Skip to main content
Nature Communications logoLink to Nature Communications
. 2026 Jun 16;17:7641. doi: 10.1038/s41467-026-74206-6

Targeting dopamine transporter for treating social transmission of depression-like behaviors in male mice

Kun Zhang 1,2,#, Dake Song 2,3,#, Yingying Zhang 1,2,#, Le Yang 1,#, Ruixia Liu 2, Hengxin Gong 2, Qi Yang 1, Min Wang 2, Xinshang Wang 3, Yumei Wu 2, Weiwei Hu 4, Shuibing Liu 2,3,, Minggao Zhao 1,
PMCID: PMC13433770  PMID: 42303982

Abstract

Mounting evidence has validated the social transmissibility of depression-like behaviors. This study identifies the essential roles of dopamine signaling and the olfactory system in mediating socially transmitted depression (STD) in male mice. Breath odors from defeated conspecifics induce approach behaviors through the main olfactory bulb–piriform cortex (MOB-PiC) pathway, whereas urine odors trigger avoidance via the accessory olfactory bulb–medial amygdala (AOB-MeA) pathway. Both chemosensory inputs ultimately converge in the medial prefrontal cortex (mPFC). Social interactions with defeated conspecifics markedly enhance dopamine release from the ventral tegmental area (VTA) to the mPFC. In STD-sensitive mice, upregulated dopamine transporter (DAT) expression in the mPFC reduces basal dopamine levels and facilitates depression-like phenotypes. The MOB-PiC-mPFC-VTA axis mediates social interaction-evoked dopamine elevation, and DAT modulates dopamine reduction. Elevated dopamine variability within the mPFC is sufficient to drive STD. Notably, DAT-targeted intervention confers superior therapeutic efficacy against STD compared with serotonin system modulation.

Subject terms: Prefrontal cortex, Empathy


Emerging evidence supports social depression transmission. Here, authors show that body odors induce mPFC-regulated VTA dopaminergic shifts mediating this process, with dopamine-targeted therapies superior to serotonin-based ones.

Introduction

Depression is a complex and heterogeneous psychiatric disorder triggered by multiple factors. Recent studies suggest that negative emotion may be transmitted between individuals13, a phenomenon referred to as social transmission of depression (STD) or depression contagion. Unlike depression caused by physical or mental stressors, STD emerges from social interactions with a depressed companion and poses significant risks to affected individuals4. Even this phenomenon resembles empathy-like behaviors, such as providing assistance to individuals in distress5, offering social support to stressed partners, etc; however, bystanders may also develop severe emotional disorders6. Nevertheless, the neuronal circuits and molecular mechanisms underlying STD are poorly understood.

STD depends on the social transmission of emotional cues (e.g., hearing, seeing, or/and smelling). Olfaction represents the most ancient sense and is essential for the detection of the social cues in rodent7,8. The main olfactory bulb (MOB) and accessory olfactory bulb (AOB) receive sensory input from the olfactory epithelium and vomeronasal organ, respectively, and transmit olfactory information to downstream brain regions such as the piriform cortex (PiC) and medial amygdala (MeA) through glutamatergic output neurons, including mitral and tufted cells9. In order to deal with these emotional cues and deliver appropriate response, more brain regions such as central amygdala10, paraventricular nucleus of the hypothalamus11, anterior cingulate cortex12, insular cortex13, and nucleus accumbens14 are implicated in this process. Among them, the medial prefrontal cortex (mPFC) plays a crucial role in decision-making during conflicts and empathy15,16. At the molecular level, research increasingly underscores neurobiological factors associated with the social transmission of emotions, including oxytocin10, vasopressin17, dopamine18, testosterone, and opioids19.

In this study, the neuronal circuits and molecular mechanisms underlying STD are investigated, and the results demonstrated MOB-PiC and AOB-MeA pathways as being preferentially activated by breath or urine olfactory cues from Defeated mice, and inducing attractive and aversive responses, respectively. Both the MOB-PiCGlu and AOB-MeAGABA pathways converges in the mPFC. Social preference for Defeated mice, mediated by activation of the MOB-PiCGlu-mPFCGlu pathway, elevates dopamine levels in the mPFC, which is driven by activation of the ventral tegmental area (VTA). Concurrently, dopamine transporter (DAT) expression is significantly higher in STD-sensitive (STDs) mice than in STD-insensitive (STDi) mice, leading to reduced basal dopamine levels. Moreover, greater variation in dopamine levels are responsible for the emergence of depression-like behaviors in Observer mice. Notably, selective DAT inhibitor was more effective in alleviating depression-like behaviors in Observer mice compared to selective serotonin reuptake inhibitor. Collectively, these findings elucidate the neural circuits and molecular mechanisms underlying STD and highlight DAT as a promising therapeutic for empathy-induced depression.

Results

Opposing effects of breath and urine odors from Defeated mice on social behaviors

To explore the mechanisms of STD, a social defeat model was modified as described previously20,21. During daily social defeat sessions, Observer mice did not experience direct social defeat. Instead, they observed Defeated mice being attacked by CD-1 mice for 20 min. Observer mice were then co‑housed with their defeated partners in a compartment adjacent to the CD-1 mouse for the remaining 24 h (Fig. 1a). Following 10 consecutive days of STD exposure, both Observer and Defeated mice exhibited enhanced depression‑like behaviors compared with control (Con) mice. Behavioral phenotypes were assessed using a battery of seven tests, including the open field test, elevated plus maze test, sucrose preference test (Fig. 1b–d), tail suspension test, forced swimming test, novelty‑suppressed feeding test, and social interaction test (Supplementary Fig. 1A–F). To rule out the possibility that depression-like behaviors in Observer mice were induced by direct aggression from Defeated mice, we scored social interactions during the subsequent 24 h. We observed no overt aggressive behaviors between Observer and Defeated mice, thus excluding this possibility.

Fig. 1. Breath odors induces social attraction of Defeated mice.

Fig. 1

a Illustration of social transmission of depression (STD). bd Summary data for different behavioral tests, including OFT, EPM and SPT. F2,42 = 38.63, P < 0.0001 for (b); F2,42 = 35.03, P < 0.0001 for (c); F2,42 = 93.44, P < 0.0001 for (d). n = 15. e Social interaction test of naïve mice with Defeated/Control (Con) mice. t6.791 = 8.267, P < 0.0001. n = 6. f Correlations of STD score and social preference of Defeated mice. F1,38 = 112.3, P < 0.0001. n = 40. gi Social interaction of naïve mice with anaesthetic (g, t9.964 = 3.140, P = 0.0106), sheltered (h, t8.099 = 5.517, P = 0.0005), and closed in transparent box (i, t9.565 = 0.5305, P = 0.6079) Defeated mice. n = 6. j, k Interaction time of naive mice exposed to body odors (j, t8.875 = 3.644, P = 0.0055, n = 6) and urine (k, t14.24 = 7.134, P < 0.0001, n = 12) from Defeated mice. l Nesting test of naïve mice using cotton contaminated with Defeated or Con urine (t2.012 = 6.285, P = 0.0242, n = 3). m Interaction time of naïve mice with breath odors from Defeated mice (t5.998 = 5.718, P = 0.0012, n = 5). Con: mice were generated by 10 days of repeated daily transfers on each side of a perforated Plexiglas partition with a CD-1 mouse on the other side; Naïve: mice without any handling. OFT, open field test; EPM, elevated plus maze; SPT, sucrose preference test. For (bd), statistical analysis was performed using one-way ANOVA with Tukey’s multiple comparisons test. For (e), and (gm) data, statistical analysis was performed using two-tailed unpaired Welch’s t-test; For (f), statistical analysis was performed using two-tailed simple linear-regression analysis. Data are mean ± s.e.m. *P < 0.05, **P < 0.01, and ***P < 0.001.

On the other hand, the depression-like behaviors observed in Observer mice might also be induced by fear triggered by witnessing social defeat. To rule out this possibility, Observer mice were assigned to three groups: Witness + cohabitation, Cohabitation only, and Witness only. Mice in the Witness-only group witnessed the social defeat procedure but had no subsequent physical contact with Defeated mice. In contrast, mice in the Cohabitation-only group did not witness social defeat but were cohoused with Defeated mice for the subsequent 24 h. Our results revealed that depression-like behaviors were significantly elevated in the Cohabitation-only group, but not in the Witness-only group (Supplementary Fig. 2A, B). These findings indicate that social interaction plays a critical role in mediating STD. Furthermore, these results support that our model recapitulates STD rather than a fear-driven behavioral response.

Social interaction provides the necessary opportunity and forms the basis for STD22. To assess social interactions during the development of STD, interactions between naïve mice and Defeated mice were examined using a single‑chamber social interaction test. We measured the time that naïve mice (tested 2 h after the first social defeat) spent interacting with Defeated mice versus Con mice. Naïve mice exhibited a clear social preference for Defeated mice (Fig. 1e). Furthermore, this preference positively predicted the final STD score when these naïve mice were subsequently tested as Observer mice (Fig. 1f). These findings support the notion that social interaction constitutes a key basis for STD2,23,24.

Rodents typically acquire social preference via visual, auditory, and olfactory cues25. In the present study, we found that the social preference for Defeated mice was abolished when Defeated mice were sealed, but not when they were anesthetized or sheltered, further underscoring the critical role of olfactory cues in mediating STD (Fig. 1g–i). To examine the source of olfactory cues inducing social preference, naïve mice were exposed to cotton balls rubbed across the body, head, and anogenital regions of either Con or Defeated mice or cotton contaminated with urine from the same groups. Naïve mice displayed robust avoidance to both the body odors (Fig. 1j) and urine odors from Defeated mice relative to Con mice (Fig. 1k). In a nesting assay, naïve mice similarly avoided cotton contaminated with urine from Defeated mice (Fig. 1l). Additionally, naïve mice avoided Defeated mice when tested immediately after social defeat—a condition during which Defeated mice commonly display urinary incontinence—whereas Defeated mice tended to aggregate together (Supplementary Video 1 and Supplementary Fig. 3A, B). Moreover, exposure to urine, but not diluted fecal suspension, from Defeated mice was sufficient to elicit increased depression-like behaviors (Supplementary Fig. 4A). Enzyme-linked immunosorbent assay (ELISA) revealed that urinary levels of epinephrine, thyroxine, and corticosterone were significantly elevated in Defeated mice, which may contribute to the avoidance behaviors (Supplementary Fig. 4B, C). Together, these results demonstrate that urine odors from Defeated mice trigger aversive and depression-like behaviors in naïve mice, rather than driving social preference.

Given that urine odors from Defeated mice elicited social avoidance, we next explored which other olfactory cues mediate the observed social preference for Defeared mice. Previous studies have reported that mice acquire food preferences via breath odor cues8,26,27. We therefore hypothesized that breath odors may underlie the social preference toward Defeated mice. To test this hypothesis, breath odors were collected into an air bag and delivered into the social chamber through a tube via a controlled air pump. Subsequent analyses revealed that breath odors from Defeated mice was sufficient to induce social preference in naïve mice (Fig. 1m). Furthermore, the STD scores of Observer mice were positively correlated with their preference for breath odors, but not with avoidance of urine odors, when the same mice were tested as naïve individuals (Supplementary Fig. 4D).

Breath odors contain a variety of volatile organic compounds (VOCs). To further validate whether altered VOC profiles in breath odors mediate social preference, we analyzed volatile components in breath odors using GC‑MS. Several compounds, including 2,3‑dimethylpyrazine, dibutyl oxalate, 4‑ethylphenol, and tetramethylpyrazine, exhibited differential concentrations in breath odors from Con and Defeated mice (Supplementary Data 1 and Supplementary Fig. 5A, B). Among these compounds, 0.1% (w/w) 2,3‑dimethylpyrazine and 0.1% (w/w) 4‑ethylphenol significantly elicited social preference and were thus identified as attractive odors (Supplementary Fig. 5C, D). Conversely, 0.1% dicyclobutyl oxalate and 0.1% cyclobutanemethanol aqueous solution evoked significant avoidance in naïve mice (Supplementary Fig. 5E, F) and were therefore classified as aversive odors.

Collectively, these findings demonstrate that distinct olfactory cues differentially regulate social behaviors: urine odors from Defeated mice drive social avoidance, whereas breath odors mediate social preference. Social defeat stress induces significant alterations in the profiles of multiple volatile and non-volatile compounds present in both urine and breath. Such odorant changes are likely responsible for mediating the distinct, stimulus-dependent social interaction behaviors of Observer mice toward Defeated mice.

Differential activation of MOB-PiC and AOB-MeA pathways by breath and urine odors

To identify the neuronal circuits involved in perceiving olfactory cues from breath and urine, c-Fos staining was employed to label activated neurons in the MOB and AOB following exposure to breath and urine odors. Results showed that both breath and urine odors from Defeated mice activated the MOB and AOB. However, breath odors from Defeated mice preferentially activated the MOB, whereas urine odors from Defeated mice preferentially activated the AOB (Fig. 2a).

Fig. 2. Breath odors from Defeated mice preferably activate the MOB-PiC pathway.

