Skip to main content
NCBI home page
BMC Microbiology logoLink to BMC Microbiology
. 2026 Jun 1;26:694. doi: 10.1186/s12866-026-05225-y

The dual role of cAMP receptor protein (CRP) in regulating type 3 fimbriae expression in Klebsiella pneumoniae CG43S3 in response to oxygen availability

Tien-Huang Lin 1,2,#, Chen-Yu Wang 3,4,#, Chien-Chen Wu 5, Der-Yen Lee 6, Ching-Ting Lin 7,✉
PMCID: PMC13435484  PMID: 42226104

Abstract

Background

In Asian countries, Klebsiella pneumoniae is the predominant pathogen isolated from liver abscesses in patients with diabetes mellitus (DM). Elevated glucose level in DM patients causes various immune problems and may enhance K. pneumoniae virulence. Oxygen availability is another crucial factor influencing virulence factors expression during bacterial infections. The cyclic adenosine monophosphate (cAMP) receptor protein (CRP) plays a key role in mediating virulence factor expression in response to dynamic glucose levels in K. pneumoniae.

Results

This study investigated the regulation of CRP in type 3 fimbriae expression of K. pneumoniae CG43S3 in response to oxygen availability. We observed that anaerobically grown bacteria exhibited increased type 3 fimbriae expression. Glucose addition increased type 3 fimbriae expression under aerobic conditions but reduced it under anaerobic conditions. Exogenous cAMP supplementation complemented the biphasic role of glucose in response to oxygen availability. Deletion of cyaA (encoding adenylate cyclase) or cpdA (encoding phosphodiesterase) altered type 3 fimbriae expression, highlighting the role of cAMP signaling in this regulation. Under anaerobic conditions, CRP acted as an activator of type 3 fimbriae expression, contrasting with its repressive role under aerobic conditions. The biphasic regulatory activity of CRP was also observed in the promoter activity of cyclic diguanosine monophosphate (c-di-GMP)-related gene cluster mrkHIJ and the intracellular concentration of c-di-GMP. Among the nine c-di-GMP related genes containing a typical CRP binding site, the biphasic regulatory activity of CRP was also reflected in mediating the mRNA expression of D364_RS04770 (a putative diguanylate cyclase). Overexpression of D364_RS04770 not only increases type 3 fimbriae expression but also compensates for the absence of crp, further leading to the repression activity of CRP on type 3 fimbriae expression under anaerobic conditions. Furthermore, anaerobic conditions triggered the role of CRP in activating biofilm formation.

Conclusions

Our study identifies a novel oxygen-dependent switch in CRP function and highlights D364_RS04770 as a key downstream effector, distinguishing this mechanism from previously known glucose-dependent regulation in K. pneumoniae CG43S3. Additionally, D364_RS04770 may act as a mediator to influence the regulation of CRP on type 3 fimbriae expression in response to oxygen availability. Understanding these regulatory mechanisms provides a deeper insight into bacterial pathogenesis and potential therapeutic targets.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12866-026-05225-y.

Keywords: Klebsiella pneumoniae, CRP, Oxygen availability, Type 3 fimbriae, Biofilm, c-di-GMP

Introduction

Klebsiella pneumoniae, a facultative anaerobe, is a predominant pathogen causing pyogenic liver abscess in diabetic patients, particularly in Asia, with increasing reports in Western countries [1]. However, pyogenic liver abscess isolates often carry heavy capsular polysaccharides (CPS) loads that could protect the bacteria from phagocytosis and killing by serum factors [2, 3]. Beyond CPS, its virulence is significantly enhanced by fimbriae, particularly type 3 fimbriae, which are central to its ability to form the biofilms on diverse surfaces [4]. Biofilm formation contributes to nosocomial infections and increases the bacterial resistance to antibiotics, complicating treatment strategies [5]. To establish a successful infection, bacteria need to sense the variation of nutrient concentrations and subsequently regulate the expression of suitable virulence factors [6]. Therefore, linking signal transduction to the precise coordination of virulence factor expression is a critical step during infection.

Oxygen availability has a profound impact on bacterial pathogenesis. Oxygen levels within different host environments can significantly affect the expression of virulence factors, the metabolism, and the stress responses. In many facultative anaerobes (Escherichia coli, Salmonella enterica, Shigella spp., Pseudomonas aeruginosa et al.), effects of oxygen availability on modulating the expression of the metabolic adaption related genes and virulence genes during infection have been demonstrated [7]. In K. pneumoniae, we found that oxygen-sensing regulator, fumarate nitrate reduction regulator (FNR), could repress the expression of RmpA and RmpA2 to decrease the CPS biosynthesis under anaerobic conditions [8]. However, the primary structure of FNR is highly homologous to the structure of CRP in E. coli [9]. However, the impact of CRP on regulating the virulence factors in K. pneumoniae in response to oxygen availability still remains largely unknown.

The cAMP and CRP are crucial in bacterial pathogenesis, regulating gene expression in response to dynamic environmental signals, particularly glucose level [10]. cAMP, a secondary messenger, varies with cellular metabolic states and influences CRP, which forms a homodimer to bind specific DNA sequences known as (TGTGA-N6-TCACA and TGCGA-N6-TCGCA), altering the genes transcription essential for bacterial adaptation [11, 12]. The pathway impacts bacterial virulence, metabolism, and stress responses. In aerobically grown K. pneumoniae CG43S3, CRP-cAMP complex can inhibit CPS biosynthesis and decrease the type 3 fimbriae expression by repressing the transcription of mrkHIJ, a gene cluster whose products directly sense and metabolize c-di-GMP to regulate type 3 fimbriae expression [13–16]. Within this cluster, MrkH binds c-di-GMP via its PilZ domain to activate fimbriae expression [16–18]. MrkI acts as a LuxR-type transcriptional activator [15]. In contrast, MrkJ hydrolyzes c-di-GMP through its EAL domain phosphodiesterase activity to repress fimbriae expression [19]. Additionally, the uptake of glucose and thus the activity of CRP-cAMP are affected by oxygen availability [20, 21], with studies showing that anaerobic conditions enhance the regulatory activity of CRP-cAMP in enterohaemorrhagic E. coli [22]. Furthermore, modifications to the CRP in E. coli can enhance bacterial tolerance to oxidative stress, suggesting an involvement of CRP-cAMP in bacterial response to oxygen availability [23].

Therefore, we aimed to investigate whether oxygen availability modulates the regulatory role of CRP-cAMP in type 3 fimbriae expression and biofilm formation in K. pneumoniae CG43S3. Since c-di-GMP signaling plays a critical role in controlling type 3 fimbriae expression through the mrkHIJ gene cluster [13, 15, 16], we further explored whether CRP exerts its oxygen-dependent regulatory effects through modulation of intracellular c-di-GMP levels. In particular, we examined the potential role of D364_RS04770 (orthologous to KP1_1863), a putative diguanylate cyclase whose upstream sequence contains a predicted CRP binding site [13], as a candidate mediator connecting CRP regulation to type 3 fimbriae and biofilm formation in K. pneumoniae CG43S3 in response to oxygen availability.

