage polarization by downregulating HIF1A in the kidneys of UUO mice. (A) Expression of HIF‐1α, FN, and Col‐I was detected using western blotting. (B) Representative images of HE. Scale bar: 20 μm. Yellow arrows denote tubular epithelium atrophy; black arrows denote tubular lumen dilatation. (C) CD68 expression was measured using an immunofluorescence assay. Scale bar: 20 μm. (D) Expression of F4/80, arginase I, and inducible nitric oxide synthase (iNOS) was detected using immunohistochemistry. Scale bar: 20 μm. (E) Cell apoptosis was detected using TUNEL assay. Scale bar: 20 μm. *p < 0.05, **p < 0.01.
3.5. YQJPXY Inhibits M1 Macrophage Polarization and HK‐2 Cell Transdifferentiation Through Downregulation of HIF1A
To further validate the effect of YQJPXY on RF, we conducted in vitro experiments. The elevation of hypoxia‐induced HIF‐1α, TNF‐α, and iNOS expression levels was mitigated by adding the YQJPXY formula (HIF‐1α: 3.06‐fold decrease; TNF‐α: 2.99‐fold decrease; iNOS: 2.74‐fold decrease; p < 0.01). The overexpression of HIF1A reversed these effects (Figure 6A–B). However, the expression levels of IL‐10 and Arg‐1 did not differ significantly between the various groups of lipopolysaccharide/IFN‐γ‐induced THP‐1 cells. (Figure 6B). These results indicate that YQJPXY can suppress hypoxia‐induced M1 macrophage polarization by downregulating HIF1A. Additionally, when THP‐1 cells stimulated with IFN‐γ and lipopolysaccharides were co‐cultured with HK‐2 cells under hypoxic conditions, the viability of HK‐2 cells was significantly reduced (1.74‐fold decrease, p < 0.01), an effect that was reversed upon YQJPXY treatment (1.52‐fold increase, p < 0.01). However, oe‐HIF1A transfection significantly reversed the promoting effect of the YQJPXY formula on HK‐2 cell viability (Figure 6C). Furthermore, the elevation of hypoxia‐induced HIF‐1α (3.88‐fold increase, p < 0.01), α‐SMA (3.21‐fold increase, p < 0.01), FN (3.90‐fold increase, p < 0.01), and Col‐I (2.43‐fold increase, p < 0.01) expression levels were attenuated upon the addition of the YQJPXY formula. These changes in protein expression were mitigated after the transfection of oe‐HIF1A (Figure 6D). These findings suggest that the YQJPXY formula inhibits hypoxia‐induced HK‐2 cell transdifferentiation by downregulating HIF1A.
FIGURE 6.

YQJPXY inhibits M1 macrophage polarization and HK‐2 cell transdifferentiation by downregulating HIF1A. (A) Influence of the YQJPXY formula on hypoxia‐induced HIF‐1α levels. (B) Expression of tumor necrosis factor‐alpha (TNF‐α), iNOS, IL‐10, and arginase I in lipopolysaccharide/IFN‐γ‐induced THP‐1 cells and their modulation by HIF1A. (C) Impact of YQJPXY formula and oe‐HIF1A transfection on HK‐2 cell viability when co‐cultured with THP‐1 cells stimulated with interferon‐gamma (IFN‐γ) and lipopolysaccharide (LPS) under hypoxic conditions. (D) Alterations in protein expression levels (α‐SMA, FN, and Col‐I) of HK‐2 cells under hypoxic conditions and their response to YQJPXY and oe‐HIF1A transfection. **p < 0.01.
4. Discussion
RF is the ultimate pathological manifestation of CKD, and RF inhibition is a new therapeutic strategy for CKD treatment. In this study, we addressed this problem using the YQJPXY formula, which has significantly slowed the progression of RF. Specifically, the YQJPXY formula downregulated HIF1A expression, decreasing macrophage recruitment and polarization toward the M1 phenotype.
