Revisiting Species Boundaries in Salispina: Morphological Plasticity in Mangrove-Associated Oomycetes, S. lobata and S. hoi

Abstract

Salispina (Salispinaceae, Rhipidiales), a mangrove-associated oomycete, is characterized by uniquely forming aculeolate sporangia. In this study, six Salispina strains were isolated from fallen mangrove leaves collected in coastal sites in the Philippines. A combined strategy of morphology, morphometric analyses, physiology, and multilocus phylogeny assigned the isolates as Salispina lobata (USTCMS 1612, USTCMS 1613, USTCMS 1617) and Salispina hoi (USTCMS 1614, USTCMS 1615, USTCMS 1616). Multilocus phylogenetic analyses consistently assigned the isolates into two strongly supported clades corresponding to the two species. Despite the clear phylogenetic separation, both species exhibited extensive overlaps in sporangial morphology (i.e., shape and spine distribution) across culture conditions. Morphometric principal component analyses revealed broadly overlapping morphospaces, with culture conditions exhibiting a stronger influence on sporangial size than species identity. Agar-grown cultures frequently developed enlarged, lobate to irregular, and extensively aculeolate sporangia, whereas globose to obpyriform forms with apical spines predominated in water cultures. Temperature and salinity growth profiles were broadly overlapping between the two species, showing optimal growth at 30$°\mathrm{C}$ and tolerance to moderate salinity levels. These findings demonstrate culture-dependent phenotypic plasticity in Salispina and highlight the importance of integrative taxonomy for delimiting closely related oomycete species with overlapping morphological traits.

1. Introduction

Mangroves are ecologically complex and vital intertidal ecosystems along the tropical and subtropical regions of the world. It is characterized by periodic tidal fluctuations in salinity and temperature, where they play important roles in stabilizing and protecting coastal zones, as nursery habitats, and as source of nourishment for various flora, fauna, and microbial communities [1]. Mangrove ecosystems provide a massive amount of energy input to their habitat and adjacent biomes in the form of detritus derived from fallen leaf litter [1–3].

Among the ecologically important members of mangrove microbial communities are saprotrophic oomycetes [2,4–8]. Oomycetes are zoosporic fungal-like organisms that are chemotactically attracted to leaf exudates, which are eventually assimilated into other forms of nutrients [2,7–9]. In mangrove and estuarine environments, these organisms play a crucial role in nutrient cycling by decomposing organic matter and converting nutrients into forms more accessible to higher trophic levels [2,10,11]. To date, approximately, 30 oomycete species have been reported from mangrove, estuarine, and salt marsh habitats; yet, thus far, none of them have been documented as pathogenic to mangrove plants [7].

Rhipidiales, an order within the Phylum Oomycota, has been overlooked for more than five decades [10–13]. Some members of this taxon can exhibit aculeolate (or spiny) sporangia [11]. It has two families, Rhipidiaceae and Salispinaceae [14]. The former is considered one of the more complex groups of oomycetes due to their remarkable morphology and ecology [10–12]. Members of Rhipidiaceae are typically isolated from submerged twigs and fruits in freshwater environments and are known to exhibit hyphal constrictions and segmented thalli [11,15,16]. Recent explorations have provided substantial evidence that Rhipidiaceae is an early-diverging lineage within the Peronosporomycetes [12,13,17–19].

Unlike Rhipidiaceae, members of Salispinaceae have been commonly found in mangroves and estuaries in the tropics and subtropics [5,14,20–25]. Some congeners of Salispina, i.e., S. spinosa and S. lobata, were once classified as Phytophthora and later combined into Halophytophthora due to morphological similarities with the latter group, specifically, the morphology of sporangia and ecological niche [5,26]. However, the phylogeny, morphology, and physiology of this group were revisited by Bennett et al. [14] and proposed Salispinaceae to accommodate mangrove oomycetes with aculeolate sporangia, i.e., Salispina intermedia, S. spinosa, S. lobata, and S. hoi [14]. Likewise, Salispinaceae exhibits weak hyphal constrictions, lacks basal structures, and thrives in oxygen-limited environments [14]. Despite the seemingly consistent morphological features, congeners of Salispina appear to exhibit plasticity.

Phenotypic plasticity is the ability of an organism to express different biological traits or behaviors in response to environmental variations, thereby enabling rapid response to fluctuating conditions and selection pressures [27,28]. Plasticity has been documented across several oomycete lineages [29–31]. In Phytophthora, plasticity has been associated with shifts in reproductive and infection strategies. For example, P. heterospora exhibiting pseudoconidia and sporangia depending on the availability of free water [32]; whereas P. cinnamomi can adapt to prolonged cold exposure [28,33]. Morphological plasticity has also been recognized in saprolegnian oomycetes, thereby complicating species delimitation and taxonomy (i.e., Saprolegnia parasitica exhibiting morphotypes in various in vitro conditions) [34,35]. In Pythium, intraspecific pleomorphism had been observed in phylogenetically similar isolates of P. plurisporium [36]. Collectively, overlaps in morphological, physiological, and developmental characters may obscure stable diagnostic characters and complicate species delimitation within these taxa.

In this study, six Salispina isolates from mangrove and estuarine habitats in the Philippines were examined using morphological, morphometric, physiological, and multilocus phylogenetic approaches to assess the extent of phenotypic plasticity and their implications for species delimitation within the taxa.

2. Materials and methods

2.1. Isolation of Salispina

Fallen leaf litter samples were collected from four different mangrove forests and parks in the Philippines (Figure 1, Table 1). Enrichment of saprotrophic mangrove oomycetes was conducted according to the methods of Bennett and Thines [4]. Fallen mangrove leaves were cut into strips, washed with running tap water, then with sterile distilled water for a final wash, and finally blot-dried multiple times. Leaf strips were laid on 10% clarified vegetable juice agar (VJA, V8^® Original 100% Vegetable Juice, Campbell Soup Company, Camden, NJ, in 1.5% agar, and pH adjusted to ∼7.0, clarified using CaCO₃). No antibiotics were used for the setups. Samples were incubated at room temperature (25–30 °C) for 7 d.

Figure 1.

(A) Sampling map of the study (in blue circles) and past records of Salispina spp.; Ibajay, Panay Island [6], Davao del Sur [14], and Davao del Norte [20] (red circles); (B) Carlatan fishpond and fish pen, Brgy. Biday, San Fernando, La Union; (C) Ormoc Mangrove Ecopark, Ormoc, Leyte; (D) Orani Mangroves, Orani, Bataan; (E) Las Piñas-Parañaque Wetland Park, Metro Manila; (F) Bucal Mangrove Forest, Calatagan, Batangas.

Table 1.

Sampling location data.