Fig. 2

a Representative images and quantification of c-Fos positive (c‑Fos⁺) neurons in the accessory olfactory bulb (AOB) and main olfactory bulb (MOB) 30 min after exposure to urine odors or breath odors from Con or Defeated mice. MOB: urine, P = 0.8964; breath, P = 0.0065. AOB: urine, P < 0.0001; breath, P = 0.6779. n = 6 mice. b Experimental design and representative images illustrating viral expression of the inhibitory hM4Di in the MOB and AOB. c Whole-cell current-clamp recordings were obtained from mCherry-labeled neurons in the MOB or AOB following expression of hM4Di. Bath application of Clozapine N‑oxide (CNO, 5 μM) induced rapid membrane hyperpolarization and markedly reduced neuronal firing rate. The trace shown is representative of 4 independent recordings. d Preference for urine odors and breath odors from Defeated mice after chemogenetic inhibition of MOB or AOB by CNO injection (i.p., 1 mg/kg, 30 min before behavioral testing). MOB hM4Di Saline vs CNO: urine preference, P = 0.2373; breath preference, P < 0.0001. AOB hM4Di Saline vs CNO: urine preference, P < 0.0001; breath preference, P = 0.6443. n = 10. Urine or breath preference = Time spent with the urine or breath from Defeat mice/Time spent with the urine or breath from Con mice × 100%. e Social interaction with the Defeated mice after chemogenetic inhibition of MOB or AOB. Social preference = Social time with the Defeat mice/Social time with the Con mice × 100%. AOB hM4Di Saline vs CNO in social preference, P < 0.0001; MOB hM4Di Saline vs CNO in social preference, P = 0.0120. n = 10. f Experimental procedures of MOB or AOB inhibition during STD. g Impact of MOB or AOB inhibition during STD session on performance of elevated plus maze and open field test. AOB hM4Di Saline + STD vs. CNO + STD: center time, P < 0.0001; open arms entries, P < 0.0001. MOB hM4Di Saline + STD vs. CNO + STD: center time, P < 0.0001; open arms entries, P < 0.0001. n = 10. h Schematic of virus injection into the AOB and MOB and representative images showing their projections in the medial amygdala (MeA) and piriform cortex (PiC). i Schematic of retrograde virus injection in the PiC and retrograde tracer CTB-555 injection in the MeA and representative images. j Schematic of retrograde virus injection in the MeA and representative images. k Schematic of the viral injection strategy used for chemogenetic inhibition of the MOB‑PiC or AOB‑MeA pathway, and representative images showing hM4Di‑mCherry expression in the PiC and MeA. Whole‑cell current‑clamp recordings were obtained from PiC neurons receiving MOB innervation and MeA neurons receiving AOB innervation following hM4Di‑mediated chemogenetic inhibition. l Effects of MOB-PiC or AOB-MeA inhibition on preference with urine or breath from Defeated mice, and social preference for Defeated mice. AOB-PiC hM4Di: Saline vs. CNO, urine preference, P < 0.0001; Saline vs. CNO, breath preference, P = 0.9541; social preference, P < 0.0001. MOB-PiC hM4Di: Saline vs. CNO, urine preference, P = 0.7116; Saline vs. CNO, breath preference, P < 0.0001; social preference, P = 0.0003. n = 10. Two-way ANOVA with post‑hoc Fisher’s LSD tests for (a, d, e, g, and l). Data are mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001.

To determine whether MOB and AOB neurons are required for responses to breath and urine odors from Defeated mice, we injected virus encoding the inhibitory chemogenetic tool hM4Di into either the MOB or AOB (Fig. 2b). In vitro patch-clamp recordings confirmed that chemogenetic inhibition with clozapine N-oxide (CNO, 1 μM) strongly suppressed the excitability of MOB/AOB neurons (Fig. 2c). Inhibition of the AOB abolished avoidance toward urine from Defeated mice yet exerted no impact on the preference for breath cues. Conversely, inhibition of the MOB abolished the preference for breath cues (Fig. 2d). Notably, inhibiting MOB or AOB activity produced opposite effects on social preference for Defeated mice (Fig. 2e). Next, roles of MOB and AOB in STD were also assessed. CNO (1 mg/kg) was administered intraperitoneally (i.p.) daily prior to the every STD training session to inhibit MOB and AOB activity (Fig. 2f). The results indicated that inhibition of either MOB or AOB activity abolished STD (Fig. 2g), suggesting that both MOB-mediated social preference and AOB-mediated avoidance are required for the establishment of STD.

We then traced the downstream circuits of the AOB and MOB by detecting mCherry-positive (mCherry+) nerve fibers following injection of AAV‑hSyn‑mCherry virus into theses two regions. Abundant mCherry+ nerve fibers were observed in the traced PiC and MeA (Fig. 2h). To examine whether these projections are distinct, retrograde tracers (CTB‑555 or AAV/Retro-green fluorescent protein [GFP]) were injected into the MeA and PiC, respectively. Retrogradely labeled cells from the PiC were predominantly located in the MOB, while retrogradely labeled cells from the MeA were primarily observed in the AOB. These results indicated that the MOB primarily projected to the PiC, while the AOB primarily projected to the MeA (Fig. 2i, j).

We further examined the requirement for the MOB-PiC and AOB-MeA pathways in mediating social preference and olfactory cue-evoked responses. The MOB‑PiC or AOB‑MeA pathway was selectively inhibited using chemogenetic approaches (Fig. 2k). Inhibition of the AOB‑MeA pathway completely abolished avoidance behavior toward urine from Defeated mice, whereas inhibition of the MOB‑PiC pathway had no such effect. By contrast, preference for Defeated mice and their breath odors were impaired by inhibition of the MOB‑PiC pathway but not the AOB‑MeA pathway (Fig. 2l). These findings indicate that attractive breath odors and aversive urine odors from Defeated mice may be processed via distinct neural pathways: the MOB‑PiC pathway mediates responses to attractive breath cues, whereas the AOB‑MeA pathway underlies the processing of aversive urine odors.

mPFC received olfactory information from both MOB-PiC and AOB-MeA projections

Having established that the MOB-PiC and AOB-MeA pathways mediate breath odor preference and urine odor avoidance, respectively, we next sought to identify their downstream brain regions responsible for the regulation of STD. Specifically, Observer mice were classified into two groups based on their STD scores, namely the STD-sensitive (STDs) group and the STD-insensitive (STDi) group (Supplementary Fig. 6A). Activated neurons were labeled using c-Fos staining across the whole brain. STDs mice exhibited significantly increased c-Fos+ cells in the mPFC as compared to STDi mice (Fig. 3a and Supplementary Fig. 6B, C).

Fig. 3. Olfactory information converges to the mPFC through the MOB-PiC and AOB-MeA pathways.

Fig. 3

a Representative images of c-Fos staining and counting results of c‑Fos⁺ neurons showed activation of mPFC neurons after STD. Green, c-Fos; Blue, cell nucleus. t8.819 = 9.037, P < 0.0001. n = 8 slices from 4 mice. b Schematic of viruses injection for the MOB-PiC-mPFC circuit and AOB-MeA-mPFC circuit. Anterograde Flp- and Cre-expressing viruses were injected into the MOB and AOB, respectively, to drive Flp-dependent mWGA-GFP and Cre-dependent mWGA-mCherry expression, which trans-synaptically label PiC/MeA downstream  neurons in mPFC. c Venn diagrams showing the ratios mPFC neurons receiving MOB-PiC or AOB-MeA projection. d Schematic of viruses injection to illustrate the neurons receiving joint projections from MOB-PiC circuit and AOB-PiC circuit. Anterograde Flp- and Cre-expressing viruses were injected into the MOB and AOB, respectively, to initiate trans-synaptic expression of mWGA-Cre and mWGA-Flp in downstream PiC and MeA neurons, and ultimately start Cre-ON/Flp-ON GFP viruses expression in mPFC neurons receiving both MOB-PiC and AOB-MeA projections. And representative images illustrating co-localization of GAD1 or vGLUT1 with GFP positive cells. e Virus injection strategy and representative images depicting Gad1 or CamkⅡ promoter drived mCherry colocalized with GFP labeled PiC neurons receiving MOB domination and projecting to mPFC or MeA neurons receiving AOB domination and projecting to mPFC. The colocalization ratios of GFP and mCherry in the PiC and MeA. f Viral injection strategy for chemogenetic inhibition of the MOB-PiC-mPFC or AOB-MeA-mPFC neural circuits. g Immunofluorescence staining images and statistical results showing c-Fos⁺ cells in the PiC and MeA following chemogenetic inhibition of the MOB-PiC-mPFC or AOB-MeA-mPFC neural circuits. t9.269 = 4.596, P = 0.0012 for PiC; t9.869 = 4.269, P = 0.0017 for MeA. n = 6 slices from 3 mice. h Representative traces showing that bath application of CNO induced membrane hyperpolarization in hM4Di-expressing PiC and MeA neurons, which were respectively derived from the MOB-PiC-mPFC or AOB-MeA-mPFC neural circuits, as assessed by whole-cell patch-clamp recordings in brain slices. i, j Behavioral performance of mice with inhibited MOB-PiC-mPFC/AOB-MeA-mPFC circuits. F2,27 = 104.9, P < 0.0001 for urine preference; F2,27 = 108.9, P < 0.0001 for breath preference; F2,27 = 53.35, P < 0.0001 for social preference; F2,27 = 26.95, P < 0.0001 for center time; F2,27 = 14.75, P < 0.0001 for open arms time; F2,27 = 25.15, P < 0.0001 for sucrose preference. n = 10 mice. k, l Viral injection strategy and representative action potentials of chemogenetically activated PiC and MeA neurons, derived from the MOB-PiC-mPFC and AOB-MeA-mPFC circuits, respectively. m, n Behavioral performance of mice with activated MOB-PiC-mPFC/AOB-MeA-mPFC circuits. F2,27 = 7.469, P = 0.0026 for urine preference; F2,27 = 19.67, P < 0.0001 for breath preference; F2,27 = 40.93, P < 0.0001 for social preference; F2,27 = 10.77, P = 0.0004 for center time; F2,27 = 15.21, P < 0.0001 for open arms time; F2,27 = 45.83, P < 0.0001 for sucrose preference. n = 10 mice. mWGA, modified wheat germ agglutinin; vGLUT1, vesicular glutamate transporter 1; GAD1, glutamate decarboxylase 1; CaMKII, calcium/calmodulin-dependent protein kinase II. Two-tailed unpaired Welch’s t-test for (a, g); One-way ANOVA with Tukey’s multiple comparisons test for (i, j, m, and n). Data are mean ± s.e.m. *P < 0.05, **P < 0.01, and ***P < 0.001.

Previous research has demonstrated that mPFC is involved in social decision-making, as evidenced by functional magnetic resonance imaging (fMRI) results28,29. On this basis, it was hereby hypothesized that the mPFC received projections from the MOB-PiC and AOB-MeA pathways. Anterograde AAV-Flp virus was infused into the MOB, which allowed the virus to express Flp in MOB-receiving PiC neurons. The Flp-dependent wheat germ agglutinin (mWGA)-GFP was injected into the PiC to label the MOB-PiC down-stream neurons with GFP. Similarly, AOB-MeA down-stream neurons were labeled with mCherry in a Cre-dependent manner. Consistent with expectations, both GFP+ and mCherry+ neurons could be identified in the mPFC, with 17.42% exhibiting co-localization (Fig. 3b, c). In another strategy, AAV/Antero-Flp virus was infused into the MOB and the Flp-dependent mWGA-Cre virus into PiC, so that MOB-receiving PiC neurons could Flp-dependently express WGA-Cre and transport it to downstream MOB-PiC receiving neurons; Similarly, WGA-Flp was expressed in AOB-MeA receiving neurons, and Cre‑dependent/Flp‑dependent GFP expressing virus (Cre‑ON/Flp‑ON GFP viruses) was injected into the mPFC. Consequently, MOB-PiC and AOB-MeA receiving mPFC neurons could be labeled with GFP. A sizeable number of GFP+ neurons were detected in the mPFC, predominantly co-localizing with vesicular glutamate transporter 1 (vGLUT1) rather than glutamate decarboxylase 1 (GAD1) (Fig. 3d). Further investigation revealed that GABAergic neurons in the MeA projected to the mPFC, whereas PiC neurons provided monosynaptic glutamatergic inputs to the mPFC (Fig. 3e). These results indicated that both the MOB-PiCGlu and AOB-MeAGABA pathways innervated glutamatergic neurons in the mPFC.

We next examined the roles of the MOB‑PiC‑mPFC and AOB‑MeA‑mPFC pathways in the opposing preferences for urine/breath odors and STD. These two pathways were separately inhibited using chemogenetic approaches (Fig. 3f), and the efficacy of inhibition was validated by c-Fos staining and electrophysiological recordings (Fig. 3g, h). Notably, chemogenetic inhibition of the MOB-PiC-mPFC circuit, but not the AOB-MeA-mPFC circuit, selectively impaired the preference for breath odors and social preference for Defeated mice, without affecting the avoidance toward urine odors from Defeated mice. Meanwhile, AOB-MeA-mPFC circuit inhibition specifically blocked avoidance toward urine odors while increasing preference for breath odors and social preference for Defeated mice (Fig. 3i). In the STD test, inhibition of either the MOB‑PiC‑mPFC or AOB‑MeA‑mPFC circuit abolished STD in observer mice (Fig. 3j). By contrast, chemogenetic activation of the MOB‑PiC‑mPFC pathway significantly enhanced preference for breath odors, social preference for Defeated mice, and STD performance (Fig. 3k–n).

