ZHX2 Alleviates Vascular Remodeling and Smooth Muscle Cell Proliferation by Transcriptional Regulation of GADD45G

ABSTRACT

Based on findings from human atherosclerotic arteries and mouse arterial injury models, where ZHX2 expression is significantly downregulated, this study identifies ZHX2 as a critical inhibitor of pathological vascular remodeling. Functionally, local adenoviral overexpression of ZHX2 in vivo attenuates neointima formation in a mouse carotid artery ligation model, while in vitro experiments demonstrate that ZHX2 impedes the proliferation and migration of primary Vascular Smooth Muscle Cells (VSMCs). Mechanistically, integrated RNA‐seq and ChIP‐seq analyses reveal that ZHX2 transcriptionally regulates GADD45G, directly binding to its promoter and activating its transcription. The essential role of this pathway is confirmed by the finding that knockdown of GADD45G counteracts the inhibitory effects of ZHX2 overexpression on VSMC proliferation, migration, and neointima formation. Consequently, the ZHX2/GADD45G signaling axis is highlighted as a potential regulatory pathway in injury‐associated neointimal remodeling.

Vascular injury downregulates ZHX2 expression, and ZHX2 inhibits the proliferation and migration of vascular smooth muscle cells (VSMCs) by transcriptionally activating GADD45G.

1. Introduction

Vascular smooth muscle cells (VSMCs), primarily found in the media layer of blood vessels, are crucial for controlling the dilation and constriction of these vessels [1]. VSMCs are inactive in the arteries of healthy adults. These smooth muscle cells play important roles in maintaining vascular tone and integrity, regulating luminal pressure, and distributing blood volume. However, VSMCs are not static, and they retain remarkable plasticity. When blood vessels are exposed to certain stimuli, such as inflammation and aging, VSMCs become activated, leading to enhanced proliferation, migration, and synthesis ability, ultimately promoting blood vessel remodeling [2]. They play a crucial role in vascular remodeling and maintaining vascular homeostasis by supporting the structural adjustment of existing blood vessels and the formation of new ones [3]. Vascular remodeling is a complex process that involves both beneficial and maladaptive responses to various stimuli, which might lead to chronic cardiovascular disease [4]. Vascular remodeling can either be beneficial or pathological [5]. A common feature of pathological vascular remodeling is neointimal hyperplasia [6, 7], which is an important process in several vascular proliferative diseases, including atherosclerosis [8, 9], hemodialysis vascular access dysfunction [10], hypertension [11], pulmonary arterial hypertension [12], restenosis after angioplasty [13, 14], and venous bypass graft stenosis [15]. Under these pathological conditions, activated VSMCs proliferate, migrate excessively, and accumulate under the endothelium [16]. The new layer they form between the lumen and the internal elastic lamina is called neointima. An Understanding of how VSMCs change from differentiation to proliferation may contribute to the prevention and treatment of not only restenosis after percutaneous coronary intervention (PCI) but also a series of pathological vascular diseases characterized by neointimal hyperplasia remodeling‐related diseases.

The zinc fingers and homeobox (ZHX) family includes ZHX1, ZHX2, and ZHX3, and these proteins have similar unique structures, containing two C2H2‐type zinc finger motifs and four or five HOX‐like homeodomains [17]. Previous studies have suggested that ZHXs can function as positive [18] or negative transcriptional regulators [19]. ZHX2 plays the role of oncogene or tumor suppressor gene in different tumors. For example, in hepatocellular carcinoma, ZHX2 can inhibit the expression of the oncogenic gene alpha‐fetoprotein (AFP) [20]. A number of results showed that in malignant tumors such as thyroid cancer [21], chronic lymphocytic leukemia [22, 23], and multiple myeloma [24, 25], the expression of ZHX2 was negatively correlated with the prognosis of appealing patients. Suggesting that ZHX2 may play the role of a tumor suppressor gene in patients with the above tumors. However, ZHX2 promotes tumorigenesis in clear cell renal cell carcinoma [26] and breast cancer [27]. Genome‐wide association studies (GWAS) studies show that ZHX2 is associated with intima‐media thickness (IMT) [28, 29]. However, the role of ZHX2 in VSMC remains unclear.

This study found that the expression of ZHX2 decreased in the carotid artery of mouse with Carotid Artery Ligation (CAL) and in human carotid atherosclerotic lesions. Our research has shown that the overexpression of ZHX2 has the ability to restrict the proliferation of VSMCs, which, in turn, inhibits the intimal hyperplasia of CAL model mice. By analyzing the results of RNA‐seq and ChIP‐seq, we found that ZHX2 binds to the Growth Arrest and DNA‐Damage‐Inducible 45 Gamma (GADD45G) promoter, activating GADD45G transcription and ultimately impeding VSMC proliferation. Our research has identified a new genetic pathway in the reprogramming of VSMCs, which includes ZHX2 and its target gene, GADD45G. This regulatory network could be a promising target for treating pathological vascular remodeling.