Methods

Strains, plasmids, and growth conditions

The bacterial strains and plasmids used in this study are described in Table 1. Bacterial was routinely cultured at 37 °C in LB medium supplemented with the different environmental cues, containing the indicated concentrations of glucose and cAMP. For aerobic conditions, bacteria were grown overnight in the LB with agitation (200 rpm) at 37 °C to the late exponential phase (approximately OD600 = 1.0). For anaerobic conditions, a one-hundred-fold dilution of overnight aerobically grown bacteria was refreshed in LB statically under 10% CO2 and 90% N2 condition at 37 °C for 24 h.

Table 1.

Bacterial strains and plasmids used in this study

Strains or plasmids Descriptions Source
K. pneumoniae
CG43S3 CG43 Smr, K2 serotype [24]
∆cyaA CG43S3∆cyaA [14]
∆cpdA CG43S3∆cpdA [14]
∆crp CG43S3∆crp [14]
∆lacZ CG43S3∆lacZ [25]
∆lacZ∆crp CG43S3∆lacZ∆crp [14]
E. coli
DH5α supE44∆lacU169 (f80 lacZ∆M15)hsdR recA1 endA1 gyrA96 thi-1 relA1 [26]
S17-1 λ pir hsdR recA pro RP4-2 [Tc::Mu; Km::Tn7] [λpir] [27]
Plasmids
yT&A Apr, TA cloning vector Yeastern
pACYC184 TcrCmr, low copy number cloning vector New England Biolabs
pETQ Kmr, protein expression vector [28]
pcrp Cmr, 987-bp fragment containing the upstream and coding region of crp cloned into pACYC184 [14]
pETQ_04770 Cmr, 1227-bp fragment containing the coding region of D364_RS04770 cloned into pETQ This study
pmrkAZ15 Cmr, 402-bp fragment containing the region upstream of mrkA cloned into placZ15 [13]
pmrkHIZ15 Cmr, 405-bp fragment containing the region upstream of mrkHI cloned into placZ15 [13]
pmrkJZ15 Cmr, 233-bp fragment containing the region upstream of mrkJ cloned into placZ15 [13]
Open in a new tab

Western blotting

Total cell lysates were prepared from the indicated K. pneumoniae strains. Protein samples (approximately 5 µg per lane) were separated by SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes. Western analysis was performed as previously described [13]. The membranes were probed with rabbit anti-MrkA (customer antibody generated by LTK BioLaboratories), mouse anti-CRP (BioLegend), and mouse GAPDH (GeneTex) as primary antibodies. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG (Abcam) were used as secondary antibodies. Immunoreactive bands were visualized using the Enhanced Chemiluminescence (ECL) Western Blotting Substrate (PerkinElmer, Wellesley, MA, USA) and detected using the ImageQuant LAS 4000 mini system (GE Healthcare, USA). The expression levels of target proteins were quantified using ImageJ software and normalized to the corresponding GAPDH internal control to account for potential variations in bacterial growth and sample loading. Data are presented as mean ±SD from three independent experiments (n = 3).

Quantitative Reverse-Transcription PCR (qRT-PCR)

Total RNA extraction, reverse transcription of mRNA to cDNA, qRT-PCR, and data analysis were performed as previously described [13, 14]. The primer used for qRT-PCR was listed in Table 2. Relative gene expressions were quantified using the comparative threshold cycle 2−∆∆CT method with recA as the endogenous reference.

Table 2.

Primers used in qRT-PCR analysis

Primers Sequence (5’◊3’) TaqMan probes Target
RT297 tcctgtctatgcacgcaaac 62 recA
RT298 cgcgtcacagatctccag
RT29 taagcaaactgggcgtgaa 20 mrkA
RT30 tagccctgttgtttgctggt
GT46 gtttaagttccgccatctcg 120 mrkH
GT47 ttgcgcttggcttctaagat
GT42 agttatgccgatgtcatccat 59 mrkI
GT43 gattctgatggcagaaatatcctt
GT54 tttcgaggtaaccgaaaacg 84 mrkJ
GT55 gaggtatcctgtgggctctg
RT155 cggactacgtggtggatga 158 yjcC
RT156 cgcagagagattgatggcta
RT159 ctggctggatgattttggtc 67 D364_RS06120
RT160 ccactttgacgcaatcgaa
RT161 cgtaggctggctgatgga 40 D364_RS08300
RT162 tctgtctcggtgacctcgat
RT163 tacgggagccatgaatacg 30 D364_RS13620
RT164 gggtttgctgatatcgatgg
RT177 atgcgctgtccatgagtatg 20 D364_RS04770
RT178 ggaagaaaatcattaacgcaaaa
RT179 aagccggttaacggatcg 70 D364_RS09380
RT180 ccgaagaagtgcatctgaaaa
RT181 agccgctgctctatgctct 84 D364_RS06140
RT182 ggagacgcttacgcaatatca
RT183 agcgtgataagcgtggtgat 66 D364_RS15385
RT184 agcgtgaagattgaggctgt
RT188 gcgaccggcatatctttg 60 bcsE
RT189 ctgttgggcgctgatacc
Open in a new tab

Measurement of promoter activity

The promoter-reporter plasmids, pmrkAZ15, pmrkHIZ15, and pmrkJZ15 were individually mobilized into K. pneumoniae strains by conjugation from E. coli S17-1 λpir. The bacteria were grown in LB broth under aerobic and anaerobic conditions, and the β-galactosidase activity was measured as previously described [25].

Detection of c-di-GMP and cAMP

Intracellular concentrations of c-di-GMP and cAMP were extracted in the indicated K. pneumoniae strains by using heat and ethanol as previously described [29]. Lyophilized samples were analyzed by UPLC-ESI-MS/MS (ultra-performance liquid chromatography-positive electrospray ionization-mass/mass spectrometry), consisting of ACQUITY UPLC I-Class and Xevo TQ-XS Triple Quadrupole Mass Spectrometry (Waters). Standards of c-di-GMP and cAMP were used to construct daughter ion scan spectra for identity confirmation and also for quantitative calculation by multiple reaction monitoring, respectively. The content of c-di-GMP and cAMP in samples was quantified by LC peak areas based on the calibration curve of standards and normalized to the total cellular protein concentration

Purification of His6-CRP protein and Electrophoretic Mobility Shift Assay (EMSA)

The recombinant His6-CRP protein was overexpressed in E. coli BL21(DE3) carrying pET30b-CRP and purified from the soluble fraction using His-Bind resin (Novagen) as previously described [14]. For EMSA, the DNA fragment containing the promoter region of D364_RS04770 was PCR-amplified by pfu polymerase using specific primer pairs GT607 (5’-CTCTGCGGATCCGGCATTGG-3’) and GT608 (5’-ATATGATAAACCATGTTACCGGGA-3’). The PrcsA−2 DNA fragment, obtained as previously described [14], was used as a negative control. The binding reaction was performed by incubating the indicated concentration of purified His6-CRP with 10 ng DNA in a 15 µl solution containing 4 mM Tris-HCl (pH 7.4), 10 mM KCl, 100 mM dithiothreitol, 200 µM cAMP, and 10 µg/ml BSA at room temperature for 30 min. The DNA-protein complexes were resolved onto a 5% native polyacrylamide supplemented with 200 µM cAMP and visualized with SYBR Green I dye (Invitrogen) staining.