To investigate how mPFC neurons encode social decisions between approach and avoidance, mPFC neurons receiving MOB-PiC projection (mPFCMOB-PiC) and AOB-MeA projection (mPFCAOB-MeA) were hereby labeled with red protein calcium indicator (jRGECO1) and green protein calcium indicator (GcaMP6s), respectively (Fig. 4a). Dual-color fiber photometry recordings of jRGECO1 and GCaMP6s were conducted to simultaneously monitor Ca2+ signals in these two subpopulations of mPFC neurons (Fig. 4b). The results indicated that mPFCMOB-PiC neurons were activated exclusively at the start stage of social interactions with Defeated mice, whereas mPFCAOB-MeA neurons were activated at both the start and the end stages of these interactions (Fig. 4c). These findings suggest that activation of mPFCAOB-MeA neurons may also contribute to the termination of social interactions with Defeated mice, consistent with our previous observation that inactivation of the AOB‑MeA pathway enhanced social preferance for Defeated mice. When the STD score was plotted against the Ca2+ signals of these two subpopulations of mPFC neurons, the findings uncovered a positive correlation with mPFCMOB-PiC neurons activation and a negative correlation with mPFCAOB-MeA neurons activation (Fig. 4d).

Fig. 4. MOB-PiC-mPFC circuit activation correlates with STD score and MOB-PiC/AOB-MeA modulation of mPFC activities.

Fig. 4

a Schematic of viruses injection and photometric recording to illustrate the Ca2+ activity of mPFC neurons receiving MOB-PiC projection (mPFCMOB-PiC) or AOB-MeA projection (mPFCAOB-MeA). Flp- and Cre-expressing anterograde viruses were injected into the MOB and AOB to drive Flp/Cre-dependent mWGA-Cre/mWGA-Flp expression, enabling trans-synaptic delivery of Cre/Flp to mPFC neurons and subsequent expression of the red Ca²⁺ sensor jRGECO1a and green Ca²⁺ sensor GCaMP6s, respectively. b, c Heatmaps (b), averaged traces, and statistics (c) of photometric Ca2+ recordings in different mPFC neurons subpulations during social interactions with Defeated mice. Start stage: mPFCMOB-PiC vs mPFCAOB-MeA, P = 0.2098; End stage: mPFCMOB-PiC vs mPFCAOB-MeA, P < 0.0001. n = 8. d The correlation between the activation of different mPFC neurons subpulations at the start or end stage of social interactions with Defeated mice and the STD score. F1,18 = 49.97, P < 0.0001 for mPFCMOB-PiC at start stage; F1,18 = 0.4361, P = 0.5174 for mPFCAOB-MeA at start stage; F1,18 = 1.416, P = 0.2496 for mPFCMOB-PiC at start stage; F1,18 = 25.29, P < 0.0001 for mPFCMOB-PiC at start stage; n = 20. e, f mPFCMOB-PiC neurons were preferentially activated by breath odors from Defeated mice, whereas mPFCAOB-MeA neurons showed similar responses to breath odors from Defeated and Con mice. t9.997 = 2.469, P = 0.0332 for mPFCMOB-PiC; t9.970 = 0.2306, P = 0.8223 for mPFCAOB-MeA. n = 6. g, h mPFCMOB-PiC neurons were inhibited by urine odors from Defeated mice, but exhibited comparable activation by urine odors from Con and Defeated mice. t9.879 = 1.198, P = 0.2589 for mPFCMOB-PiC; t7.599 = 22.56, P < 0.0001 for mPFCAOB-MeA. n = 6. c, f, and h two-tailed Kolmogorov–Smirnov test for peak distribution analysis of Ca2+ signals, two-way ANOVA with post‑hoc Fisher’s LSD tests for Z-scores in (c), two-tailed unpaired Welch’s t-test for Z-scores in (f) and (h). Two-tailed linear regression for (d). Data are mean ± s.e.m. *P < 0.05, **P < 0.01, and ***P < 0.001.

We next examined the activity of mPFCMOB-PiC and mPFCAOB-MeA neurons in response to breath and urine odors. Compared with breath odors from Con mice, breath odors from Defeated mice elicited stronger activation in mPFCMOB-PiC neurons, but comparable activation in mPFCAOB-MeA neurons (Fig. 4e, f). In contrast, urine odors from Con and Defeated mice evoked similar responses in mPFCMOB-PiC neurons, but differentially modulated mPFCAOB-MeA activity: increased by Con urine but decreased by Defeated urine (Fig. 4g, h). Together, these findings indicate that the mPFC receives olfactory input from both MOB‑PiC and AOB‑MeA pathways, which differentially regulate responses to breath and urine odors, and that both pathways are essential for STD.

Activation of the MOB-PiC-mPFC pathway elevated dopamine level in the mPFC during social interaction with Defeated mice

Social interactions and relationships are often rewarding, promoted by dopamine release from VTA30. Thus, we hypothesized that MOB‑PiC‑mPFC neurons promote dopamine release in the VTA, and that social interaction with Defeated mice is more rewarding than interaction with Con mice. To test this hypothesis, mPFC neurons receiving MOB‑PiC inputs were labeled with GFP using the strategy described above, and abundant GFP+ fibers were detected in the VTA, indicating a monosynaptic projection from these mPFC neurons to the VTA (Fig. 5a). We next examined whether mPFC neurons receiving PiC or MeA inputs also project to the VTA. For this purpose, Flp recombinase was anterogradely expressed in mPFC neurons receiving PiC inputs, and Cre recombinase in those receiving MeA inputs, combined with retrograde Flp‑ and Cre‑dependent GFP expression in mPFC neurons projecting to the VTA. GFP+ neurons in the mPFC confirmed that these neurons receive convergent PiC and MeA inputs and further project to the VTA (Fig. 5b). We next recorded activity of VTAPiC‑mPFC and VTAMeA‑mPFC neurons during social interaction and odors exposure. Ca²⁺ signals in VTAPiC‑mPFC neurons were significantly higher during interaction with Defeated mice than with Con mice (Fig. 5c–e). VTAPiC‑mPFC neuronal activity was also greater in response to breath odors from Defeated mice versus Con mice (Fig. 5f). These findings indicate that intrinsic reward may constitute an important mechanism underlying social preference toward defeated conspecifics. By contrast, Defeated mice urine reduced Ca²⁺ signals in VTAMeA‑mPFC neurons (Fig. 5g), in line with urine-induced avoidance. Importantly, VTA dopaminergic neurons receiving mPFC afferents project back to the mPFC but not the NAc31, and mediate social isolation‑induced social craving via mPFC projections rather than the NAc32. Herein, dopamine signals in the mPFC were analyzed utilizing a genetically encoded fluorescent dopamine indicator (D2m) (Fig. 5h). Higher dopamine signals peaks were detected in the mPFC when interacting with Defeated mice compared to Con mice (Fig. 5h). These results indicate that VTA neurons were oppositely regulated by activation of the PiC‑mPFC and MeA‑mPFC pathways, and that interaction with Defeated mice conferred a greater intrinsic reward.

Fig. 5. Activation of MOB-PiC-mPFC circuit increases mPFC dopamine level when interacting with Defeated mice.

Fig. 5

a Schematic and viral injection strategy and representative image showing MOB-PiC innervated mPFC neurons projecting to ventral tegmental area (VTA). b Viral injection strategy, and representative images showing that mPFC neurons receiving convergent co-innervation from the PiC and MeA can also project to the VTA. c Schematic illustration of the viral injection strategy and representative images demonstrating viral infection, used for measuring Ca²⁺ signals via fiber photometry in VTA neurons innervated by the PiC-mPFC pathway. d Mice showing more social interaction with Defeated mice when recording Ca2+ signals of VTAPiC‑mPFC neurons by photometry. t7.172 = 3.818, P = 0.0063. n = 5. e Heatmaps, averaged traces, and statistics showing Ca2+ activity of VTAPiC‑mPFC neurons when interacting with Con and Defeated mice. t5.886 = 4.621, P = 0.0038. n = 5 mice. f Heatmaps, averaged traces, and statistics showing Ca2+ activity of VTAPiC‑mPFC neurons when interacting with breath odors from Con or Defeated mice. t6.340 = 6.032, P = 0.0008. n = 5 mice. g Viral injection strategy, heatmaps, averaged traces, and statistics showing Ca2+ activity of VTAMeA‑mPFC neurons when interacting with urine odors from Con or Defeated mice. t7.480 = 5.467, P = 0.0008. n = 5 mice. h Viral injection strategy, heatmaps, averaged traces, and statistics of photometric dopamine (DA) release in the mPFC from mPFC innervated VTA neurons when interaction with Con or Defeated mice. t5.856 = 3.605, P = 0.0118. n = 5 mice. i Schematic, representative images, and statistical results showing that 6-OHDA injection depleted tryptophan hydroxylase (TH)-immunoreactive terminals in the mPFC. t4.744 = 5.091, P = 0.0044. n = 5. j Preference with urine odors and breath odors from Defeated mice and social interaction with Defeated mice after depleting dopaminergic terminals in the mPFC. t11.99 = 12.82, P < 0.0001 for breath preference; t11.14 = 0.1436, P = 0.8884 for urine preference; t13.38 = 9.212, P < 0.0001 for social preference. n = 8. k Viral injection strategy and representative images of chemogenetic inhibition of VTAPiC‑mPFC neurons, and behavioral preference with urine odors, breath odors and Defeated mice. l Representative traces of membrane depolarization by chemogenetic inhibition of VTAPiC‑mPFC neurons. m Behavioral preference with urine odors, breath odors, and Defeated mice after chemogenetic inhibition of VTAPiC‑mPFC neurons. t13.13 = 9.016, P < 0.0001 for breath preference; t13.76 = 0.04804, P = 0.9624 for urine preference; t13.42 = 9.244, P < 0.0001 for social preference. n = 8. n Dopamine (DA) levels in the mPFC and VTA after VTAPiC‑mPFC neurons inhibition. t5.733 = 2.987, P = 0.0258 for mPFC; t5.993 = 3.583, P = 0.0116 for VTA. n = 4. o Schematic showing viral injection strategy of chemogenetic inhibition of VTAPiC‑mPFC neurons during STD, and performance of mice in the OFT, EPM, and SPT. F2,21 = 53.85, P < 0.0001 for center time; F2,21 = 39.40, P < 0.0001 for open arms time; F2,21 = 60.34, P < 0.0001 for sucrose preference. n = 8. p DA levels in the mPFC and VTA after inhibiting VTAPiC‑mPFC neurons during STD. F2,9 = 24.62, P = 0.0002 for mPFC; F2,9 = 81.61, P < 0.0001 for VTA. n = 4. Two-tailed unpaired Welch’s t-test for (bar graphs in d–j); Kolmogorov–Smirnov test for peak distribution analysis of Ca2+ signals in (e–h); One-way ANOVA with Tukey’s multiple comparisons test for (o and p). Data are mean ± s.e.m. *P < 0.05, **P < 0.01, and ***P < 0.001.

To determine the necessity of dopaminergic projections to the mPFC in mediating responses to distinct urine/breath odors and social preference, we locally infused 6-OHDA to specifically ablate dopaminergic terminals in the mPFC, the efficacy of which was verified by tyrosine hydroxylase (TH) immunostaining (Fig. 5i and Supplementary Fig. 7A, B). We found that this depletion abolished social and breath odors preference for Defeated mice, without altering urine odors avoidance (Fig. 5j), suggesting that the preference mediated by the MOB-PiC-mPFC pathway is more strongly regulated by VTA-mPFC dopaminergic projections. To test this hypothesis, we further chemogenetically inhibited the PiC-mPFC-VTA pathway (Fig. 5k). We observed that this inhibition reduced preference for breath odors from Defeated mice, attenuated STD, and decreased dopamine levels in the mPFC (Fig. 5m–p). Collectively, these results demonstrate that VTA dopaminergic projections to the mPFC are critical for mediating the preference for Defeated mice and STD.

Notably, the divergent changes in mPFC dopamine levels—elevated during social interaction (Fig. 5h) but reduced after STD (Fig. 5p)—and the opposing changes between mPFC and VTA dopamine following STD (Fig. 5p) warrant further investigation.

Elevated DAT in mPFC lowers dopamine and causes depression-like behaviors following social defeat stress

To investigate the molecular mechanisms of increased dopamine levels in the mPFC during interaction with Defeated mice and decreased dopamine concentrations after STD exposure, we used iTRAQ (a high-throughput quantitative proteomic approach) to identify differentially expressed proteins between STDs and STDi mice (Fig. 6a). Increased dopamine transporter (DAT) was observed in the mPFC of STDs mice compared to STDi mice (Fig. 6b). The increased DAT levels in the mPFC of STDs mice were further validated by immunofluorescence staining and western blot analysis (Fig. 6c, d). DAT functions to reuptake dopamine from the synaptic cleft into presynaptic terminals, thereby clearing dopamine from the synaptic space33. Considering that dopamine levels were elevated during interaction with Defeated mice (Fig. 5f) but decreased after STD, we hypothesized that increased DAT expression may contribute to the reduced dopamine levels in the mPFC following 10-day STD exposure and the exaggerated dopamine fluctuation in Observer mice. To validate this hypothesis, a virus expressing a Cre-dependent DAT-knockout saCas9 system was injected into the VTA, and a retrograde virus expressing Cre recombinase was injected into the mPFC, to specifically deplete DAT in mPFC projecting VTA neurons (Fig. 6e, f). An elevation in mPFC dopamine levels was detected. Over the course of STD training, this depletion concurrently limited the variability of dopamine levels in the mPFC of Observer mice (Fig. 6g) and slowed dopamine decrease. In line with the hypothesis that enhanced DAT function contributes to STD, we found that DAT depletion significantly promoted the preference for breath odors and Defeated mice (Fig. 6h), while attenuating STD (Fig. 6i). Conversely, opposite effects were observed upon DAT overexpression in this pathway (Fig. 6j–m).

Fig. 6. Lower dopamine levels induced by increased DAT in the mPFC cause depression-like behaviors after STD.