2. Materials and Methods

2.1. Animal Procedures

Animal studies were conducted in compliance with the 8th edition (2011) of the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. Animal care and experimental procedures received approval from the Institutional Animal Care and Use Committee (IACUC) at Huazhong University of Science and Technology (IACUC number 3445). The ZHX2 Flox/Flox (ZHX2 fl/fl) mice were obtained from Shanghai Biomodel Organism Science & Technology Development Co. Ltd., and the tamoxifen‐inducible transgenic mice (Myh11‐CreERT2) were from The Jackson Laboratory (Stock No. 019079). Female ZHX2 fl/fl mice were mated with male Myh11‐CreERT2 mice to produce female ZHX2 fl/+ and male ZHX2 fl/+/Myh11‐CreERT2 offspring. These offspring were then crossbred to yield male ZHX2 fl/fl/Myh11‐CreERT2 or ZHX2 +/+/Myh11‐CreERT2 mice. Male ZHX2 fl/fl/Myh11‐CreERT2 mice were crossed with their female ZHX2 fl/fl littermates to generate the experimental ZHX2 fl/fl/Myh11‐CreERT2 mice, and ZHX2 +/+/Myh11‐CreERT2 mice were mated with their female ZHX2 +/+ littermates to produce the control ZHX2 +/+/Myh11‐CreERT2 mice. Using block randomization, animals were randomly allocated to the experimental and control groups. To induce ZHX2 deficiency, mice at the age of 6 weeks received four tamoxifen injections (50 mg/kg) on alternate days before CAL. The control mice also underwent the same tamoxifen treatment. Genotyping was carried out using Polymerase Chain Reaction (PCR) (Figure S2).

2.2. Immunohistochemistry and Immunofluorescence Staining

The freshly harvested tissues are fixed immediately in 4% paraformaldehyde (PFA) for 24 h at 4°C. After fixation, the samples are embedded in paraffin and sectioned into 6‐μm‐thick slices. These slices are then stained with Hematoxylin and Eosin (H&E) and immunofluorescence (IF). To prepare for staining, the sections are first deparaffinized and rehydrated. Antigen retrieval is performed by boiling the samples in citrate buffer (pH 6.0) at 95°C for 20 min. The slices are then permeabilized by incubating in PBS containing 1% Triton X‐100 for 15 min. To block non‐specific binding, the sections are sealed with goat serum for one hour at room temperature. The primary antibodies are diluted in the blocking buffer according to the manufacturer's instructions. The slides, coated with the primary antibodies, are incubated overnight at 4°C in a humidified chamber. Subsequently, the samples are stained with fluorescence‐labeled secondary antibodies, and the cell nuclei are marked with DAPI. Imaging is performed using an Olympus fluorescence microscope, and ImageJ software is utilized for a blind measurement of either the intensity of the IF signal or the percentage of cells positive for the indicated staining. The primary antibodies were used as follows: ZHX2 (Proteintech, 20136‐1‐ap), αSMA (Proteintech, 67735‐1‐Ig), KI67 (Proteintech, 27309‐1‐AP).

2.3. RT‐qPCR

We extracted total RNA from rat cells and tissues employing the TRIzol reagent (D9108A, TaKaRa Bio). The RNA was then reverse‐transcribed into complementary DNA (cDNA) using the RR036A PrimeScript RT Reagent Kit (Perfect Real Time) supplied by TaKaRa. The amplification products were quantified using SYBR Green (Vazyme), utilizing a PRISM 7900 Sequence Detector System (Applied Biosystems, Foster City). For the quantification of all genes, we used either GAPDH or β‐actin as the internal control. The primer sequences used are provided in Table S1.

2.4. Cell Culture and Treatment

Primary smooth muscle cells were prepared from SD rats, weighing between 150 and 180 g, using an enzymatic digestion method. The aorta of the rats was surgically removed under aseptic conditions after anesthesia was induced with an intraperitoneal injection of pentobarbital at a dosage of 100 mg/kg, and the external membrane was then stripped under a dissecting microscope. The aorta was cut into fragments of about 1–2 mm and digested for 2 h in an enzyme solution containing collagenase type II (3 mg/mL; C6885, 700.3 U/mg, Sigma) and elastase (1 mg/mL, E1250, 6 U/mg, Sigma). The cells were subsequently cultured in SMCM medium and cultured in a humidified atmosphere containing 5% CO₂ at 37°C with experiments conducted from the 3rd to 6th generation.

The mice primary VSMCs were isolated from the aorta of 10‐week‐old C57BL/6J male mice via an enzymatic digestion method. The aorta of the mice was surgically removed under aseptic conditions after anesthesia was induced with an intraperitoneal injection of pentobarbital at a dosage of 100 mg/kg, washed in PBS to remove fat and connective tissue, and then incubated for 10 min at 37°C in 1 mL DMEM containing type II collagenase (3 mg/mL; C6885, 700.3 U/mg, Sigma). The outer membrane of the aorta was subsequently stripped, and the tissue was minced and transferred into cell culture flasks. It was then incubated for 30 min in solutions of type II collagenase and for 60 min in elastase (1 mg/mL, E1250, 6 U/mg, Sigma), respectively. Digestion was halted, and the harvested cells were placed in SMCM medium and cultured in a humidified atmosphere containing 5% CO₂ at 37°C. HEK 293T cells, supplied by Procell Biotech (Wuhan, China), were cultured in a 5% CO₂ incubator at 37°C. The culture medium used was DMEM supplemented with 10% FBS.

2.5. Western Blot

Cells or tissues were lysed using pre‐chilled lysis buffer supplemented with protease inhibitors. Subsequently, the protein concentration was determined by employing the BCA method. Equal quantities of protein were combined with sample buffer, followed by SDS‐PAGE electrophoresis and immunoblotting. The specific antibodies utilized are listed below: ZHX1 (Proteintech, 13903‐1‐AP), ZHX2 (Proteintech, 20136‐1‐AP), ZHX3 (Proteintech, 29397‐1‐AP), CCND1 (Proteintech, 26939‐1‐AP), PCNA (Proteintech, 10205‐2‐AP), αSMA (Proteintech, 14395‐1‐AP), E2F1 (CST, #3742), GADD45G (ABclonal, A10286), GAPDH (Proteintech, 60004‐1‐Ig), α‐TUBULIN (Proteintech, 80762‐1‐RR).