	USTCMS 1612	USTCMS 1613	USTCMS 1614	USTCMS 1615	USTCMS 1616	USTCMS 1617
Location	San Fernando, La Union	San Fernando, La Union	Ormoc, Leyte	Orani, Bataan	Las Piñas, Parañaque Mangrove Wetland Park	Calatagan, Batangas
Site description	Estuary/fish pen	Estuary/fish pen	Mangrove Park	Mangrove forest	Mangrove Forest	Mangrove Forest
Sample type	Decaying mangrove leaf litter	Decaying mangrove leaf litter	Decaying mangrove leaf litter	Decaying mangrove leaf litter	Decaying mangrove leaf litter	Decaying mangrove leaf litter
Temperature ( $°\mathrm{C}$ )	28–30	28–30	28–30	29–31	29–32	29–32
Date isolated	April 25 2024 Dry season	April 25 2024 Dry season	August 26 2024 Wet season	December 9 2024 Northeast monsoon season	February 9 2025 Dry season	April 9 2025 Dry season

On each day of incubation, the presence of mycelial growth was observed upon lifting mangrove leaf samples from the enrichment plate. Agar blocks containing sporangia resembling Salispina (i.e., sporangial shape and presence of spines) were aseptically cut and transferred to new VJA plates until pure cultures were obtained. Simultaneously, agar blocks of the isolates were also transferred to cornmeal agar (CMA, HiMedia, Thane, India), and potato dextrose agar (PDA; TM Media, Delhi, India) was subsequently incubated.

Conversely, water cultures were also set up by submerging confirmed Salispina mycelial agar blocks in 1–3% sterile saline water (NaCl in distilled water (w/v)) in 60 mm Petri dishes. Parallel water culture setups were used to observe positive Salispina colonization in substrates such as sterile sesame seeds, sunflower seeds, and acetic acid heat-pretreated shrimp peels, which were subsequently submerged in water cultures. They were incubated for 7 d and then were aseptically transferred to sterile CMA.

2.2. Morphological observations, temperature, salinity, and sporulation conditions

Morphological characters, including colony morphology, branching patterns, hyphal diameter, and septation, were described. Sporangia characteristics (i.e., spine formation, size, shape, and papilla) and the basal plug were also reported. Photos of structures observed were taken using a CX53 inverted microscope (Olympus, Hachioji, Japan) equipped with a Moticam 1000 1.3-megapixel camera (Motic, Hong Kong). Vegetative morphology was assessed from seven-day-old cultures, while sporangial development was observed within 24–48 h after induction under standardized conditions.

Mycelial agar blocks were submerged in distilled water and saline water at increasing concentrations (0%, 1%, 2%, 3%, 4%, 5%, and 6%, w/v NaCl) and incubated at 30 °C for 24 h to observe the sporulation pattern. Zoospore release was performed following the protocols of Nakagiri [22] and Bennett et al. [14].

For temperature and salinity tests, round mycelial agar blocks were cut from 7-d-old cultures using a sterile 5-mm cork borer and transferred to CMA plates to determine radial colony growth (mm). All morphological observations and growth assays were conducted using seven-day-old actively growing cultures to ensure consistency across experiments. Vegetative mycelial growth was observed across different temperatures (15 °C, 20 °C, 25 °C, 30 °C, and 35 °C) for a span of seven days.

Afterward, the growth rate was measured across varying levels of salinity (0, 1%, 2%, 3%, 4%, 5%, and 6%, w/v NaCl) and incubated at the optimal temperature determined by the prior temperature test. Mean colony radial growth (mm/d) was measured following the methods of Solis et al. [41]. Colony-diameter growth-related experiments were in duplicate for each isolate and treatment. Because the present study primarily aimed at assessing comparative physiological responses among isolates, the growth assays should be interpreted as exploratory rather than exhaustive ecological characterizations.

2.3. Molecular phylogeny

2.3.1. DNA extraction, amplification, sequencing, and sequence alignment

Prior to DNA extraction, mycelial agar blocks were transferred to PDA and incubated at $30°\mathrm{C}$ for 7 d. Salispina grown on PDA showed cottony growth, facilitating easier collection of mycelia without agar. Mycelia were then lyophilized following the protocol by Conlon et al. [42]. The E.Z.N.A.^® Plant & Fungal DNA Kit was used to extract DNA from the isolates. DNA extracts were then submitted to MacroGen Inc. (Seoul, South Korea) for PCR amplification and sequencing. PCR amplification of cytochrome oxidase 1 (cox1), cytochrome oxidase 2 (cox2), and large nuclear ribosomal subunit (LSU) was performed using the primers listed in Table 2 with PCR conditions adapted from Bennett et al. [14].

Table 2.

PCR primers used for the study.

Loci	Primer pair	Sequence (5′–3′)	Reference
cox1	Oomcox1_Levup	GCTTAAGTTCAGCGGGT	Robideau et al. [37]
	FM85Mod	RRHWACKTGACTDATRATACCAAA	Robideau et al. [37]
cox2	cox2-F	GGCAAATGGGTTTTCAAGATCC	Hudspeth et al. [38]
	cox2-RC4	TGATTWAYNCCACAAATTTCRCTACATTG	Choi et al. [43]
LSU	LR0R	ACCCGCTGAACTTAAGC	Moncalvo et al. [39]
	LR6-O	CGCCAGACGAGCTTACC	Riethmuller et al. [40]

The resulting sequences were assembled and converted into contigs using Geneious Prime v2025.1.12. They were then deposited in the National Center for Biotechnology Information (NCBI) GenBank and the DNA Data Bank of Japan (DDBJ). A preliminary BLASTn (NCBI; https://blast.ncbi.nlm.nih.gov/Blast.cgi) search for each isolate was performed for each marker used. Reference sequences were collected from NCBI (https://www.ncbi.nlm.nih.gov/nucleotide) and the Phytophthora database (https://www.phytophthoradb.org), as well as from other Salispina sequences (Table 3). Salispina spinosa and S. hoi are the only two species with complete cox1, cox2, and LSU sequences available, while S. intermedia does not have a cox2 sequence, and S. lobata does not have an LSU sequence in the NCBI database. Moreover, recent Rhipidiaceae isolates such as Rhipidium interruptum and Araiospora spinosa only had LSU and cox2 sequences [12,13]. As a result, they were only used for the single-gene phylogenetic trees.

Table 3.

Reference sequences used in the study.

Species	Strain	cox1	cox2	LSU
Araiospora spinosa	FR-0046171	NA	PQ771708	PQ771833
Halophytophthora vesicula	CBS 393.81	MG019397	MF991427	KT455418
Phytophthora boehmeriae	CBS 291.29	HQ261251	PD_00181	HQ665190
Phytophthora insolita	IMI288805	PD_00175	PD_00175	PD_00175
Phytophthora kernoviae	P10958	PD_00105	PD_00105	PD_00105
Phytophthora quininea	CBS 406.48	PD_00126	PD_00126	PD_00126
Phytophthora ramorum	CBS 101553	HQ708387	PD_00065	HQ665053
Phytopythium helicoides	CBS 286.31	MF397921	MF397926	HQ665186
Phytopythium kandeliae	CBS 111.91	HQ708207	MF397928	HQ665065
Phytopythium megacarpum	CBS 112351	HQ708435	AB690665	HQ665067
Phytopythium montanum	CBS 111349	HQ708436	AB690667	HQ665064
Phytopythium ostracodes	CBS 768.73	EF408874	AB690668	HQ665295
Phytopythium vexans	CBS 119.80	EF426548	EF426547	HQ665090
Pythium aquatile	CBS 215.80	HQ708492	KJ595355	HQ665153
Pythium capillosum	CBS 222.94	HQ708529	KJ595360	HQ665164
Pythium inflatum	CBS 168.68	HQ708610	KJ595352	HQ665140
Pythium torulosum	CBS 316.33	HQ708900	KJ595374	HQ665206
Rhipidium interruptum	FR-0046161	NA	OQ680192	OQ685023
Salisapilia sapeloensis	CBS 127946	KT897704	KJ654178	HQ232457
Salispina hoi	USTCMS 1611	MG019399	MF991430	MG385863
	USTCMS 1614 a	PX522885 (LC901540)	PX522879 (LC902567)	PX426386
	USTCMS 1615 a	PX522886 (LC901541)	PX522880 (LC902568)	PX426387
	USTCMS 1616 a	PX522887 (LC901542)	PX522881 (LC902569)	PX426388
Salispina intermedia	CCIBt4155	KT886053	NA	KT920432
Salispina lobata	CBS 588.85	KT886056	MF991429	NA
	USTCMS 1612 a	PX522883 (LC901538)	PX522877 (LC902565)	PX426384
	USTCMS 1613 a	PX522884 (LC901539)	PX522878 (LC901539)	PX426385
	USTCMS 1617 a	PX522888 (LC901543)	PX522882 (LC902570)	PX426389
Salispina spinosa	CBS 591.85	KT886057	MF991428	KT920434
Saprolegnia ferax	P1.5.14	KP965743	KP965749	NA
Saprolegnia parasitica	CBS 223.65	NW012157837	NW012157837	HQ665165
Sapromyces elongatus	CBS213.82	MG019398	KT257452	AF235950