Fig. 6

a, b Schematic (a) and volcano image (b) showing isobaric tags for relative and absolute quantification-based quantitative proteomics of differently expressed proteins between STD-sensitive (STDs) and STD-insensitive (STDi) mice. n = 3. c Representative immunofluorescence images and quantitative analysis of dopamine transporter (DAT) expression in the mPFC of STDi and STDs mice. t5.034 = 2.915, P = 0.0329. n = 4. d Representative western blot image and statistic results of DAT expression in different groups. F2,12 = 14.94, P = 0.0006 for DAT; F2,12 = 19.50, P = 0.0002 for PDE10A. n = 5. e, f Schematic of viral injection strategy showing knocking-down DAT expression in mPFC projecting VTA DAergic neurons and behavioral tests. The Cre-expressing retrograde virus is injected into the mPFC to express Cre in the downstream VTA neurons, which initiate the Cre-dependent saCas9-DAT-KO system under TH promoter control (e). Representative image and statistic result showing decreased DAT (green) in mCherry+ (red) cells (f). t34.02 = 13.83, P < 0.0001. n = 30 cells from 3 mice. g DA levels and DA variations in the mPFC before and after 20-min watching social defeat at five time points during 10-day STD. DA variations at indicated time points = (DA before watch–DA after watch)/DA before watch × 100%. F2,12 = 23.24, P = 0.0003 for DA level; t3.660 = 3.409, P = 0.0311 for DA variation. n =  4. h, i Behavioral performance of mPFC Dat conditional knock-out mice in odors preference tests (urine odors and breath odors from Defeated mice), social interaction with Defeated mice (h), and in the OFT, EPM, and SPT following STD (i). For (h): t13.99 = 0.3467, P = 0.7340 for urine preference; t13.78 = 4.692, P = 0.0004 for breath preference; t10.12 = 3.716, P = 0.0039 for social preference. Center time in (i): F1,28 = 14.78, P = 0.0006 for interaction; P = 0.5374 for mCherry vs saCas9 Dat in Sham; P < 0.0001 for mCherry vs saCas9 Dat in STD. Open arms time in (i): F1,28 = 30.05, P < 0.0001 for interaction; P = 0.9977 for mCherry vs saCas9 Dat in Sham; P < 0.0001 for mCherry vs saCas9 Dat in STD. Sucrose preference in (i): F1,28 = 15.00, P = 0.0006 for interaction; P = 0.9598 for mCherry vs saCas9 Dat in Sham; P = 0.0002 for mCherry vs saCas9 Dat in STD. n = 8. j Schematic of the experimental design for overexpressing DAT in mPFC-projecting DAergic neurons. k Ratio of double-labeled DAT‑mCherry⁺ and TH⁺ neurons relative to single DAT‑mCherry⁺ or single TH⁺ neurons in the VTA. t3.999 = 6.037, P = 0.0038. n = 3. l and m Behavioral performance of mice with DAT overexpression in mPFC‑projecting DAergic neurons in odor preference tests (urine odors and breath odors from Defeated mice), social interaction with Defeated mice (l), and in OFT, EPM, and SPT following STD (m). t12.39 = 0.4095, P = 0.6892 for urine preference; t13.98 = 9.503, P < 0.0001 for breath preference; t12.12 = 14.60, P < 0.0001 for social preference. Center time: F1,28 = 3.316, P = 0.0793 for interaction; P = 0.8604 for Scramble vs DAT in Sham; P = 0.0114 for Scramble vs DAT in STD. Open arms time: F1,28 = 5.948, P = 0.0213 for interaction; P = 0.8604 for Scramble vs DAT in Sham; P = 0.0114 for Scramble vs DAT in STD. Sucrose preference: F1,28 = 9.273, P = 0.0050 for interaction; P = 0.9332 for Scramble vs DAT in Sham; P = 0.0002 for Scramble vs DAT in STD. n = 8. n mPFC DA levels and performance in the OFT and the EPM of mice after SDRI (selective DA reuptake inhibitor, vanoxerine, 2 mg/kg, i.p.), SSRI (selective serotonin reuptake inhibitor, fluoxetine, 2 mg/kg, i.p.), and SNDRI (toludesvenlafaxine, serotonin-norepinephrine-dopamine reuptake inhibitor, 2 mg/kg, i.p.) treatment during STD. DA level: F3,40 = 3.507, P = 0.0238 for interaction; P = 0.0417 for Saline vs SDRI in Sham; P = 0.0211 for Saline vs SNDRI in Sham; P = 0.0003 for Saline vs SDRI in STD; P < 0.0001 for Saline vs SNDRI in STD. Center time: F3,56 = 16.66, P < 0.0001 for interaction; P < 0.0001 for Saline vs SDRI and Saline vs SNDRI in STD. Open arms time: F3,56 = 7.795, P = 0.0002 for interaction; P = 0.0002 for Saline vs SDRI; P < 0.0001 for Saline vs SNDRI in STD. n = 6 for DA level determination, and n = 8 for behavioral tests. o Mice performance in the open field test and elevated plus maze test after the D1R agonist (PF-06649751, 1 mg/kg, i.p.), the D1R antagonist (SCH-23390, 1 mg/kg, i.p.), the D2R agonist (pramipexole, 1 mg/kg, i.p.), or the D2R antagonist (clozapine, 1 mg/kg, i.p.) treatment during STD. Center time: F4,70 = 28.01, P < 0.0001 for interaction; P < 0.0001 for Saline vs D1R agonist; P < 0.0001 for Saline vs D2R agonist. Open arms time: F4,70 = 21.33, P < 0.0001 for interaction; P < 0.0001 for Saline vs D1R agonist; P = 0.0028 for Saline vs D2R agonist. n = 8. Two-tailed unpaired Welch’s t-tests for (c, f, h, k, and l); Two-tailed Kolmogorov–Smirnov test for (g); One-way ANOVA with Tukey’s multiple comparisons test for (d); Two-way ANOVA with post‑hoc Fisher’s LSD tests for (i, m, n, and o). Data are mean ± s.e.m. *P < 0.05, **P < 0.01, and ***P < 0.001.

To further investigate whether targeting the dopamine system can alleviate STD-associated depression, Observer mice were administered vanoxerine (a DAT inhibitor) and toludesvenlafaxine (a serotonin-norepinephrine-dopamine reuptake inhibitor) after STD process, both of which elevate dopamine levels in the mPFC. Fluoxetine (a selective serotonin reuptake inhibitor), which does not alter dopamine levels in the mPFC, was used as a control (Fig. 6n). We found that depression-like behaviors in Observer mice were significantly attenuated by vanoxerine and toludesvenlafaxine, but not by fluoxetine (Fig. 6n). Similarly, depressive behaviors were also ameliorated by PF-06649751 (a D1 receptor agonist), but not by pramipexole (a D2 receptor agonist) (Fig. 6o), suggesting a D1 receptor-dependent mechanism. Collectively, these results demonstrate the critical role of DAT‑mediated exaggerated dopamine variation in the mPFC during the pathogenesis of STD.

Discussion

Some studies suggest that affective empathy may constitute a risk factor for depression34,35. However, the underlying mechanisms and neural circuits remain unclear. Using a mouse STD model, we identified a critical role of the olfactory system in mediating emotional state communication (Fig. 1j, k, m). Consistent with previous findings, the transfer of emotional states refers to the phenomenon by which an individual’s emotional state can be influenced by that of their social counterparts14,36. While the sense of smell was highly degraded in humans, relying more on sight and hearing37, higher brain regions integrating sensory information, such as mPFC and VTA, might still share consistent mechanisms with rodents. Furthermore, our findings highlight the complexity of social interactions, in which empathy-like behaviors can coexist with both reward processing and aversion processing.

Here, we identify both the olfactory circuits and molecular mechanisms that mediate STD. For olfactory circuits, we demonstrate urine odors of Defeated mice triggered social avoidance via the AOB-MeAGABA pathway, whereas breath odors promoted attraction through the MOB-PiCGlu pathway (Fig. 2a, l). The MeA GABAergic neurons, which receive direct inputs from AOB mitral cells encoding pheromonal signals, have been shown to be involved in pheromone detection38,39. While the MeA is known to encode prosocial helping behavior during conspecific distress40, our study reveals its additional role in mediating aversive responses. Furthermore, activation of the MOB-PiCGlu-mPFCGlu pathway evoked dopamine release from the VTA, thereby enhancing social preference for Defeated mice (Fig. 2f, h). This pattern is consistent with VTA activation observed in the vicarious social defeat model41, implying the involvement of the reward system. Susceptible Observer mice exhibited elevated DAT expression and reduced basal dopamine levels in the mPFC (Fig. 6a–d). This DAT-dependent amplification of prefrontal dopamine fluctuations directly mediates STD, suggesting that blunted reward processing underlies the depression‑like behaviors observed in these mice42. Together, these findings delineate the olfactory neural circuits governing STD and establish DAT as a potential therapeutic target for empathy-linked depression (Fig. 7).

Fig. 7. A proposed model for olfactory system‑mediated STD.

Fig. 7

When social defeat stress was applied to cage-mate mice, a significant reduction in dopamine levels within the mPFC of Observer mice (Dopamine level graph). During subsequent social interaction with these stressed, defeated conspecifics, attractive and aversive olfactory cues from the Defeated mice preferentially activate the MOB‑PiC and AOB‑MeA pathways, respectively. Both the glutamatergic MOB‑PiC and GABAergic AOB‑MeA pathways converge onto the same population of excitatory neurons in the mPFC. Concurrently, social interaction with Defeated conspecifics activates the VTA, which elevates dopamine levels in the mPFC and mediates the Observer’s preference for Defeated mice (Right part). This elevation in mPFC dopamine, in turn, upregulates DAT expression in mPFC projecting dopamine neurons (Lower left part). Compared with STDi mice, STDs mice exhibit higher DAT expression, leading to lower basal dopamine levels in the mPFC. Exaggerated fluctuations in dopamine dynamics (characterized by repeated decreases and increases) thereby drive the emergence of depression‑like behaviors in Observer mice.

Dopamine signaling in the mPFC is subtly regulated by the VTA and governs a broad range of functions, including working memory, sensory discrimination, stress reactivity, emotional–behavioral regulation43, as well as complex social behaviors such as social dominance and affective empathy44. In the present study, we observed that heightened social interaction toward defeated conspecifics is promoted by mPFC dopamine, consistent with evidence that mesocortical dopamine dysfunction in schizophrenia and depression is also accompanied by impaired empathic processing45. While the canonical reward pathway relies on VTA‑NAc projections46, our findings indicate that social interaction with defeated partners carries intrinsic rewarding value reflected by increased dopamine levels in the mPFC, in line with prior work showing that VTA dopaminergic neurons mediate social isolation‑induced social craving through projections to the mPFC rather than the NAc31; notably, VTA dopamine neurons receiving input from the mPFC project back to the mPFC but not to the NAc32, leading us to conclude that an olfactory system‑mPFC‑VTA‑mPFC feedback loop serves as a key regulator in STD (Fig. 7). Although the rewarding effects of dopamine represent a critical driver of social decision‑making, multiple stress‑sensitive brain regions including the hypothalamus47 and amygdala48,49 are also implicated in decision-making and stress susceptibility, and their specific roles in STD warrant further investigation.

To clarify our interpretation, we emphasize that temporal, dynamic changes in PFC dopamine levels across three distinct phases—rather than static dopamine concentration alone—are critical for STD (Fig. 7): the sensory phase (immediately after witnessing social defeat) is characterized by acute dopamine reduction in the mPFC of Observer mice with social avoidance (Supplementary Fig. 3 and Fig. 6g); the interaction phase involves dopamine elevation triggered by social stimuli (e.g., breath odors) that promotes social interaction, an essential prerequisite for STD (Figs. 1m and 4f); and the expression phase (depression-like state) is defined by sustained dopamine reduction accompanied by increased DAT expression (Figs. 5p and 6a, d, g). Notably, higher dopamine elevation at the second timescale (measured by fiber photometry) during social interaction correlates positively with STD susceptibility (Figs. 3d and 4f), while lower dopamine levels at the minute timescale (measured by ELISA) from elevated DAT expression are associated with the STD-sensitive phenotype (Fig. 6d, g, n), leading us to propose that dynamic dopamine changes across these phases underlie STD progression and our focus on dopamine variation over static levels.

Even so, we acknowledge that the final depressive phenotype was induced by a reduction in dopamine levels. However, we used the term “dopamine variation” in our final conclusion to emphasize that, unlike depression triggered by direct physical stress (i.e., unavoidable stress), in the STD paradigm, Observer mice had the option to move away from their defeated partner and thus avoid developing depression-like behaviors. Notably, mPFC dopamine levels increased when Observer mice engaged in social interaction with the defeated partner, prompting them to choose interaction over avoidance. If observer mice instead avoided their defeated partner, STD would not have occurred. Therefore, although the final depressive phenotype was driven by decreased dopamine levels, the entire STD process relies on dynamic fluctuations in dopamine levels, involving both increases and decreases.

The findings indicated that higher variation of dopamine contributed to the emergence of depression-like behaviors in the STDs mice. Considering the theory of dopaminergic neurons coding reward-prediction errors, amplitude of dopamine fluctuations predicted the degree of reward/aversion50. Some depression causes, such as disappointment after expectation51, post-cocacine use depression52, and larger dopamine fluctuation in adolescent leading depression53, are consistent with the present findings. Besides, inhibiting DAT or activating the dopamine system in the mPFC mitigated the effects of STD. Currently, the low efficacy of depression treatments may stem from ignoring the distinct etiological origins of psychological stress. Mental stress could generally be categorized into two types, namely vicariously experienced stress and personally experienced stress54. Herein, our results suggested that targeting the dopamine system might be more effective in alleviating depression symptoms of vicariously experienced stress compared to targeting the serotonin system. Beyond DAT, a comprehensive understanding of how other proteins mediate the differences between STDs and STDi remains to be established. Moreover, other stress-induced adaptations in the VTA-PFC pathway unrelated to DAT regulation—such as enhanced glutamatergic drive onto VTA dopamine neurons projecting to the PFC55,56—may also contribute to the magnitude of STD. Above all, our results provide valuable insights into therapeutic strategies for depression associated with affective empathy. Additionally, we offer a tentative framework for developing subtype-specific antidepressant treatments based on etiology—distinguishing between depression caused by direct stress exposure and that arising from vicarious stress as a bystander.