2.6. Carotid Artery Wire Ligation Injury Model

All surgeries were performed under sterile conditions. The establishment of the model used a blind method. Both the experiment operators and statistical analyzers did not participate in the prior tamoxifen treatment. Male C57BL/6 mice, aged eight weeks, were anesthetized using an intraperitoneal injection of pentobarbital sodium at a dosage of 50 mg/kg. For the ligation group, the left common carotid artery was carefully dissected from the surrounding tissue under a microscope and ligated using a 6–0 silk ligature. For the control group, a sham surgery was performed involving the dissection, but not ligation, of the right common carotid artery. For localized adenovirus delivery, Ad‐Control or Ad‐ZHX2 (1.5 × 10⁸ pfu) were blindly packaged by 70 μL Pluronic gel F‐127 (Keygen, China) to extend virus contact time and delivery to the carotid arteries immediately after ligation, respectively. Following a period of 14 days, mice were humanely euthanized. Anesthesia was first induced with an intraperitoneal injection of pentobarbital at a dosage of 100 mg/kg, followed by cervical dislocation. The common carotid arteries were then surgically removed. These arteries were subsequently fixed with 4% formaldehyde, embedded in paraffin, and cross‐sectioned. The sections were stained with hematoxylin and eosin (H&E) and Masson's trichrome to assess vascular morphology and collagen deposition, respectively, and were also subjected to immunofluorescence staining.

2.7. Recombinant Adenovirus Production

Adenoviral vectors, engineered to either express control or carry the ZHX2 coding DNA sequence (cDNA), were used for in vitro experiments involving vascular smooth muscle cells (VSMCs). In parallel, similar adenoviral vectors designed to express either scramble short hairpin RNA (shRNA) or ZHX2‐targeted shRNA were also employed. For in vivo studies, these modified adenoviral constructs were administered to infect the carotid arteries directly.

2.8. EdU

After undergoing the specified treatment for a duration of 12 h, vascular smooth muscle cells (VSMCs) were subsequently plated into 96‐well plates at a density of 3 × 10⁴ cells per well. Upon completion of the plating process, the cells were subjected to culture. Following the culture period, a medium containing EdU was introduced to the cells for an additional 2 h. Subsequent to this incubation, the cells were immobilized using a 4% paraformaldehyde solution. The EdU Incorporation Assay was then conducted in accordance with the guidelines provided by the manufacturer (Beyotime, C0075S). To visualize and document the results, images were acquired employing the Olympus fluorescence microscope.

2.9. Transwell

Following a 24‐h period of the specified treatment, vascular smooth muscle cells (VSMCs) were subjected to digestion and subsequently suspended in a serum‐free medium. A cell suspension of 5 × 10⁴ cells (100 μL) was introduced into the upper compartments of transwell culture plates. In parallel, 500 μL of medium containing 10% FBS was added to the lower compartments of the same plates. The entire assembly was then incubated at a temperature of 37°C with a 5% CO₂ atmosphere for a duration of 24 h. After the incubation period, the cells located on the upper surface of the polycarbonate films were delicately eliminated using moistened cotton swabs. Subsequently, the polycarbonate films were cautiously detached from the upper chambers. To proceed, the cells were fixed with pre‐chilled methanol for 30 min. Following fixation, a staining step was conducted using a 0.1% solution of crystal violet for 15 min. The stained cells were rinsed thrice with PBS and subjected to microscopic observation.

2.10. Wound Healing Assay

Vascular smooth muscle cells (VSMCs) were initially cultured in a 6‐well plate, followed by infection and treatment as per the experimental requirements. After a duration of 24 h, a linear scratch was created across the surface of the cell monolayer using a pipette tip. Subsequently, a medium containing 2% FBS was introduced to the culture. Microscopic imaging of the scratched cell area was performed immediately (0 h) and following a 24‐h interval. This allowed for visualizing the migration dynamics of the cells. The evaluation of cell migration capacity was carried out by analyzing the degree of healing observed in the scratched region between the initial and final imaging time points.

2.11. RNA‐Seq

RNA extraction, library preparation, sequencing, and analysis. Total RNAs were extracted using TRIzol Reagent (Invitrogen, cat. NO15596026) following the methods by Chomczynski et al. (DOI:10.1006/abio.1987.9999). DNA digestion was carried out after RNA extraction by DNaseI. RNA quality was determined by examining A260/A280 with NanodropTM OneC spectrophotometer (Thermo Fisher Scientific Inc). RNA Integrity was confirmed by 1.5% agarose gel electrophoresis. Qualified RNAs were finally quantified by Qubit3.0 with QubitTMRNA Broad Range Assay kit (Life Technologies, Q10210). 2 μg total RNAs were used for stranded RNA sequencing library preparation using KCTMStranded mRNA Library Prep Kit for Illumina (Catalog NO. DR08402, Wuhan Seqhealth Co. Ltd. China) following the manufacturer's instruction. PCR products corresponding to 200–500 bps were enriched, quantified, and finally sequenced on a Novaseq 6000 sequencer (Illumina) with a PE150 model. Raw sequencing data was first filtered by Trimmomatic (version 0.36), low‐quality reads were discarded, and the reads contaminated with adaptor sequences were trimmed. Clean data were mapped to the reference genome of rat from https://ftp.ensembl.org/pub/ using STAR software (version 2.5.3a) with default parameters. Reads mapped to the exon regions of each gene were counted by featureCounts (Subread‐1.5.1; Bioconductor), and then RPKMs were calculated. Genes differentially expressed between groups were identified using the edgeR package (version 3.12.1). A FDR cutoff of 0.05 and a |log2 fold change| > 1 were used to judge the statistical significance of gene expression differences.