Construction and overexpression of D364_RS04770

To generate the D364_RS04770 overexpressed plasmid, pETQ_04770, DNA fragment containing the coding sequence of D364_RS04770 was individually PCR-amplified with primer pair GT518 (5’-CGGATCCCGGTAACATGGTTTATCATAT-3’) and GT519 (5’-CAGCGTCTCCGGGTTAATAAG-3’). This fragment was first cloned into the yT&A vector (Yeastern) and the correctness of the cloned insert was verified by DNA sequencing (results provided in supplementary material). The verified fragment was then subcloned into the expression vector pETQ. The resulting plasmid, pETQ_04770, was transformed into the indicated K. pneumoniae strains, and overexpression of D364_RS04770 was induced in LB broth under anaerobic conditions by adding 0.1 mM IPTG for 24 h at 37 °C.

Biofilm formation

Biofilm formation was assessed by the ability of the cells to adhere to glasses tube, with some modification to the reported protocol [30]. Tubes containing a 1:10 dilution of overnight bacteria culture were incubated statically at 37 °C for 24 h under aerobic and anaerobic conditions for biofilm formation. Unadherent bacteria were washed three times with 200 µl PBS, and adherent bacteria were stained with 200 µl of 0.1% safranin solution at room temperature for 30 min. Tubes were rinsed twice with deionised water to remove excess stain. Finally, the safranin-stained biofilm was solubilized in 200 µl of 95% ethanol, and the absorbance determined at a wavelength of 492 nm.

Statistical analysis

The experiments for promoter activity, qRT-PCR analysis, and biofilm formation were performed in at least three independent biological replicates. The results are presented as the mean and standard deviation. An unpaired t-test or one-way ANOVA evaluated group differences in GraphPad Prism 8.0 software. The statistical significance was set *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Results

Effect of oxygen availability on the regulation of glucose on the type 3 fimbriae expression

The impact of oxygen availability on the regulation of glucose on type 3 fimbriae expression in K. pneumoniae CG43S3 was investigated. Initially, MrkA production, a major component of type 3 fimbriae, was assessed in K. pneumoniae grown in LB with or without the indicated concentration of glucose under aerobic and anaerobic conditions. As shown in Fig. 1A, it was observed that MrkA production was higher in anaerobic conditions compared to aerobic conditions when K. pneumoniae was grown in LB alone. Consistent with previous findings [13], MrkA production increased with increasing glucose concentration under aerobic conditions. Notably, the positive effect of glucose on MrkA production under aerobic conditions was reversed to a negative effect under anaerobic conditions. This suggests that oxygen availability plays a critical role in modulating the impact of glucose on type 3 fimbriae expression in K. pneumoniae.

Fig. 1.

Fig. 1

Open in a new tab

Glucose and cAMP affect type 3 fimbriae expression of K. pneumoniae CG43S3 in response to oxygen availability. AK. pneumoniae CG43S3 were grown aerobically and anaerobically in LB broth supplemented with glucose as indicated, at 37 °C to observe the type 3 fimbriae expression by Western blot analysis against MrkA protein. B MrkA expression of WT, ∆cyaA, and ∆cpdA strains grown under aerobic and anaerobic conditions was also determined. The fold changes in MrkA expression relative to the WT strain grown aerobically in LB broth were quantified using Image J software. Values are normalized to the aerobically grown WT strain (set as 1.0) after normalization to GAPDH. Data are presented as mean ±SD from three independent experiments (n = 3)

To further investigate the involvement of cAMP in the biphasic role of glucose in type 3 fimbriae expression in response to oxygen availability, 1 mM cAMP was added to LB with 0.5% glucose to observe MrkA production in K. pneumoniae under aerobic and anaerobic conditions. As shown in Fig. 1A, the addition of 1 mM cAMP decreased MrkA production in LB with 0.5% glucose under aerobic conditions, while it increased MrkA production under anaerobic conditions. This indicates that exogenous cAMP can complement the biphasic role of glucose in the type 3 fimbriae expression in response to oxygen availability.

To further confirm the biphasic role of cAMP and to bypass upstream glucose metabolism on MrkA production, the deletion effect of cyaA and cpdA, which respectively encodes adenylate cyclase and cAMP phosphodiesterase from K. pneumoniae CG43S3 [14], on type 3 fimbriae expression in K. pneumoniae under aerobic and anaerobic conditions was observed. As shown in Fig. 1B, the deletion of cyaA, leading to the absence of cAMP synthesis, increased MrkA production under aerobic condition but decreased it under anaerobic condition. Conversely, deletion of cpdA, which prevents cAMP degradation to mimic high cAMP levels, decreased the MrkA production under aerobic conditions but increased it under anaerobic conditions. These results indicate that oxygen availability is a major determinant in reversing the regulatory role of glucose on type 3 fimbriae expression in K. pneumoniae. Notably, this reversal is mediated through the CRP-cAMP signaling pathway in an oxygen-dependent manner, rather than being solely determined by intracellular cAMP concentration.

Divergent regulation of CRP-cAMP in the type 3 fimbriae expression in response to oxygen availability

To investigate whether the regulatory role of CRP in K. pneumoniae CG43S3 is modulated by oxygen availability, we first measured the expression of crp at transcriptional and translational levels in K. pneumoniae CG43S3 grown in LB medium under aerobic and anaerobic conditions. As shown in Fig. 2A, both the mRNA levels of crp and the intracellular CRP protein levels were increased in anaerobically grown K. pneumoniae CG43S3. To assess the impact of oxygen availability on the regulatory activity of CRP, we determined MrkA production in WT and Δcrp strains grown in LB under aerobic and anaerobic conditions. Consistent with our previous study [13], deletion of crp led to increased MrkA production in aerobically grown K. pneumoniae. However, under anaerobic conditions, the deletion of crp resulted in decreased MrkA production (Fig. 2B). To further validate the impact of crp deletion in K. pneumoniae CG43S3, complementation experiments were conducted. Under aerobic conditions, the ∆crp strain carrying the complement plasmid (pcrp) exhibited reduced MrkA production compared to the strain carrying the empty vector (pACYC184). In contrast, under anaerobic conditions, the introduction of pcrp into the ∆crp strain significantly enhanced MrkA production compared to the empty vector control. These results suggest that CRP acts as a repressor of MrkA production under aerobic conditions but functions as an activator of MrkA production when K. pneumoniae is grown in anaerobic conditions.

Fig. 2.