One key limitation of the present study is the exclusive inclusion of female mice, which constrains the generalizability of our findings regarding sex-dependent mechanisms of STD. While the social defeat model has documented STD phenotypes in both male and female mice2, mounting evidence indicates that STD exhibits pronounced sex-specific patterns across murine models and human cohorts. For instance, murine mixed-housing paradigms with stressed conspecifics elicit divergent depressive phenotypes: males display heightened immobility in forced swim tests, whereas females manifest antidepressant-like responses57. This animal model-based sexual dimorphism aligns with clinical observations showing stronger mother-to-daughter intergenerational transmission of depression58, and a greater vulnerability of adolescent girls to social stress-induced internalizing symptoms compared with boys59. Mechanistically, these sex-specific trajectories are likely underpinned by differential regulation of the hypothalamic-pituitary-adrenal axis and inflammatory pathways: ovarian hormone fluctuations modulate stress susceptibility and inflammatory reactivity in females60, who also exhibit stronger correlations between proinflammatory cytokine levels and social disconnection61. Collectively, these findings highlight the critical shortcomings of male-centric preclinical research and underscore the imperative of integrating sex as a core biological variable in STD investigations. Future studies should dissect the hormone-neuroimmune crosstalk to unravel evolutionarily conserved sex biases in STD, thus facilitating the development of personalized therapeutic strategies.

Social transmission of emotions is a complex, multidimensional process critical to social interaction. In humans, it enables empathy and understanding of others’ feelings62,63, strengthening social bonds. Impairments in this process are linked to various psychiatric and neurological disorders, including psychopathy and autism6466. Elucidating the neural mechanisms of empathy thus carries both scientific significance and translational potential for promoting prosocial behavior and treating social dysfunction. Our findings provide valuable insights that may inform therapeutic strategies for neuropsychiatric conditions such as autism, depression, and schizophrenia.

Methods

Animals

Male C57BL/6J mice (10–12 weeks old; Vital River, Beijing, China) and male CD-1 mice (12–16 weeks old; Vital River) were utilized to establish the chronic social defeat stress paradigm. All mice were housed under a 12-h light/dark cycle (lights on at 7:00 AM, lights off at 7:00 PM) with unrestricted access to food and water. Ambient temperature was controlled at 23 ± 1 °C, with relative humidity kept at 55 ± 5%. Mice had ad libitum access to standard chow and filtered water throughout the experiment. All experiments performed were approved by the Fourth Military Medical University, Institutional Animal Care and Use Committee. Male littermates were randomly assigned to either the experimental or the control group. Behavioral tests on the healthy 10–18 weeks-old mice were conducted, and electrophysiological slice experiments involving whole-cell patch clamp recordings were performed on P50–60 mice.

Drugs

For chemogenetic modulation of neuronal excitability, mice pre-expressing designer receptors exclusively activated by designer drugs (DREADDs) received an intraperitoneal (i.p.) injection of CNO (catalog. HY-17366, MedChemExpress, Shanghai, China) at a dose of 1 mg/kg 30 min prior to daily STD procedures. For pharmacological interventions (Fig. 6), the following compounds were administered i.p. daily for 1 week to Observer mice after STD: Selective dopamine reuptake inhibitors: vanoxerine (catalog. HY-13217A, MedChemExpress; 2 mg/kg)67,68 and toludesvenlafaxine (catalog No. HY-U00096A, MedChemExpress; 2 mg/kg)69,70; Selective serotonin reuptake inhibitor: fluoxetine (catalog No. HY-B0102, MedChemExpress; 2 mg/kg)71; Dopamine D1 receptor (D1R) modulators: agonist PF-06649751 (catalog No. HY-119486, MedChemExpress; 1 mg/kg)72,73 and antagonist SCH-23390 (catalog. HY-19545, MedChemExpress; 1 mg/kg)74,75; Dopamine D2 receptor (D2R) modulators: agonist pramipexole (catalog. HY-B0410, MedChemExpress; 1 mg/kg) and antagonist clozapine (catalog. HY-14539, MedChemExpress; 1 mg/kg)76,77. An equal volume of saline was injected as control.

Social transmission of depression (STD)

The STD model was adapted and modified as previously reported21,78. Naïve male C57BL/6J mice were housed in pairs as cage mates for at least 2 weeks, and subsequently assigned to either Observer or Defeated mice. The STD was defined as two phases, namely the social defeat phase and the interaction phase. In the social defeat phase, social defeat was performed with small modifications as described previously79. Briefly, male CD-1 mice exhibiting consistent attacking latency (less than 30 s on three consecutive screening tests) were housed in cages equipped with perforated Plexiglas dividers, permitting sensory but not physical contact. An Observer mouse was placed in the empty compartment adjacent to the CD-1 aggressor, while a Defeated mouse was placed in the compartment containing the CD-1 aggressor. During this stage, the Defeated mouse was attacked by the CD-1 aggressor and exhibited a defensive posture. After 20 min, the Defeated mouse was returned to the Observer mouse for overnight social interaction phase. This procedure was performed daily for 10 consecutive days. Each day, the paired Observer mouse and Defeated mouse were transferred to a new cage housing a novel CD-1 mouse. The Observer mouse then witnessed its paired partner being defeated by the novel CD-1 mouse. Throughout the entire procedure, Observer mice remained physically separated from CD-1 mice. In this model, the term “watched” refers to the integrated sensory stimuli experienced by Observer mice in association with Defeated mice, rather than visual cues alone. In parallel, control (Con) mice were pair-housed and subjected to daily transfers on each side of a perforated Plexiglas partition with a CD-1 mouse on the other side for 10 days. The two paired mice in control cages were tested as Con mice. Behavioral tests were performed 24 h after the last social defeat session, following the sequence shown in Fig. S1A. Naïve mice were defined as mice without any handling.

Behavioral testing

Behavioral tests of Con, Defeated, and Observer mice began 24 h after the last social defeat. For naïve mice, indicated behavioral tests were carried out after 2-week habituation breeding.

Open field test (OFT)

The OFT was conducted as described previously80. The test was carried out in the open fixed, a square arena with clear Plexiglas walls and floor, with mice placed inside an isolation chamber (44 × 44 × 30 cm) equipped with dim illumination and a fan. Mice were positioned in the center of the box and permitted to explore freely for 15 min. In all behavioral tests, mice were videotaped using cameras and analyzed with a DigBehv software (Jiliang, Shanghai, China).

Elevated plus maze (EPM)

The EPM was performed 2 h after the open field test on the same day, as previously described81. The apparatus comprised of two open arms (25 × 8 × 0.5 cm) and two closed arms (25 × 8 × 12 cm) that extended from a common central platform (8 × 8 cm). The apparatus elevated to a height of 50 cm above the floor. Mice were allowed to habituate to the testing room for 2 days prior to the test, and pre-treated with gentle handling twice per day to eliminate their nervousness. For each test, individual animals were placed in the center square, facing an open arm, and allowed to move freely for 5 min. The number of entries and time spent in each arm were recorded using a DigBehv software (Jiliang).

Social interaction test (SIT)

A “Classic” social interaction test was conducted on Con, Defeated, and Observer mice for 20 min to evaluate the STD score. In the social interest test, the experimental mice were allowed to freely explore in an OFT box (44 × 44 × 30 cm) containing two perforated plexiglass cages (10 × 6 cm) centered against two opposite walls of the arena under red lighting82. In one box, an unfamiliar mouse was placed (target cage), while a same size object was placed in the other cage (Con cage). Time spent in the “target zone” (14 × 26 cm) surrounding the target cage, “Con zone” (14 × 26 cm) surrounding the Con cage was measured using video tracking software (DigBehv software). Motion trails of the experimental mice were also visualized. The social interaction ratio was calculated as: social interaction ratio = ([time in target zone]/[time in Con zone]) × 100%. The distance traveled and the velocity were recorded during the Con zone to avoid potential biases arising from the social interaction behaviors and potential motor ability variations. Social cue ports were constructed out of metal and boiled in detergent, rinsed thoroughly with water, dipped in 3% hydrogen peroxide and ethanol, rinsed again with running distilled water, and air-dried to clean off any contaminants between experiments.

Social preference test

The social preference test was conducted for 20 min prior to the last STD training in naïve mice. Modified from the classic social interaction test, a Defeated mouse was placed in the target chamber, while a Con mouse was placed in the opposite chamber. Social preference was calculated as: Social preference (%) = (Time in Defeated mouse zone/Time in Con mouse zone) × 100%. To assess the preference of naïve mice towards anesthetized Defeated or Con mice, the Defeated and Con mice were anesthetized with pentobarbital sodium (i.p., 50 mg/kg) 10 min before the commencement of the test. When evaluating the preference for sheltered Defeated or Con mice, the cages housing Defeated or Con mice were covered with opaque non-woven fabric. For examining the preference of naïve mice for Defeated or Con mice in a closed-box environment, both the cages housing Defeated or Con mice and the OFT apparatus were modified. The inner walls of the cages positioned within the OFT apparatus were rendered airtight. These cages shared certain wall sections with the OFT apparatus, and the shared walls were perforated to enable airflow for respiratory exchange among mice while preventing odor leakage into the OFT chamber.

Olfactory preference test

For body odors stimuli experiments, mice were tested as described above, but Defeated mice were replaced with cotton balls, which had been swiped throughout the body, head, and anogenital areas of Defeated mice. Odors collected from Con mice were placed in the Con zone. For urine odors stimulation experiments, testing was performed as previously described, with cotton balls soaked in urine from Defeated mice placed inside perforated plexiglass cages in the target zone, and urine collected from Con mice used in the Con zone. Urine preference was calculated as: urine preference = (time spent in the Defeated urine zone/time spent in the Con urine zone) × 100%. For odors stimulation experiments with epinephrine (catalog HY-B0447, MedChemExpress), thyroxine (catalog HY-101406R, MedChemExpress), and corticosterone (catalog HY-B1618, MedChemExpress), cotton balls soaked with the indicated concentrations of each compound were placed inside perforated plexiglass cages in the target zone, whereas cotton balls soaked in saline were placed in the Con zone. The time spent in each zone was recorded by a video camera. For breath odors stimuli experiments, breath odors was collected into an air bag using a mask worn by the Defeated mice under anesthesia. The mask was connected with the air pump at a rate of 1 mL/min, and the collected odors was released also through a pipe by the air pump at a rate of 1 mL/min. The open ends of the pipes releasing breath odors from Defeated mice and Con mice were affixed to the walls of the target and Con zones, respectively. Both of them were freely accessible for the tested mice. The breath preference was calculated as: breath preference = ([time in zone of breath from Defeated mice]/[time in zone of breath from Con mice]) × 100%.

Tail suspension test (TST)

Tail suspension test was performed in a quiet room as described previously83. Each mouse was suspended 50 cm above the floor and a small piece of adhesive taped to a wooden stick near the end of the mice tail about 2 cm, and the mice views were surrounded by a barrier. TST was carried out for 6 min, during which the immobility time was recorded and calculate. Mice were considered immobile when they exhibited signs of hopelessness, with minimal or complete lack of movement.

Forced swimming test (FST)

Swimming sessions were carried out by placing mice individually in glass cylinders (30 cm height × 10 cm diameter) filled with water at 23–25 °C to a depth of 25 cm, ensuring that the mice could not touch the bottom with their paws or tail. This procedure was adapted from previously reported methods (54). Two swimming sessions were conducted: an initial 15-min pre-test (designed to induce behavioral despair) followed by a 5-min test 24 h later. Only situations in the second test were analyzed using software. Following every swimming session, each mouse was dried, warmed, and returned to its home cage.

Sucrose preference test (SPT)

As reported previously84, before the first time of the test, all mice were trained to get accustomed to 1% sucrose solution (w/v) in their home cages. Two bottles of 1% sucrose solution were placed on each cage for 24 h. For the following period of 24 h, 1% sucrose in one bottle was replaced with pure water. Upon adaptation, mice were deprived of food and water for 24 h, followed by SPT the next morning, in which the mice were fed with two pre-weighed bottles of liquid at the same time: one containing 1% sucrose solution and the other containing pure water. The bottles were counterbalanced across the left and right sides of the cages throughout the experiment to avoid position preference effects. After 12 h, the two bottles were re-weighed. Sucrose preference percentage was calculated using the following formula: Sucrose preference (%) = (volume of consumed sucrose solution / total liquid intake [volume of sucrose solution plus volume of consumed water]) × 100.

Novelty-suppressed feeding test (NSFT)

This test was performed as described previously85. Specifically, the mice were deprived of food in the home cage 24 h before testing. One food pellet was placed on a piece of round filter paper (12.5 cm in diameter) at the center of the acrylic testing chamber (50 × 50 × 40 cm), with the floor covered with bedding. Subsequently, the mice were placed in a corner of the chamber. The latency to approach and to initiate feeding on the food was measured for a maximum duration of 5 min under 140 lux illuminations in center and 120 lux illuminations in the periphery.