YQJPXY is an optimized formulation derived from XXD, previously demonstrated to possess antifibrotic effects in the kidneys. However, the effect of the YQJPXY formula on RF remains largely unexplored. YQJPXY is a complex TCM formula designed to offer a multitargeted therapeutic intervention through its active constituents. In a previous study, 12 major active components were identified in the YQJPXY formula, including amygdalin, calycosin‐7‐O‐β‐D‐glucoside, lobetyolin, calycosin, astragaloside IV, astragaloside III, formononetin, aloe emodin, atracylenolide III, emodin, chrysophanol, and physcion [14]. Among these, amygdalin, calycosin, astragaloside IV, formononetin, aloe emodin, emodin, and chrysophanol have been shown to inhibit RF [36, 37, 38, 39, 40, 41, 42]. In the present study, our preliminary findings, based on network pharmacology and molecular docking, revealed HIF1A as a critical target for the YQJPXY formula in mitigating RF. Additionally, existing studies have demonstrated that calycosin, formononetin, aloe emodin, and emodin can downregulate the expression of HIF1A [43, 44, 45, 46]. Therefore, these active components may be the key medicinal components of YQJPXY against RF.
Hypoxic injury is a common pathway in CKD and an initial factor in RF [47]. HIF1A is well‐recognized as a primary modulator of cellular adaptation to hypoxia and plays a critical role in tissue fibrosis [48, 49, 50]. During renal injury, HIF1A can drive pro‐fibrotic signaling by regulating EMT and ECM deposition in response to hypoxia [51, 52]. Here, we observed that HIF‐1α expression was elevated in UUO mice compared with sham mice, and HIF1A−/−‐UUO mice showed milder renal injury and fibrosis relative to their WT counterparts. These findings were in line with previous studies [53, 54, 55], thereby substantiating the hypothesis that targeting HIF1A might offer a viable therapeutic strategy for mitigating RF. Furthermore, a recent study has revealed that HIF1A knockdown could reduce the sensibility of RF in diabetic mice, suggesting the beneficial effects of HIF‐1α inhibitor in the progression of RF [55]. Another study has reported that HIF1A upregulation induced by hypoxia can cause cell cycle rest and then activate the TGF‐β signaling pathway, resulting in ECM production and RF [56]. Consistently, we found that the YQJPXY formula markedly reduced HIF‐1α protein expression within fibrotic renal tissues, and its therapeutic effect on RF was abolished by HIF1A overexpression. Collectively, these findings demonstrate that the YQJPXY formula can alleviate RF by suppressing HIF1A expression.
Our immune cell infiltration analyses suggest that the therapeutic effect of YQJPXY on RF may be mediated, at least in part, through the modulation of macrophage recruitment. Macrophages are crucial regulators of both inflammatory and fibrotic responses and display diverse phenotypes and functions that adapt to local tissue conditions [57, 58, 59]. Specifically, M1‐type macrophages exacerbate local inflammatory reactions by secreting pro‐inflammatory cytokines (TNF‐α and IL‐6). These cytokines facilitate fibrosis by hindering the breakdown of fibrinogen via suppression of matrix metalloproteinases [16]. In contrast, M2‐type macrophages ameliorate inflammatory responses and promote fibrosis by secreting anti‐inflammatory cytokines (IL‐10 and TGF‐β) [60]. In the current study, YQJPXY led to a notable downregulation of markers indicative of macrophages and M1 polarization, including CD68, F4/80, and iNOS. This reduced macrophage recruitment and M1‐type macrophage polarization. Inhibition of histone deacetylase 8 ameliorates peritoneal fibrosis by suppressing the fibrotic pathway downstream of HIF1A and M2 macrophage polarization [61]. Furthermore, Jia et al. showed that albuminuria exacerbates RF in patients with diabetic nephropathy by promoting HIF‐1α‐induced glycolysis in renal macrophages [62]. Contrary to these findings, our study reveals that HIF1A mitigates RF by inhibiting the recruitment of macrophages and the polarization toward the M1 phenotype. This is substantiated by diminished fluorescent signals for CD45+CD11b+ and CD45+F4/80+ cells, alongside downregulated expression levels of α‐SMA, FN, and Col‐I in HIF1A‐deficient UUO mice. Furthermore, the downregulation of iNOS expression under hypoxic conditions corroborates these observations.