^a Isolates sampled in the present study. Accession numbers enclosed in parentheses were deposited in DNA Data Bank of Japan (DDBJ). The list was adapted from Bennett et al. [14] with the addition of Salispina intermedia [21], Araiospora spinosa, and Rhipidium interruptum [12,13].

The sequences were then aligned using the TrEase v2.0 webserver (http://thines-lab.senckenberg.de/trease/) [44]. The MAFFT algorithm was set to L-ins-I for the cox1 and cox2 datasets, while the Q-ins-I algorithm was used for the LSU dataset. Resulting MAFFT alignments were visualized using JalView (2.11.4.0) (https://www.jalview.org/) [45]. Both ends of the multiple sequence alignment were manually assessed and trimmed. The MAFFT-aligned sequences were subsequently concatenated using Concatenator v0.3.1 [46,47] (https://itaxotools.org/download.html).

2.3.2. Phylogenetic analyses

Trees were generated using three phylogenetic algorithms, minimum evolution [48], at 1000 bootstrap replicates following the generalized time-reversible (GTR) model; maximum likelihood via RAxML [49], where GTR-Gamma with 1000 bootstrap replications, and Bayesian Inference using MrBayes [50] with the GTR model of substitutions and running four incrementally heated chains of 1,000,000 generations, discarding the first 30% of the resulting trees. These were generated for both individual markers and the concatenated trees. Resulting trees were merged into one tree in the following sequence: minimum evolution, maximum likelihood, and Bayesian inference. The resulting trees were then visualized using MEGA12 [51].

2.3.3. Species delimitation tests

Using the aligned concatenated cox1–cox2–LSU and the individual marker datasets, two DNA-based species delimitation methods, namely Assemble by Automatic Partitioning (ASAP) [52] and the Bayesian variant of Poisson-Tree processes (bPTP) [53], were used to infer species status within Salispinaceae for LSU, cox1, and cox2 sequences. The graphical user interface of both ASAP and bPTP were downloaded from the iTaxoTools web platform (https://itaxotools.org/index.html). For ASAP, the cox1 and cox2 were run with the Kimura (K80) substitution model, while LSU and the concatenated cox1–cox2–LSU were run with the Jukes-Cantor (JC69) substitution model, and a Kimura transition/transversion ratio 2.0. All other parameters were left at default settings. For bPTP, a maximum-likelihood phylogenetic tree was generated from all the Salispinaceae datasets using MEGA12. In the bPTP application, all calculated ML trees underwent the H1 method with 100,000 MCMC generations, thinning every 100, burn-in rate by 10%, and seed to 123.

2.3.4. Statistical analyses on sporangial size

Morphometric analyses were conducted on sporangial dimensions obtained from viable cultures grown under two conditions: on CMA and on agar blocks submerged in 3% (w/v) saline water, both incubated aerobically at 25$°\mathrm{C}$. Observations were performed using an inverted microscope (Olympus, Hachioji, Japan) equipped with a digital imaging system (Motic Imaging software). Measurements were obtained from calibrated photomicrographs using Motic imaging software (Motic, Hong Kong). Length was measured from the hyphal tip to the apex of the sporangium, and width was measured perpendicular to the longest longitudinal axis.

Statistical analyses were performed in R (version 4.4.0) (R Foundation for Statistical Computing, Vienna, Austria). Length and width data were analyzed using principal component analysis (PCA) to summarize multivariate size and shape variation, with PC1 corresponding to overall size and PC2 representing residual shape variation independent of size. Effects of the isolate and culture were evaluated using linear models within each species. Species-level effects were assessed using linear mixed-effects models, with isolate included as a random factor. Significance was determined using Type III ANOVA with Satterthwaite’s approximation.

3. Results

3.1. Molecular characterization and phylogenetic analyses

Preliminary BLASTn analysis of the cox1, cox2, and LSU sequences from the six isolates showed high similarities with the reference sequences (i.e., Salispina hoi USTCMS 1611, Salispina lobata CBS 588.85, and Salispina spinosa P8467) (Table S1). All isolates showed >95% sequence identity across all markers, while query coverage ranged from 71% to 98%. The isolates nested within the Salispinaceae in multigene (Figure 2 and Supplemental Fig. S1) and single-gene phylogenetic trees (Figs. S2, S3, S4). Salispinaceae also formed a well-supported sister clade to Rhipidiaceae, Rhipidiales.

Figure 2.

(A) Multigene phylogeny based on concatenated cox1–cox2–LSU. Orders are shaded with different colors. Marked in red text are the present Salispina strains studied. Support values for each node: minimum evolution (ME), maximum-likelihood (ML), Bayesian inference (BI), are respectively indicated next to each clade. ME and ML bootstrap values below 50% and BI posterior probability below 0.5 were replaced with “-”, while those clades incongruent with the ME trees but highly supported in alternative topologies are replaced with “x”. Scale bar represents nucleotide substitutions per site. Saprolegnia ferax and Saprolegnia parasitica (Saprolegniales) were used as outgroups; (B) Species delimitation results based on ASAP and bPTP analyses. Species partitions inferred from single-locus (cox1, cox2, and LSU) datasets of the Salispina isolates are shown. Each vertical column represents a species hypothesis inferred by each method, and colors denote species clustering. Number of partition or “species” generated are represented by different shades of color.

USTCMS 1612, USTCMS 1613, and USTCMS 1617 formed a clade with S. lobata CBS 588.85 with strong bootstrap and posterior probability support in both cox1 and cox2 trees (Supplemental Fig. S2 and S3, respectively), while USTCMS 1614, USTCMS 1615, and USTCMS 1616 nested with S. hoi USTCMS 1611, also with strong bootstrap support in both single and multigene phylogenetic trees. Accordingly, USTCMS 1612, USTCMS 1613, and USTCMS 1617 were assigned as S. lobata, whereas USTCMS 1614, USTCMS 1615, and USTCMS 1616 were assigned as S. hoi.