Fig. 2

Open in a new tab

Role of oxygen availability in the regulation of CRP on the type 3 fimbriae expression in K. pneumoniae CG43S3. A Expression of crp at transcriptional and translational levels. Relative mRNA levels of crp were measured by qRT-PCR in K. pneumoniae CG43S3 grown in LB medium under aerobic and anaerobic conditions (upper panel). Intracellular CRP protein levels were determined by Western blotting (lower panel). The fold changes indicated below the bands were calculated relative to the aerobic condition (set as 1.0) after normalization to GAPDH. B MrkA expression levels of WT and ∆crp strains (upper panel), as well as the complements strains (lower panel), were analysed under aerobic and anaerobic conditions using Western blot analysis with MrkA antiserum. MrkA expression was quantified using ImageJ software, and fold changes were calculated relative to the WT strain or the ∆crp strain carrying the empty plasmid pACYC184 (empty vector, C) grown aerobically (set as 1.0) after normalization to GAPDH. Data are presented as mean ±SD from three independent experiments (n = 3). C qRT-PCR analyses of the mrkA expression for WT and ∆crp strains grown in LB medium under aerobic and anaerobic conditions were determined. D β-galactosidase activities of K. pneumoniae CG43S3∆lacZ and the isogenic strain (∆lacZ∆crp) carrying the reporter plasmid pmrkAZ15 (PmrkA::lacZ) were determined under aerobic and anaerobic conditions. The results are representative of three independent experiments, with error bars indicating standard deviations. Asterisk indicate significant differences between the indicated groups

In aerobically grown K. pneumoniae CG43S3, CRP has been demonstrated to act as a repressor for type 3 fimbriae expression at transcriptional level [13]. To determine if the activation of CRP on type 3 fimbriae expression under anaerobic conditions also occurs at the transcriptional level, we evaluated the effect of crp deletion on the mRNA level and promoter activity of mrkA in anaerobically grown K. pneumoniae CG43S3. Our results showed that the mRNA levels of mrkA were higher in WT strain under anaerobic condition compared to aerobic conditions. Additionally, the Δcrp strain exhibited higher mRNA level of mrkA under aerobic conditions, but lower under anaerobic conditions (Fig. 2C). Furthermore, we used a plasmid carrying PmrkA fused with the lacZ reporter gene to assess mrkA promoter activity. Our results indicated that PmrkA activity was significantly lower in the ΔlacZΔcrp strain compared to the ΔlacZ strain (Fig. 2D), suggesting that CRP activates type 3 fimbriae expression at the transcriptional level under anaerobic condition.

Effect of CRP on the expression of mrkH, mrkI, and mrkJ in response to oxygen availability

Previously, we demonstrated that CRP represses the expression of type 3 fimbriae in K. pneumoniae CG43S3 by repressing the transcription of mrkH, mrkI, and mrkJ [13]. To further investigate the impact of oxygen availability on the regulatory activity of CRP in the transcription of mrkH, mrkI, and mrkJ, we examined the mRNA levels of these genes in WT and Δcrp strains under aerobic and anaerobic conditions using qRT-PCR. As shown in Fig. 3A, the mRNA levels of mrkH, mrkI, and mrkJ were apparently increased in K. pneumoniae grown under anaerobic conditions, suggesting that anaerobic conditions activate the mRNA levels of these genes. Under aerobic conditions, the deletion of crp resulted in increased mRNA levels of mrkH, mrkI, and mrkJ, consistent with CRP acting as a repressor. However, under anaerobic conditions, the mRNA levels of mrkH, mrkI, and mrkJ were significantly reduced in the Δcrp strain compared to the WT strain (Fig. 3A). To further assess transcriptional regulation, we measured the promoter activities of PmrkHI and PmrkJ (Fig. 3B). Consistent with mRNA data, the promoter activities were increased under anaerobic conditions. We found that the repressive role of CRP on the promoter activities of PmrkHI and PmrkJ under aerobic conditions was reversed to an activating role under anaerobic conditions. These results suggest that CRP acts in a biphasic manner to mediate the transcription of mrkH, mrkI, and mrkJ in response to oxygen availability in K. pneumoniae CG43S3.

Fig. 3.

Fig. 3

Open in a new tab

Transcriptional analysis of mrkhij in wt and δcrp strains under aerobic and anaerobic conditions. A qRT-PCR analysis of mrkH, mrkI, and mrkJ expression was measured in WT and ∆crp strains grown in LB medium under aerobic and anaerobic conditions. β-galactosidase activities of K. pneumoniae CG43S3∆lacZ and the isogenic strain (∆lacZ∆crp) carrying the reporter plasmid pmrkHIZ15 (PmrkHI::lacZ) (B) and pmrkJZ15 (PmrkJ::lacZ) (C) were determined under aerobic and anaerobic conditions. Data for qRT-PCR (A) are presented as mean±SD from six independent biological replicates (n = 6), while promoter activity data (B, C) represent the mean±SD from three independent experiments (n = 3). Asterisks indicate significant differences between the indicated groups

Effect of CRP on the intracellular c-di-GMP concentration in response to oxygen availability

In previous study [13], we have demonstrated that CRP could repress the intracellular concentration of c-di-GMP in K. pneumoniae CG43S3 when grown under aerobic condition. To further investigate the impact of oxygen availability on the role of CRP in regulating c-di-GMP levels in K. pneumoniae CG43S3, we measured the intracellular concentration of c-di-GMP in WT and Δcrp strains grown under aerobic and anaerobic conditions. As shown in Fig. 4A, both WT and Δcrp strains grown under anaerobic conditions led to an increase c-di-GMP levels compared to those grown under aerobic Consistent with our previous findings [13], deletion of crp resulted in an increased relative concentration of c-di-GMP under aerobic conditions. However, under anaerobic conditions, the relative concentration of c-di-GMP in the Δcrp strain was lower than that in the WT strain. Complementation experiments further confirmed the effect of crp deletion on c-di-GMP levels, as shown in Fig. 4B. These results suggest that the intracellular c-di-GMP concentration is the critical mediator affecting the regulation of CRP in type 3 fimbriae expression in response to oxygen availability.

Fig. 4.