However, several limitations of this study should be acknowledged. First, although the UUO model effectively captures fibrotic responses, it does not fully recapitulate the pathophysiological processes of RF in humans. Second, the specific roles of key bioactive compounds within the YQJPXY formula in the treatment of RF remain to be elucidated. Future investigations should focus on obtaining key clinical evidence and further exploring the multitarget and multipathway synergistic mechanisms of the YQJPXY formula against RF.
To conclude, this study demonstrated that the YQJPXY formula ameliorated RF by inhibiting the polarization of M1 macrophages, mediated through the downregulation of HIF1A (Figure 7). Given the therapeutic potential of YQJPXY in mitigating CKD, these findings offer a substantive foundation for further clinical trials, emphasizing its potential clinical utility in CKD treatment.
FIGURE 7.

Graphical representation of the mechanism of action of the YQJPXY formula in the attenuation of RF by inhibiting HIF1A‐mediated M1 macrophage polarization.
Funding
This work was supported by the Modernization Special Project of Zhejiang Province Traditional Chinese Medicine Science and Technology (2021ZX007) and the Zhejiang Province Science and Technology Plan of Traditional Chinese Medicine in 2020 (2020ZZ008).
Ethics Statement
The protocols for all animal studies were approved by the Animal Ethics Committee of Yangzhou University (202308011).
Supporting information
Figure S1: Expression validation of 15 key targets in UUO model mice.
Acknowledgments
We are grateful to Yangzhou University for providing supervision of animal experiments.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- 1. Kovesdy C. P., “Epidemiology of Chronic Kidney Disease: An Update 2022,” Kidney International. Supplement 12 (2022): 7–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Li Y., Ricardo S. D., and Samuel C. S., “Enhancing the Therapeutic Potential of Mesenchymal Stromal Cell‐Based Therapies With an Anti‐Fibrotic Agent for the Treatment of Chronic Kidney Disease,” International Journal of Molecular Sciences 23 (2022): 6035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Zhou S., Ai Z., Li W., et al., “Deciphering the Pharmacological Mechanisms of Taohe‐Chengqi Decoction Extract Against Renal Fibrosis Through Integrating Network Pharmacology and Experimental Validation In Vitro and In Vivo,” Frontiers in Pharmacology 11 (2020): 425–425. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Xie Y., Lan F., Zhao J., and Shi W. J. I., “Hirudin Improves Renal Interstitial Fibrosis by Reducing Renal Tubule Injury and Inflammation in Unilateral Ureteral Obstruction (UUO) Mice,” International Immunopharmacology 81 (2020): 106249. [DOI] [PubMed] [Google Scholar]
- 5. Shan G., Zhou X. J., Xia Y., and Qian H. J., “Astragalus Membranaceus Ameliorates Renal Interstitial Fibrosis by Inhibiting Tubular Epithelial‐Mesenchymal Transition In Vivo and In Vitro,” Experimental and Therapeutic Medicine 11 (2016): 1611–1616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Yang Y., Zhao L., Gao F., Wu G., Luo Y., and An M., “Modulation of Renal Fibrosis‐Related Signaling Pathways by Traditional Chinese Medicine: Molecular Mechanisms and Experimental Evidence,” International Urology and Nephrology 57 (2025): 3263–3286. [DOI] [PubMed] [Google Scholar]