3.2. Species delimitation analyses

Species delimitation analyses using ASAP and bPTP were conducted using concatenated (cox1–cox2–LSU) and single-locus datasets (cox1, cox2, LSU) (Figure 2(B); Supplemental Figs. S2(B,C) and S4(B,C)). Both ASAP and bPTP analyses of the cox1, cox2, and concatenated datasets consistently recovered three species partitions within Salispinaceae, corresponding to S. lobata (USTCMS 1612, USTCMS 1613, and USTCMS 1617), S. hoi (USTCMS 1614, USTCMS 1615, and USTCMS 1616 together with USTCMS 1611), and S. spinosa CBS 591.85.

In contrast, the LSU dataset showed lower species-level resolution. ASAP recovered only two species partitions, grouping the six isolates with S. hoi USTCMS 1611 while maintaining S. spinosa CBS 591.85 as a separate lineage. Likewise, bPTP yielded weakly supported and less consistent partitions, with USTCMS 1612, USTCMS 1613, and USTCMS 1617 clustering with S. intermedia and S. spinosa, USTCMS 1614 forming a separate partition, USTCMS 1615 and USTCMS 1616 grouped together, and S. hoi USTCMS 1611 recovered as a distinct lineage. Overall, ASAP and bPTP produced largely congruent species boundaries across the mitochondrial datasets.

3.3. Morphology

A summary of morphological and physiological analyses for the Salispina isolates is described in Table 4. All isolates expressed appressed mycelia, forming petaloid and/or rosette shapes in both CMA (Figures 3(A)–8(A)) and VJA (Figures 3(B)–8(B)), while indistinct radial, slightly aerial cottony growth on PDA (Figures 3(C)–8(C)). Hyphae showed irregular branching patterns with weak to no constrictions for all isolates, with vegetative hyphae undifferentiated from sporangiogenic hyphae (Figures 3(D)–8(D)). Occasionally, some sporangiogenic hyphae were bifurcated or rarely trifurcated. Sporangium formed only at the terminal end of a sporangiogenic hypha, where a weakly constricted basal hyaline plug separates the two in between (Figures 3(G),4(I),and 5(E)–8(E)).

Table 4.

Morphology and morphometric summary for Salispina isolates.

Species	Salispina lobata			Salispina hoi
Isolate	USTCMS 1612	USTCMS 1613	USTCMS 1617	USTCMS 1614	USTCMS 1615	USTCMS 1616
Locality	San Fernando, La Union, PH	San Fernando, La Union, PH	Calatagan, Batangas, PH	Ormoc, Leyte, PH	Orani, Bataan, PH	Las Pinas-Paranaque Wetland Park, PH
Structures
Colony pattern	Appressed and petaloid on VJA and CMA, appressed with indistinct radial growth on PDA			Appressed and petaloid on VJA and CMA, appressed with indistinct radial growth on PDA
Hyphal width ( $\mathrm{\mu }\mathrm{m}$ ) (n = 25)	5.689–15.34  $\mathrm{\mu }\mathrm{m}$	4.807–15.11  $\mathrm{\mu }\mathrm{m}$	4.458–16.23  $\mathrm{\mu }\mathrm{m}$	4.866–18.99  $\mathrm{\mu }\mathrm{m}$	5.327–15.25  $\mathrm{\mu }\mathrm{m}$	4.236–16.10
Sporangiogenic hypha	Undifferentiated from vegetative hypha bears a terminal sporangium; sometimes bifurcated, rarely trifurcated			Undifferentiated from vegetative hypha bears a terminal sporangium; sometimes bifurcated, rarely trifurcated
Sporangia shape (water culture)	Globose, obpyriform, ovoid, obovoid, clavate, typically elongated on water, variable			Globose, obpyriform, ovoid, obovoid, clavate, typically elongated on water, variable
Sporangia shape (agar cultures)	Globose, obpyriform, ovoid, obovoid, clavate, sometimes reniform, botryose, or lobate variable. Irregular sporangia more frequent on agar surface			Globose, obpyriform, ovoid, obovoid, clavate, sometimes reniform, botryose, or lobate variable. Irregular sporangia more frequent on agar surface
Conditions for sporangia development	Readily developed on agar cultures Developed aerobically on >1% saline water cultures No development in non-saltwater cultures			Readily developed on agar cultures Developed aerobically on >1% saline water cultures No development in non-saltwater cultures
Papilla	Unipapillate	Unipapillate	Unipapillate	Unipapillate	Unipapillate	Unipapillate
Size (sporangia in water culture) (μm) (n = 100; globose, ovoid, obpyriform); length × widtha	30.23 − (39.42) −56.02 − (72.72) −95.60 × 24.90 −(39.14) − 56.94 −(74.74) − 91.22	33.63 − (49.15) −60.81 − (72.47) −86.47 × 27.13 −(40.44) − 52.92 −(65.40) − 81.92	30.58 − (39.06) −54.72 − (70.38) −104.10 × 22.56 −(29.22) − 43.39 −(57.56) − 78.53	24.80 − (35.79) −53.00 − (70.21) −135.90 × 20.77 −(30.74) − 46.01 −(61.38) − 137.00	32.07 − (39.87) −53.21 − (66.55) −106.60 × 26.95 −(34.63) − 46.31 −(57.99) − 92.41	24.21 − (35.02) −50.30 − (65.58) −97.88 × 22.61 −(28.99) − 44.29 −(59.59) − 94.50
Size (sporangia in solid culture) (μm) (n = 100; variable); length × widtha	31.74 − (49.66) −70.82 − (91.98) −122.80 × 29.52 −(44.25) − 73.57 −(102.86) − 216.10	26.51 − (60.05) −86.94 − (113.83) −198.00 × 28.62 −(53.49) − 84.40 −(115.31) − 107.10	32.44 − (54.03) −81.56 − (108.59) −162.60 × 35.27 −(49.76) − 75.22 −(100.68) − 154.50	34.26 − (52.96) −88.96 − (124.96) −217.70 × 33.92 −(49.74) − 87.11 −(124.48) − 207.00	40.75 − (63.94) −85.05 − (106.36) −149.10 × 40.51 −(60.74) − 84.15 −(107.38) − 163.00	44.50 − (60.21) −87.39 − (114.57) −181.20 × 44.57 −(58.27) − 84.56 −(110.85) − 178.00
Surface spines (water culture)	Some smooth-walled; most spines form at the apex of the sporangia, typically exhibiting a crown-like appearance in water with 3% salt.			Some smooth-walled; most spines form at the apex of the sporangia, typically exhibiting a crown-like appearance in water with 3% salt.
Surface spines (agar culture)	Mostly covered for lobate, botryose, or irregular-shaped sporangia, while spines at the apical end for obpyriform, ovoid, globose-shaped sporangia Surface-exposed sporangia usually exhibit full-wall ornamentations, while those formed within the agar show spine restriction at the apical region			Mostly covered for lobate, botryose, or irregular-shaped sporangia, while spines at the apical end for obpyriform, ovoid, globose-shaped sporangia Surface-exposed sporangia usually exhibit full-wall ornamentations while those formed within the agar show spine restriction at the apical region
Vacuole	Present, when incubated long in 35 °C or in old water cultures			Present, when incubated long in 35 °C or in old water cultures
Basal plug	Present, hyaline			Present, hyaline
Zoospore discharge	Through a thin-walled dehiscence tube, sometimes exhibiting a flask-like appearance; the apical end of the tube deliquesces			Through a thin-walled dehiscence tube, sometimes exhibiting a flask-like appearance; the apical end of the tube deliquesces
Zoospore release conditions	Combined temperature-saline shock; microaerophilic incubation also triggered zoospore release			Combined temperature-saline shock; microaerophilic incubation also triggered zoospore release
Vesicle	Absent			Absent
Chlamydospores	Not observed			Not observed
Sexual structures	Not observed			Not observed

^a Size measurements are presented as length × width and reported as: minimum − (mean − SD) − mean − (mean + SD) − maximum. Measurements were obtained from calibrated photomicrographs captured at 100× total magnification (10× objective × 10× ocular lens).