STD score calculating

The STD score served as an indirect metric to gauge the extent to which each mouse was affected by its defeated cagemate. Every Observer mouse underwent seven distinct behavioral tests. These tests included the OFT, EPM, TST, FST, SPT, NSFT, and SIT. The behavioral tests were performed with the sequence of behavioral tests depicted in Fig. S1A. STD scores were assigned based on performance relative to the mean values of Con mice: a score of +1 was added for performance 1 standard deviation (SD) worse than the Con mean, a score of −1 was subtracted for performance 1 SD better than the Con mean, and a score of 0 was assigned for performance within 1 SD of the Con mean. In each behavioral test, every mouse was assigned a numerical score distinct from −1, 1, and 0. The STD score for each mouse was calculated as the sum of its scores across seven different behavioral tests. Mice with an STD score of ≥ 1 were identified as STD-sensitive (STDs) individuals. Those with an STD score of ≤ −1 or lower were classified as STD-insensitive (STDi) individuals. Mice with an STD score of 0 (the remaining cohort) were designated as the “Undefined” subgroup and subsequently excluded from the final high-throughput proteomic analysis. This exclusion was performed to eliminate potential confounding effects that might interfere with comparative analyses between the STDs and STDi subgroups. This classification method was adapted from the approach used to distinguish depression-resilient and depression-sensitive mice86. This would then allow for using STD scores for regressions with some of the other measures, and not only to classify individuals as either STDs or STDi mice.

Collection and analysis of Breath odors from Defeated mice

Firstly, Defeated mice were anaesthetized with 250 mg/kg tribromoethanol (catalog. T48402, Sigma, St. Louis, MO, USA). Carprofen (5 mg/kg, catalog. HY-B1227, MCE) was administered subcutaneously before and after surgery for analgesic purposes. Breath odors were collected using a mask connected to an air pump at a rate of 1 mL/min. The air flow was further collected in a 15 mL tube, which was frozen with liquid nitrogen and stored at −80 °C before further analysis. Analysis of samples was performed by GC-MS combined with thermal desorption as previously described87. Volatile organic compounds (VOCs) were desorbed and concentrated in a thermal desorber (Unity®, Markes International Limited, Bridgend, UK) at 250 °C onto a −10 °C cold trap for 6 min (helium flow 50 mL/min). The cold trap, packed with the same sorbents as the sorbent tubes, was subsequently heated rapidly to 250 °C, and VOCs were transferred to a gas chromatograph (HP6890N, Agilent Technologies, Santa Clara, CA, USA). Column (capillary column, HP5MS, 30 m × 0.25 mm × 0.25 μm film thicknesses, Agilent Technologies) temperatures were programmed as follows: −40 °C for 1 min, 4 °C/min to 180 °C, 0.10 min hold, and 30 °C/min to 300 °C, 0.25 min hold. Liquid nitrogen was used as the cryogen. Column head pressure of helium carrier gas was set to 10 psi. Purity of helium was at least 6.0, and a helium purifier (Alltech Associates, Deerfield, IL, USA) was utilized to further increase the purity. VOCs were identified using a mass spectrometer (HP5973, Agilent Technologies) with a mass range of 30–350 amu.

Enzyme-linked immunosorbent assay (ELISA)

Following behavioral tests, mice were sacrificed. The brain tissues were lysed in phosphate-buffered saline (PBS), and the supernatant was collected from lysate centrifuged at 3000 × g for 15 min at 4 °C and stored at −80 °C for subsequent analysis. ELISA was carried out as manufacture using commercially available kit used to quantify mouse Dopamine (catalog No. RK00642, ABclonal, Wuhan, China), Epinephrine (catalog No. E-EL-0045c, Elabscience, Wuhan, China), Thyroxine (catalog No. EIAT4CX10, Thermo Fisher Scientific, Waltham, MA, USA), Corticosterone (catalog No. EIACORT, Thermo Fisher Scientific) in urine or mPFC according to the manufacturer’s instruction. The final dopamine level in each sample was normalized to the total protein content, which was determined using the bicinchoninic acid protein assay.

Viruses

AAV2/9-hSyn-hM4Di-mCherry, AAV2/9-hSyn-DIO-hM4Di-mCherry, AAV2/9-hSyn-mCherry, AAV2/9-hSyn-DIO-GFP, AAV2/Retro-GFP, AAV2/Retro-hSyn-Cre, AAV2/Antero-hSyn-Cre, AAV2/Antero-hSyn-Flp, AAV2/9-hSyn-fDIO-RVG, AAV2/9-hSyn-Cre-ON/Flp-ON-mCherry, AAV2/9-mGAD1-mCherry, AAV2/Retro-hSyn-hM4Di, AAV2/Retro-hSyn-hM3Dq, AAV2/9-hSyn-DIO-Flp, AAV2/9-hSyn-fDIO-mWGA-Cre, AAV2/9-hSyn-DIO-mWGA-Flp, AAV2/9-hSyn-DIO-jRGECO1a, AAV2/9-hSyn-fDIO-GCaMP6s, AAV2/9-hSyn-DIO-DA2m, AAV2/Retro-Th-Dat-mCherry and AAV2/9-Th-DIO-saCas9-pA-U6-sgRNA.Dat were purchased from Taitool Bioscience (Shanghai, China). AAV2/9-fDIO-mWGA-GFP and AAV2/9-DIO-mWGA-mCherry were sourced from Braincase (Shenzhen, China). The sgRNA.Dat1 sequence was reported by Larry Zweifel (CATCTTGGTCAAGGAGCAGAA, Addgene plasmid # 159902; http://n2t.net/addgene:159902; RRID: Addgene_159902). All AAV titers ranged from 0.2–3.0 × 1013 genomic copies per mL.

Stereotaxic virus injection and optical fiber implantation

Mice were anesthetized with gaseous isoflurane and placed on a stereotaxic apparatus (RWD Life Science, Shenzhen, China). The eyes were covered using a drop of ophthalmic ointment to prevent drying. Upon shaving the hair and cleaning the incision site with iodine and medical alcohol, the scalp was incised to expose the skull. The connective tissue was gently removed from the skull surface with cotton swabs. A small craniotomy hole was made using a dental drill (catalog. 78001, RWD Life Science). Small craniotomy holes (~1 mm diameter) were drilled using microscope for virus injection. Virus was injected stereotaxically into bilateral mPFC (AP, +1.9 mm; LM, ± 0.3 mm; DV, −2.7 mm), MOB (AP + 4.2 mm; LM ± 0.5 mm; DV, −2.2 mm), AOB (AP, +3.2 mm; LM, ± 0.9 mm; DV, −2.3 mm), MeA (AP −1.4 mm; LM ± 1.8 mm; DV, −5.5 mm), PiC (AP −1.5 mm; LM ± 3.5 mm; DV, −5.0 mm), and VTA (AP −3.3 mm; LM ± 0.5 mm; DV, −4.5 mm) via a micropipette (WPI, Sarasota, FL, USA) connected to a microsyringe pump (Nanoliter, WPI) and its controller (Micro21, WPI) at a speed of 30 nL/min. Following injection, the glass micropipette was left in place for an additional 5 min before being slowly withdrawn. Then, the wound was sutured, and antibiotics (bacitracin and neomycin) were applied. Mice were allowed to recover from anesthesia under a heat lamp. Pathway-specific labeling is achieved only when all viral components are present, further supporting the high specificity of our intersectional targeting approach.

In vitro electrophysiological recordings

Electrophysiological recordings were conducted following a modified protocol as previously described88. Briefly, mice were anesthetized with sodium pentobarbital (80 mg/kg, intraperitoneal injection), followed by perfusion with ice-cold slicing buffer bubbled with 95% O2/5% CO2 to maintain neuronal viability. Mice were subsequently decapitated, and whole brains were promptly isolated to preserve neuronal function. Acute coronal brain slices (300 μm in thickness) containing the target brain region were prepared using a vibratome (VT 1200S; Leica, Wetzlar, Germany) and immediately transferred into oxygenated artificial cerebrospinal fluid (ACSF) maintained at 32 °C for 30 min to facilitate recovery. Prior to recordings, slices were allowed to equilibrate at room temperature (~22 °C) for a minimum of 30 min. During electrophysiological recordings, brain slices were placed in a submerged recording chamber and continuously perfused with oxygenated ACSF at a flow rate of 2 mL/min via gravity, with the ACSF temperature maintained at 30 °C. The target region was visualized using a 5× objective lens, and individual neurons within this region were observed under a 40× water-immersion objective lens using infrared differential interference contrast (IR-DIC) video microscopy (BX51WI; Olympus, Tokyo, Japan). Recordings were targeted to the somata of neurons in the designated region. Patch pipettes (4–6 MΩ resistance when filled with intracellular solution) were pulled from borosilicate glass capillaries using a PC-100 micropipette puller (NARISHIGE, Tokyo, Japan). Electrophysiological signals were amplified using an Axon MultiClamp 700B amplifier (Molecular Devices, CA, USA) and converted to digital signals via an Axon 1440 A Digidata analog-to-digital converter (Molecular Devices). Signals were sampled at a rate of 10 kHz and low-pass filtered at 2 kHz. All data were collected and stored using pCLAMP™ 10.3 software (Molecular Devices).

Fiber photometry

Mice were anesthetized with isoflurane (induction: 3–5% in oxygen; maintenance: 1.5–2% in oxygen) delivered via a vaporizer. Anesthesia depth was monitored continuously by observing the absence of tail pinch reflex and stable respiratory rate (60–80 breaths per minute) to avoid excessive anesthesia or wakefulness that might affect neural activity signals. Unilateral implantation of an optical fiber patch cord (outer diameter: 200 μm, numerical aperture (NA): 0.37, Inper, Hangzhou, China) was performed targeting either the mPFC or the VTA of the mice. The optic fiber (Thinker Tech Nanjing Biotech Co., Ltd.) had a diameter of 100 μm, an NA of 0.22, and a length of 3 mm for mPFC stimulation or 7 mm for VTA stimulation. It was precisely targeted to the same location as the virus injection site. Subsequently, dental cement was applied to cover the skull, and the cement was allowed to harden for 10 min to secure the implant. Behavioral experiments were performed at least 3 weeks post-surgery. Mice were employed for further experiments three weeks after injection. Virus injection sites and optical fiber placements were confirmed postmortem in all animals. GCaMP6s or dopamine fluorescence signals from mPFC or VTA neurons were captured using a fiber photometry system (RWD Life Science) as reported previously89. Specifically, 470 nm, 560 nm and 410 nm laser beams were sequentially directed into the fluorescence cube and subsequently coupled into the optical fibers, with the 410 nm laser employed for motion control. The emission fluorescence from GCaMP6s, dopamine, and control was captured by the camera at 20 Hz. In vivo recordings were carried out in an open-top home cage (21.6 × 17.8 × 12.7 cm) for 10 min. The photometry signal F was calculated as F470/F410 or F560/F410, the relative change in signal (∆F/F) was determined using the formula ∆F/F = (FF0)/F0, where F0 represents the median of the photometry signal. Only calcium signals over 3 SD were treated as events. The average of 10 peak ∆F/F and the number of events per minute were analyzed for each mouse.

DREADD experiment

CNO was dissolved in Dimethyl sulfoxide (catalog. D2650, Sigma) to a stocking solution of 0.4 g/mL and diluted with saline (0.9% NaCl solution) to a working concentration of 0.2 mg/mL. Stocking solution was stored at 4 °C, and fresh CNO solution was prepared each day prior to experiments. In STD regulation experiments, saline or CNO (1 mg/kg, i.p.) was administered daily to the mice during STD process in the blind design.

Lesion of dopamine neurons

The neurotoxin 6-OHDA (catalog. HY-B1081A, MedChemExpress) was used to deplete dopamine neurons/projections with slight modifications90. Before conducting the dopamine neuron lesion surgery, mice were anesthetized using isoflurane inhalation. Specifically, isoflurane was delivered through a dedicated anesthesia mask, with an induction concentration of 4–5% in oxygen to achieve rapid sedation, followed by a maintenance concentration of 2–2.5% in oxygen to sustain stable anesthesia. The stereotaxic microinjection of 6-OHDA (2.5 µg/µL, in saline with 0.2 mg/mL ascorbic acid) was applied for the local depletion of dopaminergic terminals in the targeted regions. Moreover, the 6-OHDA was bilaterally injected (200 nL per site) into the mPFC. Three weeks after 6-OHDA injection, mice were subjected to behavioral tests and subsequently sacrificed for verification of dopaminergic terminal loss via TH-staining.

Immunohistochemistry

For mice used in immunohistochemical analysis, deep anesthesia was induced and maintained with an intraperitoneal injection of pentobarbital sodium (50 mg/kg body weight). For the c-Fos staining depicted in Fig. 2a, mice were sacrificed immediately following a 30-min exposure. During this exposure, they were presented with either urine-contaminated cotton or breath odors. The breath odors was delivered via a tube, propelled by an air pump. In Fig. 3a, mice were sacrificed 24 h after the last STD for to perform c-Fos staining. In Supplementary Fig. 6, mice were classified into two groups: STDs and STDi mice, based on their STD score. After another 24-h social interaction with their respective defeated partners, these mice were euthanized for further analysis. Mice were anaesthetized using isoflurane and then perfused transcardially with ice-cold PBS (pH 7.4), followed by 4% paraformaldehyde (PFA). Following an overnight fixation in 4% PFA solution, brains were cryoprotected in a 30% sucrose solution for 1 day. Coronal sections (40 μm) were cut on a microtome (CM1950, Leica), collected in PBS, and stored at 4 °C for further use. The following antibodies were used in this study: rabbit anti-DAT (1:200; Clone No. ARC66721, catalog No. A25875; ABclonal), rabbit anti-TH (1:200; catalog No. A25683, Clone No. ARC67477; ABclonal), rabbit anti-GAD1 (1:200; Clone No. EPR20578, catalog No. ab213508; Abcam, Cambridge, UK), rabbit anti-vGlut1 (1:200; Clone No. EPR22269, catalog No. ab227805; Abcam, Cambridge, UK), rabbit anti-c-Fos (1:200; Clone No. 9F6, catalog No. 2250; Cell Signaling Technology, Danvers, MA, USA), mouse anti-Cre (1:200; Clone No. 7-23, catalog No. C7988; Merck, Darmstadt, Germany), Alexa Fluor 546-conjugated goat anti-rabbit IgG (1:200; catalog No. A-11010; Thermo Fisher Scientific, Waltham, MA, USA), and Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:200; catalog No. A-11094; Thermo Fisher Scientific, Waltham, MA, USA). Slices for verifying the injection site were counterstained with DAPI. Fluorescent images were captured using an Olympus Fluoview FV1000 confocal microscope (Tokyo, Japan).