- 7. Xin L., Jing X., Li H., Wenfan G., and Ming C., “Efficacy and Safety of Activating Blood Circulation and Removing Blood Stasis of Traditional Chinese Medicine for Managing Renal Fibrosis in Patients With Chronic Kidney Disease: A Systematic Review and Meta‐Analysis,” Journal of Traditional Chinese Medicine 43 (2023): 429–440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Song L., Zhang W., Tang S. Y., et al., “Natural Products in Traditional Chinese Medicine: Molecular Mechanisms and Therapeutic Targets of Renal Fibrosis and State‐of‐the‐Art Drug Delivery Systems,” Biomedicine & Pharmacotherapy 170 (2024): 116039. [DOI] [PubMed] [Google Scholar]
- 9. Ye Q., Chen H., Ma H., et al., “Xiaoyu Xiezhuo Drink Protects Against Ischemia‐Reperfusion Acute Kidney Injury in Aged Mice Through Inhibiting the TGF‐β1/Smad3 and HIF1 Signaling Pathways,” BioMed Research International 2021 (2021): 9963732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Lu K., Xie Z., Ma H., He L., and Li X., “Effects of Xiaoyu Xiezhuo Yin on the Expression of TGF‐β1 of Renal Tissue in Rat With UUO,” Chinese Traditional and Western Medicine Nephrosis Miscellaneous 12 (2022): 665–668+753. [Google Scholar]
- 11. Lu K., Zhang B., Xie Z., Ma H., He L., and Li X., “The Protective Effect of Xiaoyu Xiezhuo Yin on Kidney of Renal Interstitial Fibrosis Rats,” Chinese Archives of Traditional Chinese Medicine 29 (2011): 1537–1540. [Google Scholar]
- 12. Xiang X., Zhang P., Ye Q., Xu Y., and Chen H., “Study on Effect of Xiaoyu Xiezhuo Decoction in Preventing and Treating Renal Fibrosis in Diabetic Nephropathy Mice,” Chinese Journal of Modern Applied Pharmacy 39 (2022): 442–449. [Google Scholar]
- 13. Zhao Y. Y., Feng Y. L., Bai X., Tan X. J., Lin R. C., and Mei Q., “Ultra Performance Liquid Chromatography‐Based Metabonomic Study of Therapeutic Effect of the Surface Layer of Poria cocos on Adenine‐Induced Chronic Kidney Disease Provides New Insight Into Anti‐Fibrosis Mechanism,” PLoS ONE 8 (2013): e59617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Xia H., Zhang B., Yang D., et al., “Yi‐Qi‐Jian‐Pi‐Xiao‐Yu‐Xie‐Zhuo Formula Improves Muscle Atrophy via Modulating the IGF‐1/PI3K/Akt Signaling Pathway in 5/6 Nephrectomized Rats,” Frontiers in Pharmacology 12 (2021): 624303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Zheng L., Xia H., Zhang P., et al., “The Ameliorative Effects of the Yi–Qi–Jian–Pi–Xiao–Yu Formula on Protein‐Energy Wasting Status in Patients With Chronic Kidney Disease,” Zhejiang Clinical Medical Journal 24 (2022): 1765–1768. [Google Scholar]
- 16. Wu Q., Sun S., Wei L., et al., “Twist1 Regulates Macrophage Plasticity to Promote Renal Fibrosis Through Galectin‐3,” Cellular and Molecular Life Sciences: CMLS 79 (2022): 137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Hao X., Luan J., Jiao C., et al., “LNA‐Anti‐miR‐150 Alleviates Renal Interstitial Fibrosis by Reducing Pro‐Inflammatory M1/M2 Macrophage Polarization,” Frontiers in Immunology 13 (2022): 913007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Engel J. E. and Chade A. R., “Macrophage Polarization in Chronic Kidney Disease: A Balancing Act Between Renal Recovery and Decline?,” American Journal of Physiology Renal Physiology 317 (2019): F1409–f1413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Lu Y., Yang L., Chen X., Liu J., Nie A., and Chen X., “Bone Marrow Mesenchymal Stem Cell‐Derived Exosomes Improve Renal Fibrosis by Reducing the Polarisation of M1 and M2 Macrophages Through the Activation of EP2 Receptors,” IET Nanobiotechnology 16 (2022): 