Figure 3.

Salispina lobata USTCMS 1612. (A–C) Colony morphology in CMA, VJA, and PDA, respectively; (D) Protosporangium; (E) Immature sporangium; (F, G) Mature sporangia (arrow – hyaline plug); (H) Mature sporangium with elongated apex; (I, J) Empty sporangia with elongated dehiscence tubes; (K) Anterior view of a mature sporangium; (L) Irregular sporangium; (M) Lobate and aculeolate irregular sporangium with rounded lateral lobes; (N) Multilobate sporangia. Scale bar (white line) = 10 μm.

Figure 4.

Salispina lobata USTcMS 1613. (A–C) Colony morphology in CMA, VJA, and PDA, respectively; (D) Protosporangium; (E) Immature sporangium; (F, G) Mature sporangia; (H) Mature sporangium with defined apex; (I) Bifurcated mature sporangia (arrow – hyaline plug); (J) Shoe-like irregular sporangium; (K) Empty sporangium; (L, M) Lobed, aculeolate sporangium; (N) Multilobate sporangia. Scale bar (white line) = 10 μm.

Figure 5.

Salispina lobata USTCMS 1617. (A–C) Colony morphology in CMA, VJA, and PDA, respectively; (D) Immature sporangium; (E, F) Mature sporangia with apical spines (arrow – hyaline plug); (G) Globose sporangium; (H) Mature obpyriform sporangium with defined apex; (I, J) Irregular sporangia; (K) Multilobate sporangium arising from a single hyphae; (L) Irregularly pyriform sporangium; (M) Multilobate sporangium; (N) Entirely aculeolate irregular sporangium. Scale bar (white line) = 10 μm.

Figure 6.

Salispina hoi USTCMS 1614. (A–C) Colony morphology in CMA, VJA, and PDA, respectively; (D) Protosporangium; (E, F) Immature smooth sporangia (arrow – hyaline plug); (G) Mature sporangium with apical spines; (H) Smooth sporangium with elongated apex; (I) Lobate aculeolate sporangium; (J) Mature sporangium with elongated dehiscence tube; (K) Empty sporangium with flask-like dehiscence tube; (L–N) Lobed, aculeolate sporangium. Scale bar (white line) = 10 μm.

Figure 7.

Salispina hoi USTCMS 1615. (A–C) Colony morphology in CMA, VJA, and PDA, respectively; (D, E) Mature smooth-walled sporangia; (F) Bifurcating sporangia (arrow – hyaline plug); (G) Trifurcating sporangia originating from a single sporangiogenic hyphae; (H, I) Mature sporangia; (J) Irregular-shaped sporangium; (K) Empty sporangium; (L–N) Multilobate to irregular-shaped, aculeolate sporangia. Scale bar (white line) = 10 μm.

Figure 8.

Salispina hoi USTCMS 1616. (A–C) Colony morphology in CMA, VJA, and PDA, respectively; (D) Immature sporangium; (E) Globose sporangium (arrow – hyaline plug); (F) Immature sporangium; (G, H) Mature obpyriform sporangia; (I) Globose, smooth-walled sporangium; (J, K) Large ovoid to lobate sporangia; (L–N) Multiple lobate sporangia. Scale bar (white line) = 10 μm.

The isolates exhibited sporangia ranging from globose to obpyriform, with increasing frequencies of irregularly shaped (Figures 3(L),4(J),5(I–L),6(I),7(J) and 8(L)) and lobate (sometimes botryose) sporangia (Figures 3(M,N),4(L–N),5(M), 6(L–N),7(L–N) and 8(N)). Sporangia surfaces varied from smooth-walled to entirely aculeolate for all isolates. Surface spines were observed to extrude outwards from the wall of a young sporangium.

The dehiscence tube was present at the apex of the sporangium, with its length not necessarily elongated to facilitate zoospore release (Figures 3(I,J),4(K) and 6(J,K)). Sexual structures (i.e., antheridium, oogonium, and oospore) and chlamydospores were not observed in all isolates.

3.4. Growth rate across varying temperature and salinity

The Salispina isolates exhibited a wide range of growth from 15 °C to 35 °C, with optimal growth at 30 °C (Figure 9(A)). Growth increased progressively from 15 °C to 30 °C, then declined at 35 °C.

Figure 9.

Mean colony growth per day (mm day⁻¹) on CMA. (A) Growth across a temperature range of 15–35°C. (B) Growth across salinity concentrations of ($0-6\%$ NaCl (w/v). Each treatment was performed in duplicate for each isolate under each culture condition. Error bars represent standard deviations of replicate measurements. Statistical annotations indicate the significance of the fixed effects from the linear mixed-effects model: ns, not significant (P ≥ 0.05); *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Under optimal temperature (30 $°\mathrm{C}$), the growth responses of the isolates to increasing salinity (NaCl) concentrations were also assessed (Figure 9(B)). Mycelial growth generally increased with increasing salinity, with several isolates exhibiting enhanced growth at higher salinity concentrations, indicating tolerance to moderate salinity levels (Figure 9(B)).

The linear mixed effects analysis of both salinity and temperature also supported the patterns. Temperature strongly influenced radial growth rate (p < 0.001), indicating that growth variations among the examined isolates were primarily influenced by the tested environmental conditions. In contrast, species identity did not significantly affect growth (p ≥ 0.05), and no significant interaction between species and temperature was detected (p ≥ 0.05), suggesting both S. lobata and S. hoi isolates showed similar growth responses across temperature treatments. However, variations among isolates were detected, suggesting intraspecific physiological variability in growth responses (Figure 9(A)).

In the salinity-growth rate experiment, salinity concentration had a significant quadratic effect on growth rate (p < 0.001), indicating a non-linear relationship across the salinity gradient. Similar to the temperature mycelial growth experiment, species identity alone did not significantly influence growth (p ≥ 0.05), suggesting that physiological differences occurred primarily within species rather than between species. However, a significant species–salinity interaction was detected (p < 0.001), indicating minor differences in salinity response patterns between the two species despite their broadly overlapping growth ranges (Figure 9(B)).

3.5. Sporulation of Salispina

Sporangium development begins as the apex of a hypha and swells to form a protosporangium (Figures 3(D)–8(D)). Sporangia developed within 24–48 h and were more frequent in the agar surface layer. In water cultures, however, sporangial formation occurred only when mycelial blocks were immersed in saline water (>1% (w/v) NaCl or sea salt) at room temperature (25–30 °C) within 12–24 h.

Similar to the observations of Nakagiri [22], zoospore release was not observed in all isolates under constant saline and temperature conditions. The trigger was observed eight h after both temperature and saline gradients were simultaneously shifted (i.e., from 20 °C to 30 °C or a dilution of the salt concentration). Likewise, zoospore release occurred after 24 h of incubation in microaerophilic conditions using the candle-jar method [14]. Notably, Salispina zoospores seemed to squeeze through an elongated dehiscence tube. This was also observed in the irregularly shaped sporangia of the different isolates.