Proteomics

Proteomics analysis was carried out by Beijing Genomics Institution (BGI, Beijing, China) as described previously91. Mice were anesthetized with isoflurane, and their brains were excised. The mPFC tissue was rapidly hand-dissected and frozen in liquid nitrogen. Three pairs of mPFC samples from STDs mice and STDi mice were utilized for proteomic analysis. Tissues protein were extracted using lysis buffer. The samples were then sonicated on ice and centrifuged at 4 °C, 17,000 × g, for 30 min. The supernatants were collected and used for BCA protein quantification. Same amount of protein (100 µg each sample) was digested with Trypsin Gold (Promega, Madison, WI, USA) (30:1, protein: trypsin) at 37 °C for 16 h and labeled according to the manufacture’s protocol for 4-plex iTRAQ reagent (Applied Biosystems, Foster City, CA, USA). The labeled peptide mixtures underwent fractionation via strong cation exchange chromatography (LC-20AB HPLC Pump system, Shimadzu, Kyoto, Japan). For LC-ESI-MS/MS analysis, the peptides were separated using a LC-20AD nano HPLC (Shimadzu). The eluate was subjected to nano electrospray ionization, followed by tandem mass spectrometry in a Q EXACTIVE Orbitrap mass spectrometer (Thermo Fisher Scientific). Intact peptides were detected at a resolution of 70,000 and subsequently selected for MS/MS analysis using high-energy collision dissociation with a normalized collision energy of 27. Ion fragments were detected in the Orbitrap at a resolution of 17,500. A data-dependent acquisition method was employed, targeting the 15 most abundant precursor ions above a threshold ion count of 20,000 in the MS survey scan. Following data import into the MetaboAnalyst software, median normalization was applied.

Bioinformatics analysis

Protein identification and quantification were performed using Protein Pilot™ 4.5 software (AB Sciex LLC, Framingham, MA, USA). Peptide identification was performed using the Paragon database search algorithm, incorporating an integrated false discovery rate analysis function. According to the standard parameters, a unique protein had to contain at least two unique peptides, and the false discovery rate must be below 1%. To strengthen credibility, only the iTRAQ ratio of the proteins within the range 0.5–20 was considered. A 95% confidence interval was selected as the significance threshold for protein identification, and the detected protein threshold (unused ProtScore) was set to ≥1.3 to minimize the false positive identification of proteins. Functional classification and Gene Ontology (GO) enrichment analyses of the differently expressed proteins were carried out using DAVID. Proteins were classified via GO category (http://www.geneontology.org), involving “biological process,” “cell component,” and “molecular function.” The KEGG database was employed to identify significantly enriched pathways, and the significance was determined with slight modifications as recommended by the authors of DAVID according to the Benjamini-corrected p-value < 0.05. Functional protein association networks were explored in STRING v.10.5 (http://string-db.org/). Additionally, the heat map was generated using MeV 4.9 software.

Western blot

mPFC proteins were extracted as previously described. Animals were anaesthetized using isoflurane, and the mPFC tissue was rapidly dissected from the brain and homogenized in lysis buffer (50 mM Tris, 150 mM NaCl, 1% Triton ×-100, 1% sodium deoxycholate, 0.1% SDS, and protease inhibitor cocktail tablets). Upon protein concentration measurement by BCA assay, 10–20 μg protein for each lane was separated on a 10% SDS-PAGE gel and transferred for Western blot analysis. The following antibodies and reagents were involved: mouse anti-β-actin (1:10,000; Clone No. AC-15; Cat. No. A5441; Sigma-Aldrich), rabbit anti-DAT (1:1000), rabbit anti-PDE10A (1:1000; Clone No. ARC58635; Cat. No. A15597; ABclonal Bioscience), horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Cat. No. CW0103S; CWBio), and HRP-conjugated goat anti-mouse IgG (Cat. No. CW0102S; CWBio). High-sensitivity enhanced chemiluminescence (ECL) reagent was purchased from ZATA Life (Cat. No. 310209; California, USA)., and high-sensitivity ECL reagent (catalog. 310209, ZATA Life, California, USA). All the bands were analyzed using the Tanon 4200 system (Biotanon, Shanghai, China). Uncropped immunoblot images are provided in the Source Data Excel file.

Statistical analysis

All analyses were performed using Prism (GraphPad), and data sets were assessed for normality and group variance prior to statistical analysis. Statistical analysis was performed using one-way ANOVA, two-way ANOVA followed by Tukey’s post hoc test, or two-tailed unpaired Welch’s t-test. Numerical data are expressed as means ± s.e.m., and significance levels are indicated as *P < 0.05, **P < 0.01, and ***P < 0.001 for comparisons between groups or animals. Statistical details are provided in the figure legends.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

41467_2026_74206_MOESM2_ESM.pdf (5.5KB, pdf)

Description of Additional Supplementary Files

Supplementary Video 1 (6.9MB, mp4)
Reporting Summary (97.4KB, pdf)
Supplementary Data 1. (79.4KB, xlsx)

Source data

Source Data (153.9KB, xlsx)

Acknowledgements

We extend our sincerest gratitude for Qian Yang (Tangdu Hospital, Fourth Military Medical University, China), Changhe Wang (Xi’an Jiaotong University, China), Tao Chen (Department of Anatomy and K.K. Leung Brain Research Centre, Fourth Military Medical University, China) for discussions regarding this project.

Author contributions

K.Z. and D.K.S. conceived the experiments and performed viral infection surgeries; R.X.L., Y.Y.Z. and H.X.G. performed the behavioral experiments; L.Y. performed virus injections; X.S.W. performed immunohistochemical staining and histological analysis; M.W., Y.M.W. and Q.Y. analyzed the data; M.G.Z. conceived and supervised the study and drafted the manuscript, with contributions from S.B.L. and W.W.H.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work. A peer review file is available.

Funding

This research was supported by National Natural Science Foundation of China (No. 82430047, 82571721, and 82471537), National Natural Science Foundation Innovation Research Group Project (No. 82221001), and Shaanxi Science and Technology Innovation Team Plan (No. 2023-CX-TD-63), Technology Innovation Talent Engineering Project (2023RCZZ003), Science and Technology Research Projects (2024GJJH03-02).

Data availability

All data are accessible upon request from the corresponding author. The proteomic data generated in this study have been deposited in the ProteomeXchange database under accession code PXD069281 (https://www.proteomexchange.org/). The animal behavior data, imaging data, and processed proteomic data generated in this study are provided in the Supplementary Information/Source Data file. Source data are provided within this paper. Source data are provided with this paper.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Kun Zhang, Dake Song, Yingying Zhang, Le Yang.

Contributor Information

Shuibing Liu, Email: liushb1974@aliyun.com.

Minggao Zhao, Email: minggao@fmmu.edu.cn.

Supplementary information

The online version contains supplementary material available at 10.1038/s41467-026-74206-6.