14–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Xie F., Lei J., Ran M., et al., “Attenuation of Diabetic Nephropathy in Diabetic Mice by Fasudil Through Regulation of Macrophage Polarization,” Journal of Diabetes Research 2020 (2020): 4126913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Wang X., Chen J., Xu J., Xie J., Harris D. C. H., and Zheng G., “The Role of Macrophages in Kidney Fibrosis,” Frontiers in Physiology 12 (2021): 705838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Safran M., Dalah I., Alexander J., et al., “GeneCards Version 3: The Human Gene Integrator,” Database: The Journal of Biological Databases and Curation 2010 (2010): baq020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Piñero J., Bravo À., Queralt‐Rosinach N., et al., “DisGeNET: A Comprehensive Platform Integrating Information on Human Disease‐Associated Genes and Variants,” Nucleic Acids Research 45 (2017): D833–d839. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Kim J., So S., Lee H. J., Park J. C., Kim J. J., and Lee H., “DigSee: Disease Gene Search Engine With Evidence Sentences (Version Cancer),” Nucleic Acids Research 41 (2013): W510–W517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Ru J., Li P., Wang J., et al., “TCMSP: A Database of Systems Pharmacology for Drug Discovery From Herbal Medicines,” Journal of Cheminformatics 6 (2014): 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Huang L., Xie D., Yu Y., et al., “TCMID 2.0: A Comprehensive Resource for TCM,” Nucleic Acids Research 46 (2018): D1117–d1120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Ye H., Ye L., Kang H., et al., “HIT: Linking Herbal Active Ingredients to Targets,” Nucleic Acids Research 39 (2011): D1055–D1059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Ritchie M. E., Phipson B., Wu D., et al., “limma Powers Differential Expression Analyses for RNA‐Sequencing and Microarray Studies,” Nucleic Acids Research 43 (2015): e47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Seeliger D. and de Groot B. L., “Ligand Docking and Binding Site Analysis With PyMOL and Autodock/Vina,” Journal of Computer‐Aided Molecular Design 24 (2010): 417–422. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Liu X., Chen J., Sun N., et al., “Ginsenoside Rb1 Ameliorates Autophagy via the AMPK/mTOR Pathway in Renal Tubular Epithelial Cells In Vitro and In Vivo,” International Journal of Biological Macromolecules 163 (2020): 996–1009. [DOI] [PubMed] [Google Scholar]
- 31. Wei J., Shan Y., Xiao Z., et al., “Anp32e Promotes Renal Interstitial Fibrosis by Upregulating the Expression of Fibrosis‐Related Proteins,” International Journal of Biological Sciences 18 (2022): 5897–5912. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Wu J., Guan F., Luo W., et al., “Prelamin A Overexpression Promotes Detrusor Calcification/Aging in Urinary Incontinence via Prelamin A Accumulation,” Journal of Cellular Physiology 234 (2019): 17800–17811. [DOI] [PubMed] [Google Scholar]
- 33. Xie J., Chen Z., Yao G., Yuan Y., Yu W., and Zhu Q., “NUP160 Knockdown Inhibits the Progression of Diabetic Nephropathy In Vitro and In Vivo,” Regenerative Therapy 21 (2022): 87–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Zhao X., Kong Y., Liang B., et al., “Mechanosensitive Piezo1 Channels Mediate Renal Fibrosis,” JCI Insight 7 (2022): 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Wu R., Li J., Tu G., et al., “Comprehensive Molecular and Cellular Characterization of Acute Kidney Injury Progression to Renal Fibrosis,” Frontiers in Immunology 12 (2021): 699192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Chen J., Hu Y., Mou X., Wang H., and Xie Z., “Amygdalin Alleviates Renal Injury by Suppressing Inflammation, Oxidative Stress and Fibrosis in Streptozotocin‐Induced Diabetic Rats,” Life Sciences 265 (2021): 118835. [DOI] [PubMed] [Google Scholar]
- 37. Hu Q., Zhu B., Yang G., et al., “Calycosin Pretreatment Enhanced the Therapeutic Efficacy of Mesenchymal Stem Cells to Alleviate Unilateral Ureteral Obstruction‐Induced Renal Fibrosis by Inhibiting Necroptosis,” Journal of Pharmacological Sciences 151 (2023): 72–83. [DOI] [PubMed] [Google Scholar]
- 38. Cao Y., Zhang L., Wang Y., Fan Q., and Cong Y., “Astragaloside IV Attenuates Renal Fibrosis Through Repressing Epithelial‐to‐Mesenchymal Transition by Inhibiting microRNA‐192 Expression: In Vivo and In Vitro Studies,” American Journal of Translational Research 11 (2019): 5029–5038. [PMC free article] [PubMed] [Google Scholar]
- 39. Zhuang K., Jiang X., Liu R., et al., “Formononetin Activates the Nrf2/ARE Signaling Pathway via Sirt1 to Improve Diabetic Renal Fibrosis,” Frontiers in Pharmacology 11 (2020): 616378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Dou F., Liu Y., Liu L., et al., “Aloe‐Emodin Ameliorates Renal Fibrosis via Inhibiting PI3K/Akt/mTOR Signaling Pathway In Vivo and In Vitro,” Rejuvenation Research 22 (2019): 218–229. [DOI] [PubMed] [Google Scholar]
- 41. Yang F., Deng L., Li J., et al., “Emodin Retarded Renal Fibrosis Through Regulating HGF and TGFβ‐Smad Signaling Pathway,” Drug Design, Development and Therapy 14 (2020): 3567–3575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Gu M., Zhou Y., Liao N., et al., “Chrysophanol, a Main Anthraquinone From Rheum palmatum L. (rhubarb), Protects Against Renal Fibrosis by Suppressing NKD2/NF‐κB Pathway,” Phytomedicine 105 (2022): 154381. [DOI] [PubMed] [Google Scholar]
- 43. Jia Z., Wang X., Wang X., et al., “Calycosin Alleviates Allergic Contact Dermatitis by Repairing Epithelial Tight Junctions via Down‐Regulating HIF‐1α,” Journal of Cellular and Molecular Medicine 22 (2018): 4507–4521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Zhang Y., Chen C., and Zhang J., “Effects and Significance of Formononetin on Expression Levels of HIF‐1α and VEGF in Mouse Cervical Cancer Tissue,” Oncology Letters 18 (2019): 2248–2253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Wu J., Ke X., Wang W., et al., “Aloe‐Emodin Suppresses Hypoxia‐Induced Retinal Angiogenesis via Inhibition of HIF‐1α/VEGF Pathway,” International Journal of Biological Sciences 12 (2016): 1363–1371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Li X., Shan C., Wu Z., Yu H., Yang A., and Tan B., “Emodin Alleviated Pulmonary Inflammation in Rats With LPS‐Induced Acute Lung Injury Through Inhibiting the mTOR/HIF‐1α/VEGF Signaling Pathway,” Inflammation Research 69 (2020): 365–373. [DOI] [PubMed] [Google Scholar]