Fig. 4

Open in a new tab

Intracellular c-di-GMP levels in WT and Δcrp strains under aerobic and anaerobic conditions. A The c-di-GMP levels in WT and Δcrp strains, and (B) in the complementation strains, were measured in LB medium under aerobic and anaerobic conditions as described in the Methods section. Relative c-di-GMP levels were calculated by comparing the c-di-GMP concentration of the indicated strains to those of the aerobically grown WT strain (A) or the aerobically grown Δcrp strain carrying pACYC184 (B), which were set as 100%. Results are representative of three independent experiments, with error bars indicating standard deviations. An asterisk indicates a significant difference between the indicated groups

CRP regulation of c-di-GMP-related genes in response to oxygen availability

In our previous study, we identified that the upstream sequences of 9 c-di-GMP related genes in K. pneumoniae CG43S3 possess the typical CRP binding site [13]. To further investigate the impact of oxygen availability on the mRNA expression of these c-di-GMP related genes in WT and Δcrp strains, we measured the mRNA levels of them under aerobic and anaerobic conditions. As shown in Fig. 5A, the mRNA of GGDEF domain-containing genes (D364_RS04770, D364_RS06140, D364_RS09380, and D364_RS15385) were increased in the WT grown under anaerobic conditions compared to aerobic conditions. Under anaerobic conditions, only the mRNA expression of D364_RS04770 was decreased in the Δcrp strain compared to that in the WT strain, which is opposite to the impact under aerobic conditions. However, there was no apparent difference in the mRNA expression of D364_RS06140, D364_RS09380, and D364_RS15385 between the WT and Δcrp strains under anaerobic conditions. Furthermore, we also observed the mRNA expression of EAL domain-containing genes (D364_RS06120, D364_RS08300, D364_RS13620, and yjcC) and bcsE (containing a GIL domain) in WT and Δcrp strains under aerobic and anaerobic conditions. In Fig. 5B, we found that only the mRNA expression D364_RS06120 in the WT strain was significantly increased under anaerobic conditions as compared to aerobic conditions. In addition, while the deletion of crp led to a significant increase in mRNA expression in D364_RS06120, D364_RS13620, yjcC, and bcsE under aerobic conditions, there was no apparent effect on these genes under anaerobic conditions. These results suggest a divergent role of CRP in K. pneumoniae in mediating the expression of c-di-GMP related gene, D364_RS04770, with its regulatory effect being influenced by oxygen availability.

Fig. 5.

Fig. 5

Open in a new tab

The role of oxygen availability in the regulation of CRP on c-di-GMP-related genes. qRT-PCR analyses were performed to measure the expression of the GGDEF domain-containing genes (A) and the EAL domain-containing and GIL domain-containing gene (B) expressions in WT and ∆crp strains grown in LB medium under aerobic and anaerobic conditions were determined. The results are representative of three independent experiments, with error bars indicating standard deviations. Asterisk indicate significant differences between the indicated groups

Direct regulation of D364_RS04770 by CRP and its effect on type 3 fimbriae expression

To investigate whether D364_RS04770 is a direct target of CRP, we performed an EMSA. As shown in Fig. 6A, the recombinant His6-CRP protein specifically bound to the promoter region of D364_RS04770 in a dose-dependent manner, whereas no apparent binding to the PrcsA−2 DNA fragment was observed. This confirms a direct regulatory interaction between CRP and the promoter region of D364_RS04770. To further investigate the impact of D364_RS04770 on the regulatory activity of CRP in type 3 fimbriae expression under anaerobic conditions, we generated an overexpression plasmid of D364_RS04770 using the pETQ vector. This plasmid was then transferred into both WT and Δcrp strains to observe MrkA production under anaerobic conditions. As depicted in Fig. 6B, overexpression of D364_RS04770 in both WT and Δcrp strains led to an increase in MrkA production. Notably, the overexpression of D364_RS04770 in Δcrp strain resulted in a higher increase in MrkA production compared to its overexpression in the WT strain. In addition, overexpression of D364_RS04770 in the Δcrp strain compensated for the absence of crp and enhanced MrkA production under anaerobic conditions. Therefore, overexpression of D364_RS04770 in K. pneumoniae CG43S3 not only increases type 3 fimbriae expression but also compensates for the absence of crp, further elucidating the activating role of CRP on type 3 fimbriae expression under anaerobic conditions.

Fig. 6.

Fig. 6

Open in a new tab

Direct regulation of D364_RS04770 by CRP and its impact on type 3 fimbriae expression. A EMSA for CRP binding to the D364_RS04770 promoter and the DNA fragment of PrcsA−2. The indicated concentrations of purified His6-CRP protein were incubated with 10 ng of the indicated DNA fragments containing the respective promoter regions. Following incubation at room temperature for 30 min, the mixtures were analyzed on a 5% non-denaturing polyacrylamide gel containing 200 µM cAMP. The gel was stained with SYBR Green I dye and photographed. B Effect of D364_RS04770 overexpression on MrkA production. The MrkA expression of WT and ∆crp strains carrying pETQ (empty vector, C) and pETQ_04770 (04770) under anaerobic conditions was determined by Western blot analysis using MrkA antiserum. The fold change of MrkA expression was calculated using Image J software relative to the WT strain carrying the empty vector (set as 1.0) after normalization to GAPDH. Data are presented as mean ±SD from three independent experiments (n = 3)

Effect of the CRP-D364_RS04770 axis on mediating biofilm formation

To observe the impact of oxygen availability on regulation of CRP in biofilm formation, we measured the biofilm formation of WT and Δcrp strain under aerobic or anaerobic conditions. As shown in Fig. 7A, we observed a significant increase in biofilm formation in the WT strain under anaerobic conditions compared to aerobic conditions. However, while the deletion of crp led to decreased biofilm formation under aerobic and anaerobic conditions, there was no apparent effect of oxygen availability on biofilm formation in the Δcrp strain. Additionally, the complement plasmid pcrp, when introduced into the ∆crp strain, significantly increased biofilm formation compared to the empty vector under anaerobic conditions (Fig. 7B). These findings suggest that oxygen depletion triggers the regulatory role of CRP on activating biofilm formation in K. pneumoniae.

Fig. 7.

Fig. 7

Open in a new tab

The role of oxygen availability and the CRP-D364_RS04770 axis in biofilm formation. A Biofilm formation of WT and Δcrp strains in LB medium under aerobic and anaerobic conditions. B Complementation analysis of the Δcrp strain carrying the empty vector or the crp-expressing plasmid (pcrp) under anaerobic conditions. C Biofilm formation was assessed in the Δcrp strain carrying the empty vector pETQ or the overexpression plasmid pETQ_04770 under anaerobic conditions. Biofilm was visualized by staining with 0.1% safranin solution (upper panel) and quantified by measuring the absorbance at a wavelength of 492 nm (lower panel). The results are representative of three independent experiments (n = 3), with error bars indicating standard deviations (mean±SD). The asterisks indicate the significant difference between the indicated groups

To further verify whether D364_RS04770 acts as the key downstream effector of CRP in this process, we examined the overexpression effect of D364_RS04770 on biofilm formation in the Δcrp strain under anaerobic conditions. As shown in Fig. 7C, overexpression of D364_RS04770 significantly restored the biofilm formation ability of the Δcrp mutant under anaerobic conditions. This result confirms that the CRP-D364_RS04770 axis plays a pivotal role in activating biofilm formation in K. pneumoniae CG43S3.

Discussion

K. pneumoniae is recognized as the predominant pathogen in pyogenic liver abscesses in diabetic patients [1]. It exhibits higher virulence in diabetic mice compared to normal mice, indicating the significant impact of dynamic environmental cues on its pathogenesis [31]. Our study provides evidence for the biphasic role of CRP in mediating the type 3 fimbriae expression in response to oxygen availability in K. pneumoniae CG43S3. Additionally, the c-di-GMP signaling plays a crucial role in modulating this CRP-mediated expression.