2.12. ChIP‐Seq

ChIP assay was performed on VSMC by SeqHealth (Wuhan, China). The tissue/cell was fixed in 1% formaldehyde for 10 min at room temperature, after which 0.125 M glycine was added, and the mixture was sat for 5 min to terminate the crosslinking reaction. The tissue was then collected and frozen in liquid nitrogen. The cells were treated with cell lysis buffer, and the nucleus was collected by centrifuging at 2000 g for 5 min. Then, the nucleus was treated with nucleus lysis buffer and sonicated to fragment chromatin DNA. The 10% lysis sonicated chromatin was stored and named “input”, and 90% was used in immunoprecipitation reactions with anti‐ZHX2 antibody (Proteintech, 20136‐1‐AP) and named “IP”. The DNA of input and IP was extracted by the phenol‐chloroform method. The high‐throughput DNA sequencing libraries were prepared by using VAHTS Universal DNA Library Prep Kit for Illumina V3 (Catalog No. ND607, Vazyme). The library products corresponding to 200–500 bps were enriched, quantified and finally sequenced on a Novaseq 6000 sequencer (Illumina) with a PE150 model. Raw sequencing data was first filtered by Trimmomatic (version 0.36), low‐quality reads were discarded and the reads contaminated with adaptor sequences were trimmed. The clean reads were used for protein binding site analysis. They were mapped to the reference genome of rat from https://ftp.ensembl.org/pub/ using STAR software (version 2.5.3a) with default parameters. The RSeQC (version 2.6) was used for read distribution analysis. The MACS2 software (Version 2.1.1) was used for peak calling.

2.13. Dual‐Luciferase Assay

The company (Tsingke Biotechnology Co. Ltd) was commissioned to create synthetic sequences of the GADD45G gene promoter for rat (−2000 to +200) and to incorporate them into the pGL3.0 basic vector. Subsequently, a mutated vector was assembled using the reverse PCR technique. In 293T cells, the pRL‐TK plasmid was co‐transfected alongside either the empty vector or the ZHX2 overexpression vector and the wild‐type or mutant reporter gene vectors. After a span of 12 h, the Dual‐Luciferase Reporter Gene Assay Kit II (Beyotime, RG029) was utilized for measurements as per the instructions provided by the manufacturer.

2.14. ChIP‐qPCR

The ChIP‐qPCR experiments were carried out according to the manufacturer's instructions using the ChIP Assay Kit (Beyotime, P2078). In brief, VSMCs were treated with PDGF‐BB for 12 h, with 27 μL of 37% formaldehyde added to each milliliter of the culture medium. This was followed by incubation in formaldehyde at 37°C for 10 min to crosslink target proteins and corresponding genomic DNA. After replacing the culture medium with glycine solution from the kit, we prepared pre‐cooled PBS containing PMSF and used it to suspend and centrifuge the cells. The cells were then scraped, washed twice, and resuspended in SDS Lysis Buffer with 1 mM PMSF. The mixture was incubated on ice for 10 min and then sonicated. Subsequently, 8 μL of 5M NaCl was added to 0.2 mL of sonicated sample, mixed thoroughly, and heated at 65°C for 4 h to de‐crosslink the proteins and genomic DNA. DNA extraction was performed next using phenol‐chloroform. We then prepared a ChIP Dilution Buffer with 1 mM PMSF and diluted the sonicated sample. Some of the sample was taken out as an input and mixed with Protein A+G Agarose/Salmon Sperm DNA. The sample was centrifuged, and the supernatant was transferred to a new centrifuge tube and incubated with an appropriate amount of primary antibody overnight at 4°C with gentle rotation or shaking. Protein A+G Agarose/Salmon Sperm DNA was added next to precipitate protein or complexes recognized by the primary antibody. After centrifugation, the liquid was discarded, and the precipitate was washed sequentially with wash buffer and finally used for qPCR. The primers used were as follows: forward primer: CGAGCGCAAGTAAAGATTCCC, reverse primer: AAAGGCGAGGTGAAATCTGC.

2.15. Statistics

All data are expressed as the mean ± standard error of the mean and were analyzed using SPSS software. Initially, the Shapiro–Wilk test was utilized to assess the normality of the data. For the comparison of two groups, the Student's Unpaired t‐test was applied when the data were normally distributed with equal variances; for normally distributed data with unequal variances, the t‐test with Welch's Correction was employed; and for data that did not follow a normal distribution, the Mann–Whitney U Test was selected. For comparisons involving three or more groups, One‐way Analysis of Variance (ANOVA) was utilized for data that were normally distributed with equal variances, followed by Bonferroni's Post Hoc Tests for significant differences. For data that were normally distributed but had unequal variances, Welch ANOVA and Dunnett's T3 Post Hoc Tests were conducted.

3. Results

3.1. ZHX2 Is Downregulated in Proliferating VSMCs Both In Vivo and In Vitro

To understand ZHX2's role in vascular remodeling, we analyzed atherosclerotic vascular data GSE43292 from the GEO database. The analysis revealed a reduction in the ZHX family expression in human atherosclerosis specimens compared to the control group (Figure 1A). The mouse carotid artery injury model data GSE70410 corroborated these findings (Figure 1B).

FIGURE 1.

ZHX2 is downregulated in injured arteries and PDGF‐BB‐stimulated VSMCs (A) Expression of ZHX family members and cell‐cycle‐related genes in GSE43292. (B) Heatmap of ZHX family members and cell‐cycle‐related genes in GSE70410. (C) Western blot analysis of ZHX1/2/3 in sham and CAL arteries (n = 4). (D) IF staining of ZHX2 and αSMA in sham and CAL arteries. Scale bar = 50 μm. (E, F) RT‐qPCR and western blot analysis of ZHX2 and proliferation/contractile markers in vehicle‐ or PDGF‐BB‐treated VSMCs (n = 3). Data are mean ± SEM. Statistical significance was determined by unpaired Student's t‐test or t‐test with Welch's Correction. *p < 0.05, **p < 0.01.

Further, we assessed the ZHX family protein level in a mouse Carotid Artery Ligation (CAL) model. After 14 days of ligation, we confirmed the successful establishment of the CAL model through Hematoxylin and Eosin (HE) staining (Figure S1A). Western blot assay results revealed a significant reduction in ZHX2 protein in the CAL mice, while ZHX1 and ZHX3 protein levels remained stable compared to the Sham group (Figure 1C). This suggests a potential key role for ZHX2 in vascular remodeling.

Immunofluorescence results showed a reduction in ZHX2 expression, primarily in αSMA‐positive cells, in the CAL mice compared to the Sham group (Figure 1D). To stimulate primary VSMCs in vitro, we used PDGF‐BB, which caused a decrease in ZHX2 expression at the mRNA level (Figure 1E). The effectiveness of the stimulation was confirmed by PCNA and ACTA2 used as positive controls. Similar results were observed in the Western blot assay (Figure 1F).

Collectively, these results hint at a potentially significant role for ZHX2 in vascular remodeling.

3.2. ZHX2 Deficiency Aggravates Neointimal Formation Induced by Ligation and Promotes Proliferation and Migration of VSMCs Induced by PDGF‐BB

To examine ZHX2's role in vivo, we established a Myh11‐CreERT2‐mediated conditional ZHX2 knockout mouse (Figure S2A). To verify ZHX2's knockout, we extracted primary mouse vascular smooth muscle cells following regular injections of tamoxifen. Western blot assay results confirmed the knockout of ZHX2 protein in the smooth muscle of CKO mice, compared to Myh11‐CreERT2 mice (Figure S2C).

Post the Carotid Artery Ligation (CAL) experiment performed on ZHX2 CKO and Myh11‐CreERT2 mice, the tissue sections revealed a thicker intima in the ZHX2 CKO group, compared to the Myh11‐CreERT2 group, 14 days after ligation (Figure 2B). Because Myh11‐CreERT2 may also affect adventitial progenitor‐related populations, we further assessed adventitial remodeling in HE‐stained carotid sections. Quantification of the adventitial/media area ratio did not reveal a significant difference between Myh11‐CreERT2 and ZHX2 CKO mice after CAL (Figure S4). To assess smooth muscle cell proliferation during intimal hyperplasia in ZHX2 CKO mice, we evaluated the expression of Ki67 in carotid artery sections with an immunofluorescence experiment. The increased Ki67 expression indicated that ZHX2 knockout could enhance SMC proliferation (Figure 2C).

FIGURE 2.

ZHX2 deletion aggravates neointima formation and VSMC proliferation. (A) Experimental protocol for tamoxifen induction, CAL, and tissue analysis. (B) HE/Masson staining and I/M ratio in Myh11‐CreERT2 and ZHX2 CKO mice after CAL (n = 3). Scale bar = 50 μm. (C) IF staining of αSMA, Ki67, and DAPI, with Ki67+ cell quantification (n = 3). Scale bar = 50 μm. (D) RT‐qPCR analysis of cell‐cycle‐related genes in ligated arteries (n = 3). (E–G) Transwell, EdU, and wound‐healing assays in VSMCs after ZHX2 knockdown (n = 3). Scale bars = 100 μm. (H, I) RT‐qPCR and western blot analysis of cell‐cycle/proliferation markers in VSMCs after ZHX2 knockdown (n = 3). Data are mean ± SEM. Statistical significance was determined by unpaired Student's t‐test or t‐test with Welch's Correction. *p < 0.05, **p < 0.01. CKO, conditional knockout; I/M ratio, intima/media ratio.

Moreover, at the cellular level, primary rat smooth muscle cells infected with either Ad‐Scr‐sh or Ad‐ZHX2‐sh were subject to scratch tests, transwell, and EdU experiments. We found that ZHX2 knockdown could promote SMC proliferation and migration (Figure 2E–G). RT‐qPCR and Western blot results also suggested that ZHX2 knockdown could enhance SMC proliferation to some extent (Figure 2H,I).

In summary, our results suggest that ZHX2 knockdown could promote SMC proliferation both in vivo and in vitro.

3.3. ZHX2 Overexpression Alleviates Neointimal Formation Induced by Ligation and Suppresses Proliferation and Migration of VSMCs Induced by PDGF‐BB

Conversely, to determine if ZHX2 overexpression could curb VSMC proliferation, we established a CAL model in C57BL/6J mice and locally applied adenovirus to overexpress ZHX2. Carotid arteries were collected from the Ad‐Control and Ad‐ZHX2 groups following ligation. Histological staining of carotid artery tissue sections, 14 days post‐ligation, revealed a significant reduction in carotid artery intima thickening in the ZHX2 overexpression group compared to the control group (Figure 3A). Immunofluorescence of the tissue section showed a decrease in Ki67 positive cells in the Ad‐ZHX2 group mice compared to the control group, suggesting that ZHX2 overexpression could inhibit SMC proliferation (Figure 3B). The RT‐qPCR assay supported this by indicating that ZHX2 overexpression could restrain SMC proliferation in the CAL model (Figure 3C).

FIGURE 3.

Local ZHX2 overexpression attenuates neointima formation and VSMC activation. (A) HE/Masson staining and I/M ratio after local Ad‐Control or Ad‐ZHX2 delivery to ligated carotid arteries (n = 3). Scale bar = 50 μm. (B) IF staining of αSMA, Ki67, and DAPI, with Ki67+ cell quantification (n = 3). Scale bar = 50 μm. (C) RT‐qPCR analysis of cell‐cycle‐related genes in ligated arteries (n = 3). (D–F) Transwell, EdU, and wound‐healing assays in VSMCs after ZHX2 overexpression (n = 3). Scale bars = 100 μm. (G, H) RT‐qPCR and western blot analysis of cell‐cycle/proliferation markers in VSMCs after ZHX2 overexpression (n = 3). Data are mean ± SEM. Statistical significance was determined by unpaired Student's t‐test or t‐test with Welch's correction. *p < 0.05, **p < 0.01. Ad, adenovirus.

At the cellular level, primary rat smooth muscle cells infected with Ad‐Control or Ad‐ZHX2 demonstrated, through Western blot, successful overexpression of ZHX2 with the use of adenovirus (Figure 3H). Scratch tests, transwell, and EdU experimental results showed that ZHX2 overexpression could inhibit SMC proliferation and migration (Figure 3D–F). RT‐qPCR and Western blot assays also revealed ZHX2 overexpression inhibiting SMC proliferation to a certain extent (Figure 3G,H).

In summary, our results suggest that ZHX2 overexpression could inhibit SMC proliferation both in vivo and in vitro.

3.4. RNAseq Discloses Downstream Consequences of ZHX2 in VSMCs Stimulated by PDGF‐BB

To further explore the mechanism of ZHX2 inhibiting VSMC proliferation, we used adenovirus to infect primary smooth muscle cells, overexpressed ZHX2 and then conducted RNA‐seq to detect the influence of ZHX2 on the transcriptome level of VSMCs. Using RNA‐seq heatmap analysis, we evaluated the difference clustering of genes shown by the principal component analysis (PCA) between Ad‐Control and Ad‐ZHX2 (Figure 4A) and the difference in gene expression shown by the heatmap (Figure 4B). In addition, Gene Set Enrichment Analysis (GSEA) further displayed the co‐expression network of cell cycle‐related genes after ZHX2 overexpression from the sequencing data (Figure 4C). The GSEA enrichment plot of the most enriched Hallmark gene set “CELL_CYCLE” is shown (Figure 4D). The 10 genes with the highest enrichment scores in the “CELL_CYCLE” gene set are shown in the figure (Figure 4E).

FIGURE 4.

RNA‐seq identifies cell‐cycle‐related transcriptional changes induced by ZHX2 overexpression. (A) PCA of RNA‐seq data from Ad‐Control‐ and Ad‐ZHX2‐treated VSMCs. (B) Heatmap of DEGs. (C) GSEA bubble plot of enriched KEGG pathways. (D) Enrichment plot of the KEGG cell cycle pathway. (E) Representative genes from the KEGG cell cycle enrichment gene set. DEGs, differentially expressed genes.

3.5. GADD45G Is Identified as a Direct Target of ZHX2

Considering that ZHX2, as a transcription factor, plays a role in transcriptional regulation in various diseases, ChIP‐seq was used to explore the target genes regulated by ZHX2. We observed a distinct binding pattern at the transcription start sites (TSS) of differentially expressed genes (Figure 5A). These results suggest that ZHX2 may play a crucial role in the transcriptional regulation of upregulated and downregulated genes. To identify the most likely direct target of ZHX2 that affected the proliferation phenotype of VSMCs, we performed an intersection analysis of differentially expressed genes (DEGs) in RNA‐seq, ChIP‐seq target genes, and genes in the KEGG “CELL_CYCLE” pathway. The analysis showed that GADD45G appears in the intersection of these three datasets (Figure 5B). The interaction of ZHX2 with the promoter of GADD45G through ChIP‐seq signal trace images was shown (Figure 5C). Besides, we found that the binding site of ZHX2 with the GADD45G promoter region was highly conserved in humans, rats, and mice (Figure S3B). We constructed a GADD45G promoter reporter plasmid and mutated the possible binding sites of ZHX2 (Figure 5D). The luciferase reporter assay showed that ZHX2 overexpression could enhance the transcriptional activity of GADD45G, but had no effect on the promoter with a mutated ZHX2 binding sequence (Figure 5E). The ChIP experiment further confirmed that ZHX2 could directly bind to the GADD45G promoter region (Figure 5F). At the same time, we examined the impact of ZHX2 intervention on GADD45G protein levels and found that ZHX2 knockdown could inhibit the expression of GADD45G protein (Figure 5G), while ZHX2 overexpression could enhance the expression of GADD45G protein (Figure 5H). These results suggested that ZHX2 could directly bind to the promoter of GADD45G.

FIGURE 5.

ZHX2 directly binds to the GADD45G promoter and activates GADD45G transcription. (A) ChIP‐seq signal profiles and heatmaps of ZHX2 enrichment around TSSs. (B) Overlap of cell‐cycle‐related genes, DEGs, and ZHX2 ChIP‐seq targets. (C) Genome browser tracks showing ZHX2 enrichment at the GADD45G locus. (D) Predicted ZHX2‐binding motif and WT/MUT GADD45G promoter constructs. (E) Luciferase reporter assay of WT and MUT GADD45G promoters in 293T cells with ZHX2 overexpression (n = 5). (F) ChIP‐qPCR validation of ZHX2 enrichment at the GADD45G promoter (n = 6). (G,H) Western blot analysis of GADD45G, E2F1, and PCNA after ZHX2 knockdown or overexpression (n = 3). Data are mean ± SEM. Statistical significance was determined by unpaired Student's t‐test or t‐test with Welch's Correction. *p < 0.05, **p < 0.01. DEGs, differentially expressed genes; TSS, transcription start site.