References

  • 1.Kramer, A. D., Guillory, J. E. & Hancock, J. T. Experimental evidence of massive-scale emotional contagion through social networks. Proc. Natl. Acad. Sci. USA. 111, 8788–8790 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Carnevali, L., Montano, N., Tobaldini, E., Thayer, J. F. & Sgoifo, A. The contagion of social defeat stress: insights from rodent studies. Neurosci. Biobehav. Rev.111, 12–18 (2020). [DOI] [PubMed] [Google Scholar]
  • 3.Boyko, M. et al. Establishment of an animal model of depression contagion. Behav. Brain Res.281, 358–363 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Martinez, V., Jimenez-Molina, A. & Gerber, M. M. Social contagion, violence, and suicide among adolescents. Curr. Opin. Psychiatry36, 237–242 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang, M., Wu, Y. E., Jiang, M. & Hong, W. Cortical regulation of helping behaviour towards others in pain. Nature626, 136–144 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Aron, C. M., Harvey, S., Hainline, B., Hitchcock, M. E. & Reardon, C. L. Post-traumatic stress disorder (PTSD) and other trauma-related mental disorders in elite athletes: a narrative review. Br. J. Sports Med.53, 779–784 (2019). [DOI] [PubMed] [Google Scholar]
  • 7.Shin, M. G., Bae, Y., Afzal, R., Kondoh, K. & Lee, E. J. Olfactory modulation of stress-response neural circuits. Exp. Mol. Med.55, 1659–1671 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liu, Z. et al. The cortical amygdala consolidates a socially transmitted long-term memory. Nature632, 366–374 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Stark, R. The olfactory bulb: a neuroendocrine spotlight on feeding and metabolism. J. Neuroendocrinol.36, e13382 (2024). [DOI] [PubMed] [Google Scholar]
  • 10.Ferretti, V. et al. Oxytocin signaling in the central amygdala modulates emotion discrimination in mice. Curr. Biol.29, 1938–1953 e1936 (2019). [DOI] [PubMed] [Google Scholar]
  • 11.Sterley, T. L. et al. Social transmission and buffering of synaptic changes after stress. Nat. Neurosci.21, 393–403 (2018). [DOI] [PubMed] [Google Scholar]
  • 12.Smith, M. L., Asada, N. & Malenka, R. C. Anterior cingulate inputs to nucleus accumbens control the social transfer of pain and analgesia. Science371, 153–159 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zhang, M. M. et al. Glutamatergic synapses from the insular cortex to the basolateral amygdala encode observational pain. Neuron110, 1993–2008 e1996 (2022). [DOI] [PubMed] [Google Scholar]
  • 14.Loureiro, M. et al. Social transmission of food safety depends on synaptic plasticity in the prefrontal cortex. Science364, 991–995 (2019). [DOI] [PubMed] [Google Scholar]
  • 15.Euston, D. R., Gruber, A. J. & McNaughton, B. L. The role of medial prefrontal cortex in memory and decision making. Neuron76, 1057–1070 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Friedman, A. et al. A corticostriatal path targeting striosomes controls decision-making under conflict. Cell161, 1320–1333 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Walum, H. et al. Genetic variation in the vasopressin receptor 1a gene (AVPR1A) associates with pair-bonding behavior in humans. Proc. Natl. Acad. Sci. USA. 105, 14153–14156 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Marino, M. D., Bourdelat-Parks, B. N., Cameron Liles, L. & Weinshenker, D. Genetic reduction of noradrenergic function alters social memory and reduces aggression in mice. Behav. Brain Res.161, 197–203 (2005). [DOI] [PubMed] [Google Scholar]
  • 19.Karjalainen, T. et al. Dissociable roles of cerebral mu-opioid and type 2 dopamine receptors in vicarious pain: a combined PET-fMRI study. Cereb. Cortex27, 4257–4266 (2017). [DOI] [PubMed] [Google Scholar]
  • 20.Carnevali, L. et al. Social stress contagion in rats: behavioural, autonomic and neuroendocrine correlates. Psychoneuroendocrinology82, 155–163 (2017). [DOI] [PubMed] [Google Scholar]
  • 21.Li, M., Xu, H. & Wang, W. An improved model of physical and emotional social defeat: different effects on social behavior and body weight of adolescent mice by interaction with social support. Front. Psychiatry9, 688 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Heyes, C. Empathy is not in our genes. Neurosci. Biobehav. Rev.95, 499–507 (2018). [DOI] [PubMed] [Google Scholar]
  • 23.Ueno, H. et al. Rescue-like behaviour in mice is mediated by their interest in the restraint tool. Sci. Rep.9, 10648 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Watanabe, S. Distress of mice induces approach behavior but has an aversive property for conspecifics. Behav. Process.90, 167–173 (2012). [DOI] [PubMed] [Google Scholar]
  • 25.Nakamura, M., Nomoto, K., Mogi, K., Koide, T. & Kikusui, T. Visual and olfactory signals of conspecifics induce emotional contagion in mice. Proc. Biol. Sci.291, 20241815 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Burne, T. H., Johnston, A. N., Wilkinson, L. S. & Kendrick, K. M. Effects of anesthetic agents on socially transmitted olfactory memories in mice. Neurobiol. Learn Mem.93, 268–274 (2010). [DOI] [PubMed] [Google Scholar]
  • 27.Wrenn, C. C. Social transmission of food preference in mice. Curr. Protoc. Neurosci.8, 8 5G (2004). [DOI] [PubMed] [Google Scholar]
  • 28.Labutina, N., Polyakov, S., Nemtyreva, L., Shuldishova, A. & Gizatullina, O. Neural correlates of social decision-making. Iran. J. Psychiatry19, 148–154 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Price, R. B. & Duman, R. Neuroplasticity in cognitive and psychological mechanisms of depression: an integrative model. Mol. Psychiatry25, 530–543 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Solie, C., Girard, B., Righetti, B., Tapparel, M. & Bellone, C. VTA dopamine neuron activity encodes social interaction and promotes reinforcement learning through social prediction error. Nat. Neurosci.25, 86–97 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Carr, D. B. & Sesack, S. R. Projections from the rat prefrontal cortex to the ventral tegmental area: target specificity in the synaptic associations with mesoaccumbens and mesocortical neurons. J. Neurosci.20, 3864–3873 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chang, H. T., Cheng, K. H., Hung, Y. C. & Hsu, K. S. Oxytocin signaling in the ventral tegmental area mediates social isolation-induced craving for social interaction. J. Biomed. Sci.32, 37 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Korchynska, S. et al. A hypothalamic dopamine locus for psychostimulant-induced hyperlocomotion in mice. Nat. Commun.13, 5944 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Yan, Z., Zeng, X., Su, J. & Zhang, X. The dark side of empathy: Meta-analysis evidence of the relationship between empathy and depression. Psych. J.10, 794–804 (2021). [DOI] [PubMed] [Google Scholar]
  • 35.Bray, K. O. et al. Associations between cognitive and affective empathy and internalizing symptoms in late childhood. J. Affect. Disord.290, 245–253 (2021). [DOI] [PubMed] [Google Scholar]
  • 36.Dolensek, N., Gehrlach, D. A., Klein, A. S. & Gogolla, N. Facial expressions of emotion states and their neuronal correlates in mice. Science368, 89–94 (2020). [DOI] [PubMed] [Google Scholar]
  • 37.Clark, A. G. et al. Inferring nonneutral evolution from human-chimp-mouse orthologous gene trios. Science302, 1960–1963 (2003). [DOI] [PubMed] [Google Scholar]
  • 38.Bian, X. Physiological and morphological characterization of GABAergic neurons in the medial amygdala. Brain Res.1509, 8–19 (2013). [DOI] [PubMed] [Google Scholar]
  • 39.Raam, T. & Hong, W. Organization of neural circuits underlying social behavior: a consideration of the medial amygdala. Curr. Opin. Neurobiol.68, 124–136 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sun, F., Wu, Y. E. & Hong, W. A neural basis for prosocial behavior toward unresponsive individuals. Science387, eadq2679 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Qi, G. et al. NAc-VTA circuit underlies emotional stress-induced anxiety-like behavior in the three-chamber vicarious social defeat stress mouse model. Nat. Commun.13, 577 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Cai, X. et al. Electroacupuncture alleviated depression-like behaviors in ventromedial prefrontal cortex of chronic unpredictable mild stress-induced rats: Increasing synaptic transmission and phosphorylating dopamine transporter. CNS Neurosci. Ther.29, 2608–2620 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Weele, C. M. V., Siciliano, C. A. & Tye, K. M. Dopamine tunes prefrontal outputs to orchestrate aversive processing. Brain Res.1713, 16–31 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Padilla-Coreano, N. et al. Cortical ensembles orchestrate social competition through hypothalamic outputs. Nature603, 667–671 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Regenbogen, C. et al. Neural responses to dynamic multimodal stimuli and pathology-specific impairments of social cognition in schizophrenia and depression. Br. J. Psychiatry.206, 198–205 (2015). [DOI] [PubMed] [Google Scholar]
  • 46.Sun, F. et al. Shared neural substrates of prosocial and parenting behaviours. Nature654, 454–464 (2026). [DOI] [PMC free article] [PubMed]
  • 47.Supiot, L. F. et al. A prefrontal cortex-lateral hypothalamus circuit controls stress-driven increased food intake. Nat. Commun.17, 4620 (2026). [DOI] [PMC free article] [PubMed]
  • 48.Kumar, S. et al. Prefrontal cortex reactivity underlies trait vulnerability to chronic social defeat stress. Nat. Commun.5, 4537 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Gangopadhyay, P., Chawla, M., Dal Monte, O. & Chang, S. W. C. Prefrontal-amygdala circuits in social decision-making. Nat. Neurosci.24, 5–18 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Schultz, W. Behavioral dopamine signals. Trends Neurosci.30, 203–210 (2007). [DOI] [PubMed] [Google Scholar]
  • 51.Lara, K. H., Kramer, H. J. & Lagattuta, K. H. This is not what I expected: The impact of prior expectations on children’s and adults’ preferences and emotions. Dev. Psychol.57, 702–717 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Mendez, S. B. & Salazar-Juarez, A. Prenatal and postnatal cocaine exposure enhances the anxiety- and depression-like behaviors in rats during cocaine withdrawal. Dev Psychobiol.66, e22493 (2024). [DOI] [PubMed]
  • 53.Joca, L., Zuloaga, D. G., Raber, J. & Siegel, J. A. Long-term effects of early adolescent methamphetamine exposure on depression-like behavior and the hypothalamic vasopressin system in mice. Dev. Neurosci.36, 108–118 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Putzer, A., Brune, M., Hatt, H. & Wolf, O. T. Hedione reduces subjective vicarious stress. Front. Behav. Neurosci.13, 297 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Linders, L. E. et al. Stress-driven potentiation of lateral hypothalamic synapses onto ventral tegmental area dopamine neurons causes increased consumption of palatable food. Nat. Commun.13, 6898 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Lammel, S., Ion, D. I., Roeper, J. & Malenka, R. C. Projection-specific modulation of dopamine neuron synapses by aversive and rewarding stimuli. Neuron70, 855–862 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Patel, S. D., Cameron, L. P. & Olson, D. E. Sex-specific social effects on depression-related behavioral phenotypes in mice. Life11, 1327 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Fang, G. et al. Sex differences in intergenerational transfer risk of major depressive disorder. Med. Sci. Monit.25, 9887–9892 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Hankin, B. L., Mermelstein, R. & Roesch, L. Sex differences in adolescent depression: stress exposure and reactivity models. Child Dev.78, 279–295 (2007). [DOI] [PubMed] [Google Scholar]
  • 60.Slavich, G. M. & Sacher, J. Stress, sex hormones, inflammation, and major depressive disorder: extending social signal transduction theory of depression to account for sex differences in mood disorders. Psychopharmacology236, 3063–3079 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Gehrung, E., Veit, O., Velasco, M., Faiguenbaum, J. & Apablaza, A. A case of hepatic distomatosis (fascioliasis) without eosinophilia. Bol. Chil. Parasitol.22, 37–39 (1967). [PubMed] [Google Scholar]
  • 62.Singer, T. & Lamm, C. The social neuroscience of empathy. Ann. N. Y. Acad. Sci.1156, 81–96 (2009). [DOI] [PubMed] [Google Scholar]
  • 63.Ballesta, S. & Duhamel, J. R. Rudimentary empathy in macaques’ social decision-making. Proc. Natl. Acad. Sci. USA. 112, 15516–15521 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Anderson, N. E. & Kiehl, K. A. The psychopath magnetized: insights from brain imaging. Trends Cogn. Sci.16, 52–60 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Henry, J. D., von Hippel, W., Molenberghs, P., Lee, T. & Sachdev, P. S. Clinical assessment of social cognitive function in neurological disorders. Nat. Rev. Neurol.12, 28–39 (2016). [DOI] [PubMed] [Google Scholar]
  • 66.Harmsen, I. E. Empathy in autism spectrum disorder. J. Autism Dev. Disord.49, 3939–3955 (2019). [DOI] [PubMed] [Google Scholar]
  • 67.Loos, M. et al. Inhibitory control and response latency differences between C57BL/6J and DBA/2J mice in a Go/No-Go and 5-choice serial reaction time task and strain-specific responsivity to amphetamine. Behav. Brain Res.214, 216–224 (2010). [DOI] [PubMed] [Google Scholar]
  • 68.Hirate, K. & Kuribara, H. Characteristics of the ambulation-increasing effect of GBR-12909, a selective dopamine uptake inhibitor, in mice. Jpn J. Pharm.55, 501–511 (1991). [DOI] [PubMed] [Google Scholar]
  • 69.Sun, X., Wang, T., Zhou, L., Zhang, C. & Fu, F. The effect of triple reuptake inhibitor toludesvenlafaxine on neurological function in cerebral ischemic rats. Front. Pharm.14, 1073099 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Zhu, H. et al. Pharmacological characterization of toludesvenlafaxine as a triple reuptake inhibitor. Front Pharm.12, 741794 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Dhir, A., Malik, S., Kessar, S. V., Singh, K. N. & Kulkarni, S. K. Evaluation of antidepressant activity of 1-(7-methoxy-2-methyl-1,2,3,4-tetrahydro-isoquinolin-4-YL)-cyclohexanol, a beta-substituted phenylethylamine in mice. Eur. Neuropsychopharmacol.21, 705–714 (2011). [DOI] [PubMed] [Google Scholar]
  • 72.Rodriguez Sarmiento, R. M. et al. Orally bioavailable dopamine D1/D5 receptor-biased agonists to study the role of beta-arrestin in treatment-related dyskinesia in Parkinson’s disease. J. Med. Chem.68, 13532–13561 (2025). [DOI] [PubMed] [Google Scholar]
  • 73.Young, D. et al. D1 agonist improved movement of Parkinsonian nonhuman primates with limited dyskinesia side effects. ACS Chem. Neurosci.11, 560–566 (2020). [DOI] [PubMed] [Google Scholar]
  • 74.Creese, I. & Chen, A. Selective D-1 dopamine receptor increase following chronic treatment with SCH 23390. Eur. J. Pharmacol.109, 127–128 (1985). [DOI] [PubMed] [Google Scholar]
  • 75.Burke, K., Chandler, C. J., Starr, B. S. & Starr, M. S. Seizure promotion and protection by D-1 and D-2 dopaminergic drugs in the mouse. Pharmacol., Biochem., Behav.36, 729–733 (1990). [DOI] [PubMed] [Google Scholar]
  • 76.Eisa, N. H., Helmy, S. A., El-Kashef, D. H., El-Sherbiny, M. & Elsherbiny, N. M. Pramipexole protects against diabetic neuropathy: effect on oxidative stress, TLR4/IRAK-1/TRAF-6/NF-kappaB and downstream inflammatory mediators. Int. Immunopharmacol.128, 111514 (2024). [DOI] [PubMed] [Google Scholar]
  • 77.Lejeune, F. et al. Clozapine inhibits serotoninergic transmission by an action at alpha 1-adrenoceptors not at 5-HT1A receptors. Eur. J. Pharmacol.260, 79–83 (1994). [DOI] [PubMed] [Google Scholar]
  • 78.Warren, B. L. et al. Neurobiological sequelae of witnessing stressful events in adult mice. Biol. Psychiatry73, 7–14 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Golden, S. A., Covington, H. E. 3rd, Berton, O. & Russo, S. J. A standardized protocol for repeated social defeat stress in mice. Nat. Protoc.6, 1183–1191 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Zhang, K. et al. CB1 agonism prolongs therapeutic window for hormone replacement in ovariectomized mice. J. Clin. Investig.129, 2333–2350 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Zhang, K. et al. Elevated progranulin contributes to synaptic and learning deficit due to loss of fragile X mental retardation protein. Brain140, 3215–3232 (2017). [DOI] [PubMed] [Google Scholar]
  • 82.Pena, C. J. et al. Early life stress confers lifelong stress susceptibility in mice via ventral tegmental area OTX2. Science356, 1185–1188 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Ramirez, S. et al. Activating positive memory engrams suppresses depression-like behaviour. Nature522, 335–339 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Hu, C. et al. Re-evaluation of the interrelationships among the behavioral tests in rats exposed to chronic unpredictable mild stress. PLoS ONE12, e0185129 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Snyder, J. S., Soumier, A., Brewer, M., Pickel, J. & Cameron, H. A. Adult hippocampal neurogenesis buffers stress responses and depressive behaviour. Nature476, 458–461 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Zhang, J. et al. IL4-driven microglia modulate stress resilience through BDNF-dependent neurogenesis. Sci. Adv.7, eabb9888 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Roslund, K., Lehto, M., Pussinen, P. & Metsala, M. Volatile composition of the morning breath. J. Breath Res.16, 046010 (2022). [DOI] [PubMed]
  • 88.Wang, Y. L. et al. Paraventricular thalamus controls consciousness transitions during propofol anaesthesia in mice. Br. J. Anaesth.130, 698–708 (2023). [DOI] [PubMed] [Google Scholar]
  • 89.Li, Y. D. et al. Activation of hypothalamic-enhanced adult-born neurons restores cognitive and affective function in Alzheimer’s disease. Cell Stem Cell30, 415–432 e416 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Wang, L. et al. Cocaine induces locomotor sensitization through a dopamine-dependent VTA-mPFC-FrA cortico-cortical pathway in male mice. Nat. Commun.14, 1568 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Hong, H. et al. The complex effects of ocean acidification on the prominent N2-fixing cyanobacterium Trichodesmium. Science356, 527–531 (2017). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

41467_2026_74206_MOESM2_ESM.pdf (5.5KB, pdf)

Description of Additional Supplementary Files

Supplementary Video 1 (6.9MB, mp4)
Reporting Summary (97.4KB, pdf)
Supplementary Data 1. (79.4KB, xlsx)
Source Data (153.9KB, xlsx)

Data Availability Statement

All data are accessible upon request from the corresponding author. The proteomic data generated in this study have been deposited in the ProteomeXchange database under accession code PXD069281 (https://www.proteomexchange.org/). The animal behavior data, imaging data, and processed proteomic data generated in this study are provided in the Supplementary Information/Source Data file. Source data are provided within this paper. Source data are provided with this paper.


Articles from Nature Communications are provided here courtesy of Nature Publishing Group

RESOURCES