The production of cAMP in bacteria has been demonstrated to correlate with environmental factors like glucose and oxygen levels [22]. Bacteria grown in glucose-supplemented conditions typically exhibit reduced cAMP production compared to those grown on non-preferred carbon sources (such as arabinose and glycerol), where cAMP levels are elevated [32, 33]. Apart from glucose, the intracellular cAMP concentration could also be affected by oxygen availability. In K. pneumoniae CG43S3, anaerobic conditions led to an increase in cAMP levels (Figure S1), similar to observations in E. coli [22]. Notably, even with the deletion of cyaA in K. pneumoniae CG43S3, which disrupts cAMP synthesis, variations in type 3 fimbriae expression still persist under aerobic and anaerobic conditions (Fig. 1B). This indicates that the relationship between cAMP levels and type 3 fimbriae expression is complex and influenced by oxygen availability, rather than directly controlled by cAMP concentration alone. In addition, how the addition of glucose under anaerobic conditions affects the formation of the cAMP-CRP complex represents an interesting question for future study. Furthermore, whether exogenous cAMP addition to the ∆crp strain could independently modulate type 3 fimbriae expression remains to be examined, which would provide direct evidence for the CRP-independent effects of cAMP signaling.

Oxygen availability affects the metabolism of carbon source such as glucose and acetate in bacteria [34, 35]. Acetyl-phosphate is an intermediate product in acetate metabolism and glycolysis and is involved in global regulation by phosphorylating or acetylating proteins and other molecules, thereby influencing various cellular processes and virulence factors expression [36, 37]. Protein acetylation is an abundant post-translational modification in bacteria to control protein structure, stability and function [38, 39]. In E. coli and Bacillus subtilis, global protein acetylation is closely associated with acetyl-phosphate level [40, 41]. In E. coli, lysine 100 (K100) of CRP has been demonstrated to be acetylated by acetyl-phosphate in acetylome analyses [40, 42]. The acetylation of K100 affects its regulatory activity [43]. Furthermore, deletion of crp led to a significant loss of global acetylation [44]. In addition, the transcription of the acetyltransferase YfiQ is regulated by CRP-cAMP [45]. It indicates the critical role of CRP in the acetylation process, which may influence target gene expression. Therefore, whether oxygen availability could affect the acetylated status and regulatory activity of CRP in K. pneumoniae to further modulate the type 3 fimbriae expression and c-di-GMP signal pathway needs to be further investigated.

Previously, we demonstrated that CRP-cAMP is an important regulator for repressing the expression of CPS biosynthesis and type 3 fimbriae in aerobically grown K. pneumoniae CG43S3 under glucose stimulus [13, 14]. However, the regulation of CRP in type 3 fimbriae expression in aerobically grown K. pneumoniae CG43S3 contrasts with that in K. pneumoniae NTUH-K2044 and STU1 strains [46, 47]. This discrepancy suggests that either other regulatory proteins or additional factors may be involved in the regulation of CRP in type 3 fimbriae in different K. pneumoniae strains. Such strain-specific differences in CRP regulation may further influence virulence potential and disease outcomes, warranting future investigation across diverse clinical isolates. In this study, we found the dual role of CRP in type 3 fimbriae is mediated through c-di-GMP levels. As described above, the mrkHIJ cluster integrates c-di-GMP signaling to regulate type 3 fimbriae expression [15–19], and its transcription is influenced by CRP in an oxygen-dependent manner. Under aerobic conditions, CRP represses the expression of these genes, resulting in reduced type 3 fimbriae production [13]. However, this repression effect is abolished under anaerobic conditions. Interestingly, while the biphasic regulation of CRP was observed in modulating the promoter activity of mrkHI and mrkJ in response to oxygen availability, the regulatory role of CRP on the mRNA levels of mrkHIJ was only evident under aerobic conditions. Whether additional post-transcriptional regulatory mechanisms contribute to controlling the mRNA levels of mrkHIJ under anaerobic conditions remains to be further investigated.

Furthermore, under anaerobic conditions, the mRNA expression of putative CRP-regulated genes containing a GGDEF domain was increased in K. pneumoniae CG43S3. Among them, overexpression of D364_RS04770 compensated for the absence of crp by restoring MrkA production and biofilm formation under anaerobic conditions, likely through the elevation of intracellular c-di-GMP levels. Consistently, our EMSA results confirmed the direct binding of CRP to the D364_RS04770 promoter (Fig. 6A), providing a mechanistic basis for the CRP-dependent expression observed. This finding underscores the importance of the intracellular concentration of c-di-GMP in influencing the regulatory role of CRP in type 3 fimbriae expression. Although a homolog of D364_RS04770 (KP1_1863) is also present in the genome of K. pneumoniae NTUH-K2044, the precise mechanism governing its biphasic regulation remains to be fully elucidated. Since CRP itself is not an oxygen sensor, the switch from repression to activation under anaerobic conditions likely involves the interplay with other oxygen-sensing transcription factors, such as FNR or ArcA. We postulate that the elevated intracellular cAMP levels under anaerobic conditions (Figure S1) might serve as a signal to trigger this cooperative regulation. Previous studies in E. coli have shown that CRP and FNR can cooperatively regulate promoters (e.g., ansB) or compete for binding sites [22]. It is possible that under anaerobic conditions, the presence of active FNR or other anaerobic regulators alters the promoter architecture or interacts synergistically with CRP, thereby converting CRP from a repressor to an activator for D364_RS04770. Future studies utilizing ChIP-seq or combinatorial mutant analysis will be necessary to dissect this complex regulatory network.

Biofilm formation in bacteria is a complex process regulated by numerous factors and dynamic environment cues [4, 48]. Resident biofilm cells express genes linked to anaerobic condition, and oxygen availability influences biofilm community dynamics and host colonization. The second messenger c-di-GMP is universally considered a critical molecule in controlling biofilm formation [4]. Our findings suggest that the increase in c-di-GMP under anaerobic conditions leads to enhanced type 3 fimbriae expression and biofilm formation. Additionally, cAMP is also another messenger that affects biofilm formation, but its role varies among different bacterial species [49]. For instance, CRP-cAMP promotes biofilm formation in E. coli and P. aeruginosa, but inhibited it in Serratia marcescens and Vibrio cholerae. In K. pneumoniae CG43S3, CRP-cAMP plays an activating role in biofilm formation under both aerobic and anaerobic conditions. Despite the biphasic role of CRP in mediating type 3 fimbriae expression in response to oxygen availability, however, many virulence factors in K. pneumoniae affect the biofilm formation, including CPS, fimbriae, and lipopolysaccharides [4]. CRP-cAMP is a strong repressor of CPS biosynthesis in K. pneumoniae CG43S3 [14]. Therefore, although MrkA expression significantly increased in the Δcrp mutant under aerobic conditions, its biofilm formation was actually reduced (Fig. 7A). This result is likely due to the capsule masking effect. Because the Δcrp mutant lacks CRP repression, it exhibits massive CPS overproduction. This abnormally thick capsule is known to physically inhibit fimbrial assembly and function [50]. Furthermore, both aerobic and anaerobic biofilm experiments were performed under static, rather than agitated, conditions. The lack of agitation significantly lowers dissolved oxygen levels, creating a microaerobic environment that could further limit actual MrkA production and further physically block the fimbriae during biofilm development. Crucially, the overexpression of D364_RS04770 successfully restored biofilm formation in the Δcrp strain (Fig. 7C) despite the high CPS background. This finding strongly suggests that the biofilm defect in the Δcrp mutant is primarily driven by the downregulation of c-di-GMP and type 3 fimbriae, rather than solely by the steric hindrance of the capsule. In addition, oxygen sensing and iron metabolism are closely linked in bacterial pathogenesis, including biofilm formation [51]. The interplay of different virulence factors in CRP regulon in K. pneumoniae pathogenesis in response to oxygen availability needs to be further investigated.