- 47. Liu M., Ning X., Li R., et al., “Signalling Pathways Involved in Hypoxia‐Induced Renal Fibrosis,” Journal of Cellular and Molecular Medicine 21 (2017): 1248–1259. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Goodwin J., Choi H., Hsieh M. H., et al., “Targeting Hypoxia‐Inducible Factor‐1α/Pyruvate Dehydrogenase Kinase 1 Axis by Dichloroacetate Suppresses Bleomycin‐Induced Pulmonary Fibrosis,” American Journal of Respiratory Cell and Molecular Biology 58 (2018): 216–231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Liu H., Takagaki Y., Kumagai A., Kanasaki K., and Koya D., “The PKM2 Activator TEPP‐46 Suppresses Kidney Fibrosis via Inhibition of the EMT Program and Aberrant Glycolysis Associated With Suppression of HIF‐1α Accumulation,” Journal of Diabetes Investigation 12 (2021): 697–709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Li Q., Hong Y., Chen J., et al., “Hypoxia‐Induced HIF‐1α Expression Promotes Neurogenic Bladder Fibrosis via EMT and Pyroptosis,” Cells 11 (2022): 3836. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Choudhry H. and Harris A. L., “Advances in Hypoxia‐Inducible Factor Biology,” Cell Metabolism 27 (2018): 281–298. [DOI] [PubMed] [Google Scholar]
- 52. Liu D., Sun H., Li K., et al., “HIF‐1α Mediates Renal Fibrosis by Regulating Metabolic Remodeling of Renal Tubule Epithelial Cells,” Biochemical and Biophysical Research Communications 618 (2022): 15–23. [DOI] [PubMed] [Google Scholar]
- 53. Zhu F., Li H., Long T., et al., “Tubular Numb Promotes Renal Interstitial Fibrosis via Modulating HIF‐1α Protein Stability,” Biochimica et Biophysica Acta‐Molecular Basis of Disease 1867 (2021): 166081. [DOI] [PubMed] [Google Scholar]
- 54. Huang X., Guo X., Yan G., et al., “Dapagliflozin Attenuates Contrast‐Induced Acute Kidney Injury by Regulating the HIF‐1α/HE4/NF‐κB Pathway,” Journal of Cardiovascular Pharmacology 79 (2022): 904–913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Mei S., Li L., Zhou X., et al., “Susceptibility of Renal Fibrosis in Diabetes: Role of Hypoxia Inducible Factor‐1,” FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology 36 (2022): e22477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Liu L., Zhang P., Bai M., et al., “p53 Upregulated by HIF‐1α Promotes Hypoxia‐Induced G2/M Arrest and Renal Fibrosis In Vitro and In Vivo,” Journal of Molecular Cell Biology 11 (2019): 371–382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Wynn T. A. and Barron L., “Macrophages:Master Regulators of Inflammation and Fibrosis,” Seminars in Liver Disease 30 (2010): 245–257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Tang P. M., Nikolic‐Paterson D. J., and Lan H. Y., “Macrophages: Versatile Players in Renal Inflammation and Fibrosis,” Nature Reviews Nephrology 15 (2019): 144–158. [DOI] [PubMed] [Google Scholar]
- 59. Cao Q., Harris D. C., and Wang Y., “Macrophages in Kidney Injury, Inflammation, and Fibrosis,” Physiology 30 (2015): 183–194. [DOI] [PubMed] [Google Scholar]
- 60. Saito H., Tanaka T., Tanaka S., et al., “Persistent Expression of Neutrophil Gelatinase‐Associated Lipocalin and M2 Macrophage Markers and Chronic Fibrosis After Acute Kidney Injury,” Physiological Reports 6 (2018): e13707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Zhou X., Chen H., Shi Y., et al., “Histone Deacetylase 8 Inhibition Prevents the Progression of Peritoneal Fibrosis by Counteracting the Epithelial‐Mesenchymal Transition and Blockade of M2 Macrophage Polarization,” Frontiers in Immunology 14 (2023): 1137332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Jia Y., Chen J., Zheng Z., et al., “Tubular Epithelial Cell‐Derived Extracellular Vesicles Induce Macrophage Glycolysis by Stabilizing HIF‐1α in Diabetic Kidney Disease,” Molecular Medicine 28 (2022): 95. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1: Expression validation of 15 key targets in UUO model mice.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