3.6. Knockdown of GADD45G Counteracts the Inhibitory Effect of ZHX2 on VSMCs

To investigate whether GADD45G mediated the effect of ZHX2 on VSMC proliferation, we conducted transwell and EdU experiments. The results showed that the GADD45G knockdown reversed the effect caused by ZHX2 overexpression (Figure 6A,B). Subsequent RT‐qPCR and Western blot results also validated that GADD45G mediated the effect of ZHX2 on VSMC proliferation (Figure 6C,D). We also found that GADD45G knockdown could reverse the inhibition of neointima formation caused by ZHX2 overexpression in the mouse CAL model (Figure 6E). Consistent with the main findings, key validation experiments in female rat primary VSMCs showed that ZHX2 overexpression was associated with increased GADD45G expression and reduced VSMC proliferation, and this effect was attenuated by GADD45G knockdown (Figure S5). These results indicated that GADD45G knockdown could reverse the inhibition of neointima formation, VSMC proliferation, and migration caused by ZHX2 overexpression.

FIGURE 6.

GADD45G mediates the effects of ZHX2 on VSMC proliferation, migration, and neointima formation. (A, B) EdU and Transwell assays in VSMCs treated with Ad‐Control or Ad‐ZHX2 together with Ad‐Scr‐sh or Ad‐GADD45G‐sh (n = 3). Scale bars = 100 μm. (C) RT‐qPCR analysis of cell‐cycle‐related genes in VSMCs (n = 3). (D) Western blot analysis of ZHX2, GADD45G, E2F1, and PCNA under the indicated treatments (n = 3). (E) HE/Masson staining and I/M ratio after local adenoviral delivery in the CAL model (n = 3). Scale bar = 50 μm. Data are mean ± SEM. Statistical significance was determined by one‐way ANOVA with Bonferroni's post hoc test or Welch's ANOVA with Dunnett's T3 post hoc test. *p < 0.05, **p < 0.01.

4. Discussion

Intimal hyperplasia, characterized by the accumulation of VSMC in the arterial wall, is a common feature of pathological arterial remodeling. Combatting it is crucial in life‐threatening cardiovascular diseases, including coronary artery disease, stenosis and atherosclerosis. GWAS have yielded many results in the study of cardiovascular diseases, such as common genetic variants that increase the risk of coronary artery disease (CAD) [30]. There are still many genes involved in GWAS variation that have not been fully studied, and their in‐depth exploration may reveal new biological mechanisms. Several genome‐wide association studies have shown a strong association between changes in the ZHX2 locus and right carotid artery IMT [28]; this suggests that ZHX2 may play an important role in pathological vascular remodeling and neointimal formation in diseases such as stenosis and atherosclerosis.

In the present study, we identified ZHX2 as a protective regulator of injury‐associated vascular remodeling characterized by neointimal hyperplasia. ZHX2 expression was reduced in injured arteries and in PDGF‐BB‐stimulated VSMCs, whereas loss of ZHX2 aggravated and overexpression of ZHX2 attenuated VSMC proliferative phenotypes and neointima formation. Mechanistically, our data support a pathway in which ZHX2 transcriptionally activates GADD45G, thereby restraining VSMC proliferation and migration. These findings suggest that the ZHX2/GADD45G axis contributes to the control of excessive VSMC activation in the setting of vascular injury.

However, the biological consequence of VSMC proliferation and migration is highly context‐dependent. In injury‐induced neointimal hyperplasia, excessive VSMC proliferation and migration are major contributors to luminal narrowing and maladaptive vascular remodeling; therefore, restraining these responses may be beneficial in restenosis‐like settings. However, VSMCs can also play protective roles in other vascular contexts. In advanced atherosclerotic lesions, VSMC‐derived cells may contribute to fibrous cap formation, extracellular matrix deposition, and plaque stabilization. Thus, excessive or nonselective suppression of VSMC responses could theoretically impair vascular repair or plaque stability. For this reason, the therapeutic implications of the ZHX2/GADD45G axis should be interpreted in a disease‐stage‐ and context‐dependent manner.

More and more evidence shows that ZHX2 is an important regulator of various biological processes, including regulating the development of various cancers such as liver cancer, gastric cancer, and thyroid cancer, and participating in lipid metabolism, cell differentiation and development, NK cell maturation, and macrophage cell polarization, etc. [31]. Many literatures have reported that ZHX2 has an inhibitory effect on the proliferation and migration of different types of cells [17, 21, 32, 33, 34, 35, 36, 37]. Some literature reported that ZHX2 may be related to apoptosis [33, 35]. There are also some literature reports that ZHX2 overexpression can promote proliferation and migration and inhibit apoptosis [38, 39, 40].

However, ZHX2 may also participate in vascular remodeling through other cell types, including endothelial cells, fibroblasts, and immune cells. Although we used Myh11‐CreERT2‐mediated conditional ZHX2 knockout mice to examine its role in ligation‐induced carotid artery injury, these experiments do not exclude contributions from ZHX2 in other vascular or inflammatory cell populations. Indeed, ZHX2 deficiency in bone marrow has been reported to ameliorate atherosclerosis by reducing inflammation and macrophage apoptosis [41], whereas our findings indicate a protective role for ZHX2 in VSMCs during injury‐induced neointimal remodeling. These observations suggest that the effects of ZHX2 are cell‐type‐ and disease‐context‐dependent, which should be considered when evaluating this pathway as a therapeutic target. Further studies using cell‐specific approaches are required to define the roles of ZHX2 in different vascular cell populations. Another limitation is that the main in vivo experiments were conducted predominantly in male mice. Although key findings were additionally validated in female rat primary VSMCs, the present study was not designed for direct sex comparisons. Further studies including both sexes are therefore needed to determine whether the ZHX2/GADD45G axis is regulated in a sex‐dependent manner during vascular remodeling.

The GADD45 family proteins, including GADD45A, GADD45B, and GADD45G, are small proteins with high homology found in the nucleus and cytoplasm. They are known as “Stress Sensor Genes” as they respond to various stress signals, including DNA damage, ultraviolet radiation, oxidative stress, and chemical exposure. GADD45 family proteins have significant functional similarities and regulate several biological processes. They interact with various crucial proteins, bind RNA to affect their stability, and demethylate specific genes. These processes include cell cycle arrest, DNA repair, apoptosis, and cell survival and senescence [42, 43]. GADD45G affects the cell cycle in several ways. It can inhibit the kinase activity of Cdk1/cyclinB1 by directly interacting with the CDK1/cyclinB1/PCNA complex [44]. It can also induce CDKN1A's expression [45] and downregulate the expression of E2F1 by passing the p38 MAPK pathway [46]. Our research found that ZHX2's overexpression significantly increased CDKN1A's expression, decreased E2F1's expression, and inhibited the proliferation and migration of VSMCs in PDGF‐BB‐stimulated VSMCs. Knocking down GADD45G on this basis reversed the effects on them. This indicates that GADD45G is the key downstream mediator for ZHX2 to exert its inhibitory effect on VSMCs' proliferation and migration.

Taken together, our study identifies ZHX2 as a negative regulator of excessive VSMC activation and injury‐associated neointimal remodeling. By transcriptionally activating GADD45G, ZHX2 restrains VSMC proliferation and migration. These findings support the ZHX2/GADD45G axis as a potential target for vascular proliferative remodeling characterized by neointimal hyperplasia, while its broader therapeutic relevance in complex vascular diseases requires further context‐specific evaluation. From a translational perspective, the ZHX2/GADD45G axis may be particularly relevant to injury‐associated vascular proliferative remodeling, such as restenosis‐like neointimal hyperplasia. Because ZHX2 overexpression in our in vivo model was achieved by local adenoviral delivery to the ligated carotid artery, local modulation of this pathway may be more feasible and potentially safer than systemic intervention. However, future studies are needed to optimize delivery strategies and to determine whether this pathway can be targeted in clinically relevant vascular injury settings.

Author Contributions

Zhe Zheng, Yue Li, and Kai Huang conceived and designed the research; Siyuan Fan, Xuelian Wu, and Lin Gui performed the experiments; Yichen Wu and Baoru Qiao contributed to data analysis; Zhe Zheng, Yue Li, and Kai Huang wrote and revised the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (Grants 82200953, 81830014, and 91949201) and the Medical Science and Technology Program of Henan Province (Grants LHGJ20220297 and LHGJ20220286).

Ethics Statement

All animal experiments were approved by the Institutional Animal Care and Use Committee of Huazhong University of Science and Technology.

Consent

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: Representative HE staining of carotid arteries after CAL. HE‐stained carotid artery sections from sham and CAL mice. Scale bar = 50 μm.

Figure S2: Generation and validation of ZHX2 CKO mice. (A) Schematic diagram of the ZHX2 floxed allele and Cre‐mediated recombination. (B) PCR genotyping of ZHX2 floxed alleles and Cre recombinase. (C) Western blot validation of ZHX2 deletion in VSMCs from Myh11‐CreERT2 and ZHX2 CKO mice. Representative results are shown. CKO, conditional knockout.

Figure S3: ZHX2 ChIP‐seq peak distribution and conservation of the GADD45G promoter binding site. (A) Genomic distribution of ZHX2 ChIP‐seq peaks. (B) Sequence alignment of the predicted ZHX2‐binding site in the GADD45G promoter among human, mouse, and rat.

Figure S4: Adventitial remodeling after ZHX2 deletion. HE staining and quantification of adventitial/media ratio in Myh11‐CreERT2 and ZHX2 CKO mice after CAL. No significant difference was observed between the two groups. n = 3 mice per group. Scale bar = 200 μm. Data are mean ± SEM. Statistical significance was determined by unpaired Student's t‐test or Welch's t‐test.

Figure S5: GADD45G knockdown attenuates the effects of ZHX2 overexpression in female rat primary VSMCs. (A) EdU assay in VSMCs treated with Ad‐Control or Ad‐ZHX2 together with Ad‐Scr‐sh or Ad‐GADD45G‐sh (n = 3). Scale bar = 100 μm. (B) Western blot analysis of ZHX2, GADD45G, E2F1, and PCNA under the indicated adenoviral treatments (n = 3). Data are mean ± SEM. Statistical significance was determined by one‐way ANOVA with Bonferroni's post hoc test or Welch's ANOVA with Dunnett's T3 post hoc test. *p < 0.05, **p < 0.01.

Table S1: fsb272180‐sup‐0006‐Supinfo.docx.

Data Availability Statement

We obtained the gene expression profiles for carotid atheroma from the Gene Expression Omnibus database (GEO; http://www.ncbi.nlm.nih.gov/geo/). The accession numbers were GSE43292 and GSE70410. RNA‐seq and ChIP‐seq analyses were performed in this study, and these data were deposited in the NCBI Gene Expression Omnibus (GEO) under accession number GSE244565.