The isolates also colonized sesame and sunflower seeds, with hyphae extruding from the seeds after 48 h of incubation in water cultures. However, no colonization of hyphae was observed for the acetic acid-heat pretreated sterile shrimp peels for any of the isolates.

3.6. Morphometric analyses

A total of 1068 sporangia were measured across six isolates of Salispina, which represented the two species. Principal component analysis revealed that the distributions of sporangial sizes for the two species overlap, forming a continuous morphospace, with only a slight separation along PC1, suggesting minute differences in overall sporangial size (Figure 10; Supplemental Fig. S5). Consistently, the morphospace occupation along PC1 showed extensive interspecific overlap without distinct clustering by species identity. Distribution along PC1 per isolate was structured by culture condition (water-submerged vs. agar-grown) (Figure 11), suggesting an environmental effect on sporangial size. Linear mixed-effects modeling revealed that culture conditions significantly affected sporangial size (p < 0.001), with agar-grown sporangia consistently larger than water-submerged sporangia. Intraspecific size variation was also observed, and isolate identity significantly influenced PC1 (p < 0.001). A significant isolate-by-culture interaction was also detected (p < 0.001) for the S. lobata isolates, indicating isolate-specific plastic response to culture conditions. In mixed-effects modeling, no significant intrinsic size difference between species was observed (p ≥ 0.05), while culture type exerted a strong effect, with a significant species-by-culture interaction (p < 0.001).

Figure 10.

Principal component analysis (PCA) of sporangial morphometrics. PC1 (overall size) and PC2 (shape component) are shown with 95% confidence ellipses by species. Species identity is denoted by color (red = Salispina hoi; blue = S. lobata), while culture conditions are indicated by symbols (● agar; ▲ water).

Figure 11.

Variation in overall sporangial size (PC1 scores) among geographic isolates of Salispina hoi (USTCMS 1612, USTCMS 1613, USTCMS 1617) and S. lobata (USTCMS 1614, USTCMS 1615, USTCMS 1616) under two culture conditions. Panels represent the respective isolates. culture conditions are denoted by red boxes (agar) and blue boxes (water culture). Significance levels for the comparison between agar and water culture within each isolate are indicated above the boxplots as asterisks (***p < 0.001, ****p < 0.0001). linear mixed-effects modeling (within S. lobata box) showed significant effects of culture condition and isolate identity on Pc1 scores (p < 0.001), whereas species alone was not significant (p ≥ 0.05). A significant species-by-culture interaction was also detected (p < 0.001).

3.7. Taxonomy

Based on the combined morphology, phylogeny, and physiology, presented herewith are the descriptions of the isolates of the study:

• Salispina lobata J. Fell & I. Master (Figures 3–5)

See Fell and Master [5]. The Philippine strains formed a clade with S. lobata ex-type sequences, supported by strong bootstrap and posterior probability values.

Specimens examined: PHILIPPINES; San Fernando, La Union, isolated from fallen mangrove leaf litter, April 25 2024 (USTCMS 1612 and USTCMS 1613) by JA Saliba; Bucal Mangrove Forest, Calatagan, Batangas, isolated from fallen mangrove leaf litter, April 5 2025 (USTCMS 1617) by Ramon Francisco.

Culture characteristics: Growth patterns were appressed and petaloid on CMA and VJA, while aerial and cottony on PDA. Mean radial growth in CMA was optimal at $30°\mathrm{C}$, 3.748 mm/d (USTCMS 1612), 3.989 mm/d (USTCMS 1613), and 3.055 mm/d (USTCMS 1617).

Morphological characteristics: Hyphae coenocytic and irregularly branching with hyphal width ranging from 4.458 to 16.23 $\mu \mathrm{m}$, form septa at maturity; sporangiogenic hypha undifferentiated from vegetative hypha, sometimes bifurcated, rarely trifurcated. Basal plug present and hyaline. Sporangia, non-caducous and unipapillate, with shape varying from globose, ovoid, obovoid, obpyriform, clavate, and irregular in both water and agar cultures, while commonly irregular, lobate eventually forming multilobate to botryose sporangia in VJA and CMA cultures. Sporangia surfaces are initially smooth-walled; most eventually develop spines, forming mainly at the apical end in globose and obpyriform sporangia, and over the entire surface in lobate and irregular sporangia. Sporangium contents become vacuolated with age. Forms a single discharge tube forming at the apical end, sometimes elongated. Sexual structures and chlamydospores, not observed.

Sporulation conditions: Sporangium readily develops on CMA and VJA cultures. However, water setups require the presence of salt (>1% w/v sea salt or NaCl) grown at room temperature (25–30 °C) to induce sporangium formation. Zoospore release is triggered by a combined shift of temperature-salinity gradients or by overnight microaerophilic incubation at room temperature (25–30 °C).

Sporangia dimensions: USTCMS 1612: (30.23–) 39.42 − 72.72(–95.60) μm length × (24.90–)39.14 − 74.74(–91.22) μm width, on average 56.02 × 56.94 μm in water cultures, while (31.74–) 49.66 − 91.98(–122.80) μm length × (29.52–) 44.25 − 102.86(–216.10) μm width, on average 70.82 × 73.57 μm in agar cultures.

USTCMS 1613: (33.63–)49.15 − 72.47(–86.47) μm length × (27.13–)40.44 − 65.40(–81.92) μm width, on average 60.81 × 52.92 μm in water cultures, while (26.51–)60.05 − 113.83(–198.00) μm length × (28.62–)53.49 − 115.31(–107.10) μm width, on average 86.94 × 84.40 μm in agar cultures.

USTCMS 1617: (30.58–)39.06 − 70.38(–104.10) μm length × (22.56–)29.22 − 57.56(–78.53) μm width, on average 54.72 × 43.39 μm in water cultures, while (32.44–)54.03 − 108.59(–162.60) μm length × (35.27–)49.76 − 100.68(–154.50) μm width, on average 81.56 × 75.22 μm in agar cultures.

Notes: S. lobata strains USTCMS 1612, USTCMS 1613, and USTCMS 1617 showed close phylogenetic affinities with S. lobata CBS 588.85 in both cox1 and cox2 phylogenetic trees with high bootstrap and posterior probability supports (Supplementary Figures S1–S4). Morphologically, globose to obpyriform sporangia, mainly with apical spines, and frequently developing in water cultures. Interestingly, irregular and lobate sporangia are frequently observed from the three strains when cultivated on agar cultures (i.e., VJA and CMA).

Accession numbers: USTCMS 1612: cox1: PX522883 (DDBJ: = LC901538), cox2: PX522877 (DDBJ: = LC902565), and LSU: PX426384.

USTCMS 1613: cox1: PX522884 (DDBJ: = LC901539), cox2: PX522878 (DDBJ: = LC902566), and LSU: PX426385.

USTCMS 1617: cox1: PX522888 (DDBJ: = LC901543), cox2: PX522882 (DDBJ: = LC902570), and LSU: PX426389.

• Salispina hoi R. Bennett & Thines (Figures 6–8)

See Bennett et al. [14]. Strains consistently formed a clade with S. hoi ex-type sequences in both single-gene and multigene analyses, with strong bootstrap and posterior probability support.