Conclusions and future outlooks

This study demonstrates for the first time that CRP exhibits biphasic regulatory activity in response to oxygen availability. Specifically, CRP acts as a repressor under aerobic conditions but surprisingly functions as an activator under anaerobic conditions. This oxygen-dependent switch in CRP function highlights a novel layer of environmental regulation that was not addressed in earlier studies focused solely on glucose and cAMP signaling. Crucially, we identified D364_RS04770 as a key downstream effector; its overexpression restored fimbriae expression and biofilm formation in the absence of crp, providing a mechanistic link between CRP regulation and c-di-GMP signaling under anaerobic conditions.

While this study focuses on the CG43S3 strain, future work should investigate whether this regulatory mechanism is conserved across diverse clinical isolates. Further research is warranted to investigate how oxygen-sensitive metabolites, particularly acetyl-phosphate, modulate CRP activity, potentially through post-translational modifications such as lysine acetylation. Integrative approaches, including transcriptomic and proteomic analyses, will be essential to map the broader regulatory networks involving CRP, cAMP, c-di-GMP, and oxygen-sensing systems. Such efforts will enhance our understanding of K. pneumoniae pathogenesis. Ultimately, elucidating how K. pneumoniae integrates metabolic and environmental signals to regulate virulence factors, including CPS, fimbriae, and biofilm formation, could uncover novel therapeutic targets within these global regulatory pathways.

Supplementary Information

Supplementary Material 1. (122.5KB, docx)
Supplementary Material 2. (304KB, ab1)
Supplementary Material 3. (304.6KB, ab1)
Supplementary Material 4. (461.7KB, pdf)

Acknowledgements

We thank Miss Pei-Ju Tsai and Miss Yi-Min Hong from School of Chinese Medicine at China Medical University for their technical assistance during the study.

Abbreviations

CPS

Capsular polysaccharides

cAMP

Cyclic adenosine monophosphate

CRP

CAMP receptor protein

c-di-GMP

cyclic diguanosine monophosphate

LB

Luria-Bertani medium

SDS-PAGE

Sodium dodecyl-sulfate polyacrylamide gel electrophoresis

qRT-PCR

Quantitative reverse-transcription polymerase chain reaction

Authors’ contributions

Tien-Huang Lin and Chen-Yu Wang performed the experimental works, interpreted the results, and drafted the manuscript. Chien-Chen Wu conceived and designed the study, directing the research question. Der-Yen Lee provided and analyzed the data about c-di-GMP and cAMP. Ching-Ting Lin supervised and directed the practical work, and wrote the draft and the final version. All authors reviewed the manuscript and approved the submitted version.

Funding

This work was supported by the grant from National Science and Technology Council (NSTC 113-2320-B-039-026 and NSTC 114-2320-B-039 -074 -MY3), China Medical University (CMU-111-MF-11), China Medical University Hsinchu Hospital (CMUHCH-DMR-111-003), and The Buddhist Tzu Chi Medical Foundation (TTCRD 111-02).

Data availability

The data and materials that support the findings of this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Tien-Huang Lin and Chen-Yu Wang contributed equally to this work.