Specimens examined: PHILIPPINES; Ormoc Mangrove Ecopark, Leyte, isolated from fallen mangrove leaf litter, August 26 2024 (USTCMS 1614) by JA Saliba; Orani Mangroves, Bataan, isolated from fallen mangrove leaf litter, December 9 2024 (USTCMS 1615) by JA Saliba; and Las Pinas, Paranaque Mangrove Wetland Park, Metro Manila, isolated from fallen mangrove leaf litter, February 9 2025 (USTCMS 1616) by JA Saliba.

Culture characteristics: Growth patterns were appressed and petaloid on CMA and V8, while aerial and cottony on PDA. Mean radial growth in CMA, optimal at $30°\mathrm{C}$, 4.710 mm/d (USTCMS 1614), 3.079 mm/d (USTCMS 1615), and 3.210 mm/d (USTCMS 1616).

Morphological characteristics: Hyphae coenocytic and irregularly branching with hyphal width ranging from 4.236 to 18.99 μm, form septa at maturity; sporangiogenic hypha undifferentiated from vegetative hypha, sometimes bifurcated, rarely trifurcated. Basal plug present and hyaline. Sporangia, non-caducous and unipapillate, shape varying from globose, ovoid, obpyriform, clavate, and irregular in both water and agar cultures, while commonly irregular, lobate to multilobate to botryose sporangia in VJA and CMA cultures. Sporangia surfaces are initially smooth-walled, but most form spines at the apical end, common for globose and obpyriform-shaped sporangia, and then to the entirety of the surface for aculeolate, lobate, and irregular-shaped sporangia. Sporangium contents become vacuolated with age. Forms a single discharge tube, forms at the apical end, sometimes elongated. Sexual structures and chlamydospores, not observed.

Sporulation conditions: Similar to those of S. lobata strains, as stated above.

Sporangia dimensions: USTCMS 1614: (24.80–)35.79 − 70.21(–135.90) μm length × (20.77–)30.74 − 61.38(–137.00) μm width, on average 53.00 × 46.01 μm in water cultures, while (34.26–)52.96 − 124.96(–217.70) μm length × (33.92–)49.74 − 124.48(–207.00) μm width, on average 88.96 × 87.11 μm in agar cultures.

USTCMS 1615: (32.07–)39.87 − 66.55(–106.60) μm length× (26.95–)34.63 − 57.99(–92.41) μm width, on average 53.21 × 46.31 μm in water cultures, while (40.75–)63.94 − 106.36(–149.10) μm length × (40.51–)60.74 − 107.38(–163.00) μm width, on average 85.05 × 84.15 μm in agar cultures.

USTCMS 1616: (24.21–)35.02 − 65.58(–97.88) μm length × (22.61–)28.99 − 59.59(–94.50) μm width, on average 50.30 × 44.29 μm, while (44.50–)60.21 − 114.57(–181.20) μm length × (44.57–)58.27 − 110.85(–178.00) μm width, on average 87.39 × 84.56 μm in agar cultures.

Notes: Salispina hoi strains USTCMS 1614, USTCMS 1615, and USTCMS 1616 consistently formed clades with S. hoi USTCMS 1611 (ex-type strain) in both single and multigene phylogenetic analyses of cox1, cox2, and LSU. Interestingly, the S. hoi strains in the present study exhibited morphological similarities with S. lobata strains, particularly in the formation of entirely aculeolate lobate and multilobate sporangia in agar cultures, while typically globose and obpyriform-shaped sporangia with apical spines in water cultures. This denotes high morphological plasticity in the organism; thus, care should be taken when identifying the species.

Accession numbers: USTCMS 1614: cox1: PX522885 (DDBJ: = LC901540), cox2: PX522879 (DDBJ: = LC902567), and LSU: PX426386.

USTCMS 1615: cox1: PX522886 (DDBJ: = LC901541), cox2: PX522880 (DDBJ: = LC902568), and LSU: PX426387.

USTCMS 1616: cox1: PX522887 (DDBJ: = LC901542), cox2: PX522881 (DDBJ: = LC902569), and LSU: PX426388.

4. Discussion

4.1. Plasticity in sporangium morphology

Traditional morphological approaches have been employed to assign Salispina species, primarily based on sporangial morphology and spine distribution [5,14,21]. Its congeners have been characterized by distinct aculeolate sporangia and relatively wide hyphae (3–12 μm) [5,14,21]. Salispina spinosa was described to exhibit conspicuous spines and a hydrotrophic dehiscence tube [5], while Salispina lobata was differentiated from the former due to its ability to form lateral lobes (sometimes auriculate) from a single sporangium, eventually resulting in multilobate sporangia [5]. The type species of Salispina, i.e., Salispina intermedia, was described as having intermediate features of both S. spinosa and S. lobata, with larger sporangia than the two [21]. Salispina hoi, the fourth species described from the Philippines, was characterized by sporangia that remain non-botryose at maturity, with spines forming at the apex and a quickly evanescing discharge tube [14].

The diagnostic morphological differences used for S. hoi and S. lobata were not consistently expressed, as sporangial morphology varied substantially between water and agar cultures in the current study. In water cultures, globose, ovoid, and obpyriform-shaped sporangia were highly frequent in the S. lobata isolates (USTCMS 1612, USTCMS 1613, and USTCMS 1617) (Figures 3(E–H) and 5(E–H)). Smooth-walled sporangia were sometimes pyriform and clavate, while those irregularly shaped were rarely present. Conversely, sporangia shapes were much more variable and indistinct in shape when grown in agar cultures. Interestingly, the S. hoi isolates (USTCMS 1614, USTCMS 1615, and USTCMS 1616) formed lobate-shaped sporangia in agar cultures (Figures 6(L–N),7(L–N) and 8(J–N)). This morphological phenomenon became more frequent when the sporangia-forming hyphae extruded closer to the agar surface. Similar trends were also observed in spine distribution. Those ovoid and obpyriform-shaped sporangia commonly had spines sparsely distributed at the apex of the sporangium radially, whereas the irregular-shaped to lobate-shaped sporangia formed spines almost the entire sporangial surface (Figures 3(L–N) and 5(J–N)). These indicate marked developmental plasticity, consistent with environmentally induced morphological variation reported in other oomycetes [28,35].

Multivariate ordination also revealed extensive overlap in the morphospace occupied by S. hoi and S. lobata, with no discrete distinction between the two taxa based on size parameters alone (Figures 10 and 11). However, the PCA and mixed-effect analyses further showed that much of the observed variation was structured by culture conditions rather than species identity (Figure 11). Intrinsic differences between species were minimal, whereas culture type accounted for a substantial proportion of the variation in sporangial size. The significant interaction between species and culture conditions further indicates that the magnitude of morphological variation differs among isolates depending on growth environment. Based on these data, sporangial size does not appear to be a stable diagnostic character across differing culture conditions, since culture type explained more variations in morphology than the identity of the species.

Sporangial ornamentations of Salispina remain poorly understood. In Rhipidiaceae, the aculeolate form of Araiospora was hypothesized to serve as a dormant form that helps adapt to unfavorable environmental conditions, such as cold and nutrient deficiency, whereas the spines have been hypothesized to function as deterrents against predation [50–53]. In Peronosporales, Salisapilia mycoparasitica also exhibited spiny ornamentations for attachment to molds, thereby facilitating parasitism [58]. It was observed in the present study that sporangial size and spines for Salispina isolates were more pronounced in agar cultures. The increase in spine formation under surface-associated growth conditions in Salispina could reflect responses to substrates like mangrove leaf litter. However, its role in possibly enhancing attachment and persistence against tidal shear, or resistance to microfaunal predation within the mangrove sediments remains speculative and requires experimental validation. These observations highlight the importance examining multiple developmental conditions when interpreting morphological characters and assessing species boundaries within Salispina.

4.2. Phylogenetic analysis and the use of molecular markers

Geographic distance, ocean currents, and environmental gradients have been linked to structuring genetic diversity, as demonstrated by mangrove landscape genomic studies [59]. In such environments, the effects of physical barriers and estuarine water flow dynamics may limit spore dispersal, thereby promoting isolation-by-distance or divergence mediated by environmental factors [60]. Similar processes have been proposed to facilitate divergence by restricting gene flow in Phytophthora spp. (i.e., P. drechsleri with two ecotypes adapting to different temperature ranges [33]; P. infestans and P. mirabilis failing to produce hybrids [61]). Phylogenetic analyses across concatenated and single-gene datasets (Figure 2; Supplemental Figs. S1–S4) consistently supported the separation of the isolates into S. hoi and S. lobata lineages. Despite the distant geographic separation of the sampled mangrove sites, the isolates remained genetically cohesive across the loci examined. Geographically distant isolates formed coherent clades without evident geographic sub-structuring, suggesting limited phylogenetic differentiation across the sampled populations. However, this interpretation should be treated cautiously because the limited number of isolates and barcode loci currently available for Salispina may reduce resolution at the population level. The broad spatial distribution of these isolates also raises important questions regarding dispersal and connectivity among Philippine mangrove systems. Estuarine currents, tidal transport, drifting mangrove litter, or other similar modes of dispersion may facilitate the distribution of these organisms [2,3,62].

Mitochondrial markers (i.e., cox1 and cox2) used for species-level delineation of oomycetes have been reported to be highly reliable [43]. Both ASAP and bPTP produced largely congruent mitochondrial-based partitions within Salispinaceae and consistently separated the S. lobata isolates (USTCMS1612, USTCMS1613, and USTCMS1617) from the S. hoi isolates (USTCMS1614, USTCMS1615, and USTCMS1616), while S. spinosa formed a distinct lineage within Salispinaceae. The limited number of records of Salispina species, together with incomplete barcode marker data, limits broader evaluation on species boundaries and evolutionary relationships within the genus.

The ribosomal DNA (e.g., SSU, ITS, and LSU), on the other hand, has been widely used to support mitochondrial markers in species delimitation. For instance, Olpidiopsis dasysiphoniae, was inferred as a distinct lineage within Olpidiopsis after analysis with ASAP and PTP based on combined cox1, cox2, and SSU markers [63]. In the present study, the LSU dataset was instead used to assess partitions in Salispina. In contrast to the mitochondrial datasets, LSU showed lower discriminatory power and produced inconsistent partitions between ASAP and bPTP analyses. These results suggest that LSU may retain broader ancestral similarities within Salispinaceae but provide limited resolution for recent divergence events.

The differing LSU partitions between ASAP and bPTP likely reflect the comparatively conserved nature of LSU relative to mitochondrial loci. Because sequence variation in LSU was limited, the two algorithms produced less consistent species partitions than those recovered from the cox1 and cox2 datasets.

Beyond species delimitation, the phylogenetic placement of Salispina also provides insights into evolution of reproductive traits among early-diverging oomycetes. Some early-diverging oomycete clades have been known to lack sexual structures (i.e., antheridia, oogonia) [15,64]. Sparrow [18] remarked on the improbability of the lack of need for thick-walled spores by the basal oomycetes originating from the open sea because no sudden and seasonal drying up occurs in such an environment, and further suggested that a non-oogamous form of sexual cycle may have been occurring for these microorganisms, as exhibited by Lagenisma coscinodisci [18,65]. Nakagiri [22] noted in Salispina (then as Halophytophthora) an “antheridium”-like interaction in S. lobata but did not further dwell on it [22]. Interestingly, structures resembling previously reported hyphal–sporangial interactions were sometimes superficially observed with the current Salispina isolates; however, these observations alone could not provide conclusive evidence and thus require further investigation.

4.3. The ecophysiology of S. lobata and S. hoi

Mangroves experience pronounced fluctuations due to periodic tidal cycles and freshwater influx, which in turn affect parameters such as temperature and salinity, in contrast to the comparatively stable salinity of the marine environment [66]. Both S. hoi and S. lobata exhibited comparable thermal response profiles, with no species-specific differences across the tested temperature range. Salinity likewise exerted a significant non-linear effect on growth, which may reflect physiological responses to fluctuating conditions relevant to estuarine environments. Despite the significant interaction of salinity and species, the overall growth ranges of the two taxa overlapped substantially. Based on the broadly overlapping temperature and salinity, the two taxa may occupy similar ecological niches within mangrove ecosystems. Such physiological flexibility may facilitate persistence under the fluctuating environmental conditions characteristic of mangrove habitats.

Moreover, the unique zoospore release conditions of Salispina were noted to possibly synchronize with the diurnal tidal conditions of mangroves [3,22]. As such, zoospore concentrations were higher after mild drying than in a constant-wet environment with constant temperature and salinity [3]. Together, these observations suggest that several aspects of Salispina biology may be adapted to the dynamic conditions typical of mangrove ecosystems.

Despite their consistent phylogenetic separation, the two taxa exhibited broadly overlapping physiological responses across tested environmental gradients. These results suggest that ecological tolerances may have remained relatively conserved following divergence and that the physiological traits examined here provide limited value for species delimitation, although they remain informative for understanding ecological adaptations in Salispina.

5. Conclusions

The present study integrated morphological, physiological, and molecular approaches to reassess species boundaries between S. hoi and S. lobata. Morphological observations revealed considerable culture-dependent variations in sporangial morphology and spine development while physiological analyses revealed broadly overlapping temperature and salinity responses. Together, these results indicate that phenotypic traits examined here provide limited discriminatory value for separating the two taxa.

In contrast to the overlaps in phenotypic and physiological traits, multilocus phylogenetic and species delimitation analyses consistently resolved S. hoi and S. lobata as distinct evolutionary lineages. Collectively, these findings demonstrate that morphology, physiology, and molecular data provide complementary perspectives on species diversity within Salispina, with molecular markers offering the greatest resolution for delimiting closely related taxa while morphological and physiological analyses provide important biological and ecological context.

Nevertheless, the present study remains limited by the number of isolates examined and the restricted geographic coverage of available molecular data. Broader sampling across Philippine mangrove systems, together with the inclusion of ex-type cultures, additional genetic markers, and population-level or genome-scale datasets, as well as the ultrastructural investigations using scanning electron microscopy (SEM) will be necessary to determine whether cryptic geographic structuring exists within Salispina populations; identify potentially stable microstructural characters of sporangial ornamentations; further refine species boundaries within this morphologically plastic group; and better understand the evolutionary processes shaping diversification within Salispinaceae.

Funding Statement

JATS received a grant from the Department of Science and Technology through its Accelerated Science and Technology Human Resource Development (DOST-ASTHRD) Scholarship Program in the Philippines.

Disclosure statement

No potential conflict of interest was reported by the author(s).