References

  • 1.Yang YS, et al. Recurrent Klebsiella pneumoniae liver abscess: clinical and microbiological characteristics. J Clin Microbiol. 2009;47(10):3336–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sahly H, et al. Capsule impedes adhesion to and invasion of epithelial cells by Klebsiella pneumoniae. Infect Immun. 2000;68(12):6744–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lin JC, et al. High prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liver abscess. Microbes Infect. 2004;6(13):1191–8. [DOI] [PubMed] [Google Scholar]
  • 4.Li Y, Ni M. Regulation of biofilm formation in Klebsiella pneumoniae. Front Microbiol. 2023;14:1238482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Murphy CN, Clegg S. Klebsiella pneumoniae and type 3 fimbriae: nosocomial infection, regulation and biofilm formation. Future Microbiol. 2012;7(8):991–1002. [DOI] [PubMed] [Google Scholar]
  • 6.Rohmer L, Hocquet D, Miller SI. Are pathogenic bacteria just looking for food? Metabolism and microbial pathogenesis. Trends Microbiol. 2011;19(7):341–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.GreenJ, Rolfe MD, Smith LJ. Transcriptional Regulation bacterial virulence gene expression molecular oxygen and nitric oxide. Virulence. 2014;5(8):794–809. 10.4161/viru.27794. [DOI] [PMC free article] [PubMed]
  • 8.Lin TH, et al. FNR-Dependent RmpA and RmpA2 Regulation of Capsule Polysaccharide Biosynthesis in Klebsiella pneumoniae. Front Microbiol. 2019;10:2436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Sawers G, et al. Transcriptional activation by FNR and CRP: reciprocity of binding-site recognition. Mol Microbiol. 1997;23(4):835–45. [DOI] [PubMed] [Google Scholar]
  • 10.Botsford JL, Harman JG. Cyclic AMP in prokaryotes. Microbiol Rev. 1992;56(1):100–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ebright RH. Transcription activation at Class I CAP-dependent promoters. Mol Microbiol. 1993;8(5):797–802. [DOI] [PubMed] [Google Scholar]
  • 12.Cameron AD, Redfield RJ. Non-canonical CRP sites control competence regulons in Escherichia coli and many other gamma-proteobacteria. Nucleic Acids Res. 2006;34(20):6001–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lin CT, et al. CRP-Cyclic AMP Regulates the Expression of Type 3 Fimbriae via Cyclic di-GMP in Klebsiella pneumoniae. PLoS ONE. 2016;11(9):e0162884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lin CT, et al. Role of the cAMP-Dependent Carbon Catabolite Repression in Capsular Polysaccharide Biosynthesis in Klebsiella pneumoniae. PLoS ONE. 2013;8(2):e54430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wu CC, et al. Fur-dependent MrkHI regulation of type 3 fimbriae in Klebsiella pneumoniae CG43. Microbiology. 2012;158(Pt 4):1045–56. [DOI] [PubMed] [Google Scholar]
  • 16.Wilksch JJ, et al. MrkH, a novel c-di-GMP-dependent transcriptional activator, controls Klebsiella pneumoniae biofilm formation by regulating type 3 fimbriae expression. PLoS Pathog. 2011;7(8):e1002204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yang J, et al. Transcriptional activation of the mrkA promoter of the Klebsiella pneumoniae type 3 fimbrial operon by the c-di-GMP-dependent MrkH protein. PLoS ONE. 2013;8(11):e79038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tan JW et al. Positive auto-regulation of mrkHI by the c-di-GMP-dependent MrkH protein in the biofilm regulatory circuit of Klebsiella pneumoniae. J Bacteriol. 2015;197(9):1659–67. [DOI] [PMC free article] [PubMed]
  • 19.Johnson JG, Clegg S. Role of MrkJ, a phosphodiesterase, in type 3 fimbrial expression and biofilm formation in Klebsiella pneumoniae. J Bacteriol. 2010;192(15):3944–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Steinsiek S, Bettenbrock K. Glucose transport in Escherichia coli mutant strains with defects in sugar transport systems. J Bacteriol. 2012;194(21):5897–908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jeong JY, et al. Expression of ptsG encoding the major glucose transporter is regulated by ArcA in Escherichia coli. J Biol Chem. 2004;279(37):38513–8. [DOI] [PubMed] [Google Scholar]
  • 22.Kurabayashi K, et al. Cooperative Actions of CRP-cAMP and FNR Increase the Fosfomycin Susceptibility of Enterohaemorrhagic Escherichia coli (EHEC) by Elevating the Expression of glpT and uhpT under Anaerobic Conditions. Front Microbiol. 2017;8:426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Basak S, Jiang R. Enhancing E. coli tolerance towards oxidative stress via engineering its global regulator cAMP receptor protein (CRP). PLoS ONE. 2012;7(12):e51179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lai YC, Peng HL, Chang HY. Identification of genes induced in vivo during Klebsiella pneumoniae CG43 infection. Infect Immun. 2001;69(11):7140–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lin CT, et al. Homologous response regulators KvgA, KvhA and KvhR regulate the synthesis of capsular polysaccharide in Klebsiella pneumoniae CG43 in a coordinated manner. J Biochem (Tokyo). 2006;140(3):429–38. [DOI] [PubMed] [Google Scholar]
  • 26.Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol Biol. 1983;166(4):557–80. [DOI] [PubMed] [Google Scholar]
  • 27.Miller VL, Mekalanos JJ. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol. 1988;170(6):2575–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Keen NT, et al. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene. 1988;70(1):191–7. [DOI] [PubMed] [Google Scholar]
  • 29.Morgan R, et al. BdlA, a chemotaxis regulator essential for biofilm dispersion in Pseudomonas aeruginosa. J Bacteriol. 2006;188(21):7335–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lembke C, et al. Characterization of biofilm formation by clinically relevant serotypes of group A streptococci. Appl Environ Microbiol. 2006;72(4):2864–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wu JH, Tsai CG. Infectivity of hepatic strain Klebsiella pneumoniae in diabetic mice. Exp Biol Med (Maywood). 2005;230(10):757–61. [DOI] [PubMed] [Google Scholar]
  • 32.Epstein W, Rothman-Denes LB, Hesse J. Adenosine 3’:5’-cyclic monophosphate as mediator of catabolite repression in Escherichia coli. Proc Natl Acad Sci U S A. 1975;72(6):2300–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cunningham DS, et al. Pyruvate kinase-deficient Escherichia coli exhibits increased plasmid copy number and cyclic AMP levels. J Bacteriol. 2009;191(9):3041–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Thomas AD, et al. Effect of oxygen on several enzymes involved in the aerobic and anaerobic utilization of glucose in Escherichia coli. J Bacteriol. 1972;112(3):1099–105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Phue JN, Shiloach J. Impact of dissolved oxygen concentration on acetate accumulation and physiology of E. coli BL21, evaluating transcription levels of key genes at different dissolved oxygen conditions. Metab Eng. 2005;7(5–6):353–63. [DOI] [PubMed] [Google Scholar]
  • 36.Wang Q, et al. Acetylation of metabolic enzymes coordinates carbon source utilization and metabolic flux. Science. 2010;327(5968):1004–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hu LI, Lima BP, Wolfe AJ. Bacterial protein acetylation: the dawning of a new age. Mol Microbiol. 2010;77(1):15–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Carabetta VJ, Cristea IM. Regulation, Function, and Detection of Protein Acetylation in Bacteria. J Bacteriol. 2017;199(16):e00107–17. [DOI] [PMC free article] [PubMed]
  • 39.Wolfe AJ. Bacterial protein acetylation: new discoveries unanswered questions. Curr Genet. 2016;62(2):335–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Weinert BT, et al. Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli. Mol Cell. 2013;51(2):265–72. [DOI] [PubMed] [Google Scholar]
  • 41.Kosono S, et al. Changes in the Acetylome and Succinylome of Bacillus subtilis in Response to Carbon Source. PLoS ONE. 2015;10(6):e0131169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kuhn ML, et al. Structural, kinetic and proteomic characterization of acetyl phosphate-dependent bacterial protein acetylation. PLoS ONE. 2014;9(4):e94816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Davis R et al. An acetylatable lysine controls CRP function in E. coli. Mol Microbiol. 2017;107(1):116–131. [DOI] [PubMed]
  • 44.Schilling B, et al. Protein acetylation dynamics in response to carbon overflow in Escherichia coli. Mol Microbiol. 2015;98(5):847–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Castano-Cerezo S, et al. cAMP-CRP co-ordinates the expression of the protein acetylation pathway with central metabolism in Escherichia coli. Mol Microbiol. 2011;82(5):1110–28. [DOI] [PubMed] [Google Scholar]
  • 46.Panjaitan NSD, et al. EtcABC, a Putative EII Complex, Regulates Type 3 Fimbriae via CRP-cAMP Signaling in Klebsiella pneumoniae. Front Microbiol. 2019;10:1558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Luo M, et al. The KP1_4563 gene is regulated by the cAMP receptor protein and controls type 3 fimbrial function in Klebsiella pneumoniae NTUH-K2044. PLoS ONE. 2017;12(7):e0180666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Sauer K, et al. The biofilm life cycle: expanding the conceptual model of biofilm formation. Nat Rev Microbiol. 2022;20(10):608–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Liu C, et al. The Regulation of Bacterial Biofilm Formation by cAMP-CRP: A Mini-Review. Front Microbiol. 2020;11:802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Schembri MA, et al. Capsule and fimbria interaction in Klebsiella pneumoniae. Infect Immun. 2005;73(8):4626–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Guerra MES, et al. Klebsiella pneumoniae Biofilms and Their Role in Disease Pathogenesis. Front Cell Infect Microbiol. 2022;12:877995. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (122.5KB, docx)
Supplementary Material 2. (304KB, ab1)
Supplementary Material 3. (304.6KB, ab1)
Supplementary Material 4. (461.7KB, pdf)

Data Availability Statement

The data and materials that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES