Abstract
Human-induced pluripotent stem cells (hiPSCs) represent a promising cell source for cartilage regeneration because of their self-renewal capacity and chondrogenic potential. However, the propensity of hiPSC-derived chondrocytes to undergo hypertrophic maturation remains a major obstacle to generating stable articular cartilage. Here, we identified core binding factor β (CBFβ) as a critical regulator of early chondrogenic identity and a suppressor of hypertrophic transition during hiPSC-derived cartilage organoid formation. CBFβ expression was markedly diminished in degenerative articular cartilage from both human osteoarthritis (OA) specimens and mouse OA models, and cartilage-specific ablation of Cbfβ accelerated cartilage structural deterioration and matrix loss. Notably, CBFβ was secreted by non-mineralizing cells, including chondrocytes and vascular smooth muscle cells, suggesting an autocrine/paracrine regulatory role. Pharmacological inhibition with Brefeldin A reduced extracellular CBFβ levels, whereas blockade of exosome release by GW4869 had minimal effect, indicating a secretion-associated mechanism independent of exosomes. Recombinant human CBFβ (rhCBFβ) treatment enhanced the chondrocyte phenotype by upregulating early chondrogenic markers (SOX9, COL2A1) while suppressing hypertrophic and catabolic markers ( RUNX2, MMP13). In hiPSC-derived cartilage organoids, rhCBFβ enhanced matrix deposition and increased COL2A1 and SOX9 expression. Transcriptomic profiling and qRT-PCR validation further demonstrated that rhCBFβ activated cartilage matrix-associated and anti-hypertrophic transcriptional programs, including upregulation of PTHRP, HIF1α, HDAC4, MGP, CILP, and ALK5, together with suppression of RUNX2.
Collectively, these findings establish CBFβ as a key regulator of articular cartilage homeostasis and highlights its therapeutic potential for cartilage regeneration in OA. The ability of rhCBFβ to preserve early chondrogenic identity while preventing hypertrophic maturation offers a promising strategy for cartilage tissue engineering. Further preclinical studies are warranted to evaluate its efficacy and accelerate clinical translation for OA therapy.
Keywords: CBFβ, hiPSC, Chondrogenesis, Hypertrophy, Articular cartilage regeneration
Introduction
Articular cartilage is a highly specialized connective tissue that facilitates smooth joint articulation and efficient load distribution in synovial joints. However, its avascular, aneural, and alymphatic nature severely restricts intrinsic self-repair capacity, rendering it vulnerable to degeneration caused by trauma, mechanical overuse, genetic predisposition, nutritional deficits, and aging [1–4]. These factors collectively contribute to the progression of osteoarthritis (OA), a degenerative joint disease characterized by cartilage loss, matrix degradation, and structural deterioration [5–7]. Current clinical interventions, including microfracture, autologous chondrocyte implantation, and allogeneic transplantation, provide limited long-term success and frequently result in mechanically inferior fibrocartilage rather than native hyaline cartilage [8, 9]. These limitations underscore the urgent need for innovative regenerative strategies capable of restoring durable, functional cartilage.
Stem cell-based therapies have emerged as promising approaches due to their capacity for large scale expansion and chondrogenic differentiation. Among these, bone marrow-derived mesenchymal stromal cells (MSCs) remain the most extensively studied; however, MSCs-derived chondrocytes frequently undergo hypertrophic maturation, recapitulating growth plate-like chondrogenesis rather than maintaining a stable articular cartilage phenotype [10, 11]. This phenotypic drift is characterized by upregulation of hypertrophic markers, including Col10α1 and MMP13, which drive extracellular matrix (ECM) degradation and mineralization, ultimately compromising long-term cartilage function [12, 13].
Human induced pluripotent stem cells (hiPSCs) have emerged as a transformative platform in regenerative medicine, given their unlimited self-renewal and differentiation potential [14, 15]. Recent advances in three-dimensional (3D) culture technologies have enabled the generation of cartilage organoids that recapitulate key features of native cartilage tissue, including zonal organization, ECM deposition, and biomechanical properties [16]. These organoids provide physiologically relevant in vitro models for studying human chondrogenesis, disease pathogenesis, and high-throughput drug screening [17]. Moreover, hiPSC-derived cartilage holds considerable promise for transplantation-based therapies. Nonetheless, hiPSC-derived chondrocytes often exhibit hypertrophic maturation resembling transient growth plate chondrocytes rather than stable articular chondrocytes, thereby limiting their therapeutic utility [16, 17].
Core binding factor β (CBFβ), a non-DNA-binding co-transcription factor, interacts with RUNX family members to regulate gene expression crucial for skeletal development. Global Cbfβ deficiency in mice results in embryonic lethality due to cerebral hemorrhage, primarily attributable to impaired fetal hepatic hematopoiesis caused by reduced Runx1 protein stability and transcriptional activity [18, 19]. Beyond hematopoiesis, Cbfβ plays a crucial role in endochondral ossification, as demonstrated by skeletal tissue-specific deletions in mesenchymal progenitors [20, 21], chondrocytes [22, 23], and osteoblasts [24, 25]. CBFβ regulates skeletal cell fate in a context-dependent manner through its interaction with RUNX family members. During endochondral ossification, the CBFβ-RUNX2 axis promotes chondrocyte differentiation and hypertrophic maturation [26], whereas in articular cartilage, CBFβ supports cartilage homeostasis via RUNX1- and TGFβ-associated anabolic signaling. Thus, depending on cellular context and RUNX partner, CBFβ can either derive developmental chondrocyte maturation or maintain a stable articular chondrocyte phenotype [27–29]. Despite extensive studies on its role in endochondral ossification, the function of Cbfβ in hiPSC-derived chondrogenesis and cartilage organoid formation remains largely unexplored.
Given that CBFβ can favor a stable articular phenotype depending on its specific RUNX partner and signaling context, we investigated whether it could be harnessed to overcome the hypertrophic maturation of hiPSC-derived chondrocytes. Recent evidence has uncovered a novel function of CBFβ in translational regulation. Specifically, CBFβ binds to mRNAs via hnRNPK and enhances translation through eIF4B, a general translation initiation factor. Notably, RUNX1 mRNA, encoding the transcriptional partner of CBFβ, is directly bound and translationally regulated by CBFβ. In addition, the nuclear CBFβ/RUNX1 complex transcriptionally represses oncogenic NOTCH signaling in breast cancer, highlighting its multifunctional role in gene regulation [30]. Prompted by the expanding functional versatility of CBFβ beyond classical transcription, we investigated whether it could also act as an extracellular signaling molecule. In this study, we demonstrate that chondrocytes secrete CBFβ, which promotes early-stage chondrogenesis while simultaneously inhibiting hypertrophic maturation in hiPSC-derived chondrocytes, thereby providing a novel approach to generate stable, articular-like chondrocytes suitable for cartilage repair applications.
Materials and methods
Antibodies and reagents
Rabbit anti-CBFβ (#20693) and monoclonal antibodies, including anti-SOX9 (#166505), anti-RUNX2 (#390351), anti-RUNX1 (#365644), and anti-ꞵ-ACTIN (#47778) were purchased from Santa Cruz Biotechnology (CA, USA). Rabbit anti-Myc (#P/N-460603) and Rabbit anti-COL2A1 (#53047) were purchased from Abcam (MA, USA). Rabbit anti-pSMAD3 (#9520) and anti-SMAD3 (#9513) antibodies were acquired from Cell Signaling Technology (Danvers, USA). Recombinant human CBFꞵ (rhCBFꞵ) was procured from Cloud-Clone Corp (Wuhan, CN). Essential 8™ medium, vitronectin and UltraPure™ 0.5 M EDTA (pH 8.0) were purchased from Life Technologies (California, USA). STEMdiff™-ACF Mesenchymal Induction Medium, MesenCult™-ACF Plus Medium, and the MesenCult™-ACF Chondrogenic Differentiation Kit were obtained from STEMCELL Technologies (San Diego, USA).
Mice and experimental OA
All animal experiments were conducted in accordance with the guidelines established by the Institutional Animal Care and Use Committee (IACUC) of Kyungpook National University (Approval Number: KNU-2018-0020). Animals were housed in groups of five per cage in a specific pathogen-free (SPF) environment, maintained under a 12-hour light/dark cycle at a controlled temperature of 22 ± 2 °C. Standard laboratory chow (GREENPIA TECHNOLOGY, Yeoju-si, South Korea) and tap water were provided ad libitum.
Articular chondrocyte-specific Cbfꞵ deficient mice (CbfbΔac/Δac) were generated by crossing Gdf5-Cre transgenic mice (CreTg/+) with Cbfbfl/fl mice, as previously described [31, 32]. Littermate Cbfbfl/fl mice were used as controls. To assess OA progression, twelve-week-old male mice underwent bilateral destabilization of the medial meniscus (DMM) surgery. Mice were sacrificed eight weeks post-surgery, and OA-related pathological changes were assessed (n = 3/group) [33].
Human subjects
Human OA articular cartilage tissues were obtained from patients undergoing total knee arthroplasty (TKA) at Kyungpook National University Hospital. The study was conducted with the approval of the Institutional Review Board (IRB) of Kyungpook National University Hospital (IRB File No: KNUH 2022-01-010-001). Written informed consent was obtained from all participants prior to surgery, in accordance with ethical guidelines and patient confidentiality standards. Details of human cartilage sample collection are provided in Table 1. All procedures involving human tissues were conducted in adherence to the Declaration of Helsinki and local regulatory requirements governing human research.
Table 1.
Human samples
| No. | Age | Gender | ICRS Grade | Joint | Weight (kg) | Height (cm) |
RA | Others |
|---|---|---|---|---|---|---|---|---|
| 1 | 65 | F | 4 | Knee | 66 | 158 | X | heart valve disease |
| 2 | 76 | F | 4 | Knee | 71 | 155 | X | HTN, DM, unstable angina, asthma |
| 3 | 64 | M | 3 | Knee | 67 | 168 | X | HTM |
| 4 | 83 | F | 4 | Knee | 55 | 151 | X | HTN |
| 5 | 76 | F | 3 | Knee | 55 | 155 | X | HTN, DM |
| 6 | 71 | F | 4 | Knee | 70 | 159 | X | HTM, DM, AF |
F Female, M Male, ICRS International Cartilage Repair Society, RA rheumatoid arthritis, HTN hypertension, DM diabetes mellitus, AF Atrial fibrillation
Assessment of OA severity
The severity of OA was evaluated through histological analysis of the knee joint tissues. Joints were fixed in 4% paraformaldehyde (PFA) for 24 h, followed by decalcification in 10% ethylenediaminetetraacetic acid (EDTA, pH 7.4) for four weeks. Decalcified tissues were dehydrated through a graded ethanol series, embedded in paraffin, and then sectioned at a thickness of 3 μm. Histological evaluation was performed using Safranin-O staining, as previously described [34]. OA progression was scored according to the diagnostic criteria established by the Osteoarthritis Research Society International (OARSI).
Immunofluorescent staining
Tissue sections were treated with 3% hydrogen peroxide (H₂O₂) to quench endogenous peroxidase activity. Antigen retrieval was performed by boiling the sections in TEG buffer (1.211 g of Tris and 0.190 g of EGTA in 1 L of MilliQ water, pH 9.0). After cooling, sections were blocked with 1% bovine serum albumin (BSA) for 1 h at room temperature to minimize nonspecific binding.
Samples were incubated overnight at 4 °C with primary antibodies, including anti-Cbfβ, anti-Mmp13, anti-TNF-α, anti-SOX9, and anti-COL2α1. The following day, sections were incubated with FITC-conjugated secondary antibodies for fluorescent labeling, followed by DAPI staining to visualize cell nuclei. Fluorescence images were captured and analyzed using a fluorescence microscope (Leica, Wetzlar, Germany).
Cell culture
ATDC5 cells were cultured in DMEM/F12 (1:1) hybrid medium (Lonza) supplemented with 5% fetal bovine serum (FBS, Gibco BRL), 10 µg/ml human transferrin (Sigma-Aldrich), and 3 × 10− 8 M sodium selenite (Sigma-Aldrich). MC3T3E1 cells were maintained in α-MEM supplemented with 10% fetal bovine serum (FBS, Gibco BRL) and 1% antibiotics (Lonza, Rockland, ME, USA). MOVAS vascular smooth muscle cells (ATCC, VA, USA) were cultured in DMEM containing 10% FBS, 0.2 mg/ml G-418 (sigma), and 1% antibiotics. T/C-28A2 cells were maintained in DEME medium supplemented with 10% FBS and 1% antibiotics.
To examine Cbfβ secretion from different cell types, MC3T3-E1 preosteoblasts, ATDC5 chondrocytes, and MOVAS cells were seeded in 6-well plates at a density of 2 × 10 5 cells/well. Cells were transfected with 4 µg of pcDNA3.1-myc-Cbfβ plasmid using Lipofectamine 2000 (Invitrogen) and cultured for 24 h. Conditioned media (1 mL) were then collected and subjected to trichloroacetic acid (TCA, Sigma) precipitation. Briefly, TCA was added to a final concentration of 10% (v/v), samples were briefly vortexed, and the mixture was incubated on ice for 30 min. Precipitated proteins were pelleted by centrifugation at 12,000 rpm for 30 min at 4 °C and washed three times with pre-chilled acetone to remove residual TCA. Pellets were air-dried, resuspended in 2× protein loading buffer, and denatured at 100 °C for 10 min prior to SDS-PAGE analysis.
To assess the effects of recombinant human CBFβ (rhCBFβ) on the expression of chondrogenic markers, human chondrocytes (T/C-28A2) were plated at a density of 2 × 105 cells/well in 6-well plates. Following 24 h of treatment with rhCBFβ (10 ng/mL), cells were harvested for protein and total RNA extraction.
Western blot analyses
Whole-cell lysates were prepared using radioimmunoprecipitation assay (RIPA) buffer containing 10 mM Tris-HCl (pH 7.4), 0.15 M NaCl, 0.5% SDS, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 1 mM PMSF, 1 µg/mL pepstatin, and 1 µg/mL leupeptin. Protein concentrations were quantified using a Bradford protein assay kit (Bio-Rad, CA, USA). Equal amounts of protein were separated by SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 5% skim milk for 1 h and incubated overnight at 4 °C with primary antibodies. After extensive washing, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection system (GE Healthcare, USA).
Total RNA isolation and gene expression analysis
Total RNA was extracted from chondrocytes using the easy-BLUE Total RNA Extraction Kit (iNtRON Biotechnology, Seongnam-si, Gyeonggi-do, Korea). Complementary DNA (cDNA) was synthesized from 1 µg of total RNA using SuperScript II Reverse Transcriptase (Invitrogen, CA, USA). Quantitative real-time PCR (qRT-PCR) was performed using the Power SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol. Primers for qRT-PCR were designed using Primer Express software (Applied Biosystems). The specific primer sequences used in this study are listed in Table 2.
Table 2.
Primer sequences for qRT-PCR
| Target Gene | Forward Sequence | Reverse Sequence |
|---|---|---|
| ꞵ-ACTIN (human) | CACCATTGGCAATGAGCGGTTC | AGGTCTTTGCGGATGTCCACGT |
| SOX9 (human) | AGCGAACGCACATCAAGAC | GCTGTAGTGTGGGAGGTTGAA |
| COL2A1 (human) | GGAGCAGCAAGAGCAAGGAGAAG | TGGACAGCAGGCGTAGGAAGG |
| AGGRECAN (human) | CTGCTTCCGAGGCATTTCAG | CTTGGGTCACGATCCACTCC |
| COLX (human) | CGCTGAACGATACCAAATGCCC | TGGACCAGGAGTACCTTGCTCT |
| TGF-ꞵ1 (human) | TACCTGAACCCGTGTTGCTCTC | GTTGCTGAGGTATCGCCAGGAA |
| MMP13 (human) | CCTTGATGCCATTACCAGTCTCC | AAACAGCTCCGCATCAACCTGC |
Transcriptome RNA-sequencing analysis
RNA sequencing was performed on cartilage organoids treated with or without recombinant human CBFβ (rhCBFβ). Total RNA was extracted and strand-specific libraries were constructed using the MGIEasy RNA Directional Library Prep Kit, followed by paired-end 150-bp sequencing on the MGISEQ platform. Raw reads were assessed using FastQC (v0.11.5) and adapter-trimmed with Skewer (v0.2.2). Clean reads were aligned to the human reference genome (hg19) using STAR (v2.6) with strand-specific settings (fr-firststrand). Gene expression levels were quantified as FPKM using Cufflinks (v2.2.1) with bias and multi-read correction, and differentially expressed genes were identified using Cuffdiff (v2.2.1). Functional enrichment analysis of differentially expressed genes was performed using g: Profiler2 (v0.2.0) for Gene Ontology and KEGG pathway annotation.
Chondrogenesis using human iPSC-derived cells
Human iPSCs (CMC-hiPSC-009) were obtained from the Korea National Stem Cell Bank of (Korea National Institute of Health), originally provided by the NIH Center for Regenerative Medicine (NIH-CRM, U.S.). iPSCs were cultured in Essential 8™ medium on vitronectin-coated plates. Plates were pre-coated at room temperature for 2 h prior to use, and cells were maintained in Essential 8™ medium with Y-27,632 (10 µM). Cells were dissociated with EDTA at room temperature for 4 min, collected by centrifugation at 300 x g for 5 min, resuspended, and plated at 5 × 10⁴ cells/cm². On day 0, cells were induced into mesodermal progenitors using STEMdiff™-ACF mesenchymal induction medium, with daily changes for three days. On day 4, cells were transitioned to MesenCult™-ACF Plus medium, refreshed on day 5, and passaged onto six-well plates on day 6. Cells were subsequently maintained in MesenCult™-ACF Plus Medium with 10 µM Y-27,632.
Chondrogenic differentiation was performed using chondrogenic medium containing Dulbecco’s Modified Eagle Medium (DMEM; Sigma) supplemented with 1% Insulin-Transferrin-Selenium (ITS), 1% fetal bovine serum (FBS), 1 × 10−⁴ M nonessential amino acids, 1 mM sodium pyruvate, 50 U/mL penicillin and 50 mg/mL streptomycin, 50 µg/mL ascorbic acid, 10 ng/mL BMP2, 10 ng/mL TGFβ1 and 10 ng/mL GDF5 to induce chondrocyte differentiation. For cartilage organoids formation, culture plates were coated with 1% alginate mixed with chondrogenic medium prior to seeding. Cells were plated at a density of 1 × 10⁶ cells per well in 100-mm plates. The chondrogenic medium was refreshed every two days, and organoids were collected on day 40 for further analysis.
Alcian Blue staining
Cartilaginous organoids were evaluated using Alcian Blue staining. Cartilage organoids were washed three times with phosphate-buffered saline (PBS) and fixed in 4% formalin for 1 h at room temperature. Following fixation, sections were incubated with 1% Alcian Blue solution for 1 h. Excess stain was removed by rinsing sections with 0.1 M HCl, followed by washing with distilled water, as previously described [35].
Statistical analysis
All statistical analyses were performed using SigmaPlot software (version 10.0; Systat Software Inc., Chicago, IL, USA). Data are presented as the mean ± standard deviation (SD). Comparisons between two groups were conducted using the two-tailed Student’s t-test, while multiple group comparisons were analyzed by one-way analysis of variance (ANOVA) followed by appropriate post hoc testing when applicable. A p value < 0.05 was considered statistically significant.
Results
Cbfβ acts as a pivotal anabolic factor required for the maintenance of articular cartilage homeostasis
To investigate the role of Cbfβ in articular cartilage maintenance, we utilized a multi-model approach, including a surgically induced OA mouse model, human OA knee joint samples, and articular cartilage-specific Cbfβ conditional knockout mice (CbfbΔac/Δac). Immunohistochemical analysis demonstrated a significant reduction in Cbfβ expression in degenerative mouse OA joints (Fig. 1A), while immunofluorescent staining revealed elevated levels of Mmp13 and TNF-α, indicative of OA progression (Fig. 1B). Consistently, human osteoarthritic cartilage exhibited decreased CBFβ expression (Fig. 1C). Furthermore, cartilage degeneration was markedly accelerated in the CbfbΔac/Δac mice (Fig. 1D), underscoring the essential role of Cbfβ in maintaining articular cartilage integrity.
Fig. 1.
Cbfβ is essential for maintaining articular cartilage integrity. A Representative images of Safranin-O staining of knee joint sections from Sham and OA mice, along with immunohistochemical staining of Cbfβ in cartilage. The OARSI score analysis reveals significant cartilage degeneration in OA mice. Quantitative Cbfꞵ analysis of Cbfβ in Sham and OA joints cartilage (n = 3/group). Scale bars, 100 μm. B Immunofluorescent staining of TNF-α and Mmp13 in cartilage tissues from Sham and OA mice. Fluorescent intensity quantification for TNF-α and Mmp13 between Sham and OA groups (n = 3/group). Nuclei were counterstained with DAPI. Scale bars, 100 μm. C Representative Safranin-O staining and immunofluorescence for CBFβ in human osteoarthritic cartilage (OA) compared to non-OA control (Normal) cartilage. Quantification of fluorescence intensity for CBFβ in between OA and control cartilage. The OARSI score analysis reveals significant cartilage degeneration in OA knee joints (n = 6/group). Scale bars, 100 μm. D Immunofluorescent staining and Safranin-O staining of Cbfβ in WT and CbfbΔac/Δac mouse cartilage. Loss of Cbfβ in knockout mice correlates with increased matrix degradation and compromised cartilage integrity. The OARSI score analysis reveals significant cartilage degeneration in OA mice. Quantitative fluorescent intensity analysis of Cbfβ in Sham and OA joint cartilage (n = 3/group). Scale bars, 100 μm. All data are presented as mean ± SD. Statistical significance was determined using Student’s t-test, with *p < 0.05 considered statistically significant
CBFβ acts as a novel autocrine modulator of chondrocyte homeostasis
Traditionally recognized as a nuclear co-transcription factor, Cbfβ has primarily been studied for its interaction with Runx proteins [36]. However, in the present study, we observed that Cbfβ can be secreted from chondrocytes, suggesting potential autocrine and paracrine roles in maintaining cartilage integrity. Western blot analysis of conditioned media from Cbfb-myc transfected chondrocytes, osteoblasts, and vascular smooth muscle cells demonstrated robust secretion of Cbfβ in chondrocytes and vascular smooth muscle cells, whereas secretion was markedly lower in osteoblasts (Fig. 2A). To further investigate the mechanism of Cbfβ secretion in chondrocytes, cells were treated with brefeldin A (BFA) to inhibit conventional ER-Golgi-dependent secretion and with GW4869 to block exosome biogenesis and release. BFA treatment markedly reduced the level of Cbfβ detected in the conditioned medium while simultaneously increasing intracellular accumulation of Cbfβ, indicating that extracellular Cbfβ depends on a secretion-related pathway. In contrast, inhibition of exosome release with GW4869 did not significantly alter extracellular Cbfβ levels. Together, these findings suggest that extracellular Cbfβ is released through a secretion associated mechanism rather than through exosome-mediated export (Fig. 2B). To explore the biological activity of extracellular CBFβ in cartilage regeneration, we treated T/C-28A2 human chondrocytes with recombinant human CBFβ (rhCBFβ). rhCBFβ treatment significantly enhanced chondrocyte proliferation (Fig. 2C). Furthermore, qRT-PCR analysis showed increased expression of early chondrogenic markers, including RUNX1, COL2α1, AGGRECAN, and SOX9, whereas hypertrophic markers such as RUNX2 and MMP13 were suppressed (Fig. 2D). Consistently, protein levels of SOX9 and COL2A1 were increased, while hypertrophic markers, including RUNX2 and MMP13, were decreased following rhCBFβ treatment. Together, these findings suggest that extracellular CBFβ may function as a novel autocrine/paracrine modulator that supports chondrocyte phenotype maintenance and suppresses hypertrophic differentiation (Fig. 2E).
Fig. 2.
Cbfβ is secreted from chondrocytes and regulates chondrocyte homeostasis. A Western blot analysis of Cbfβ expression in both cell lysates and culture supernatants following transfection with Cbfβ-myc in osteoblast cell line MC3T3E1 (OB), chondrogenic cell line ATDC5 (Chon), and vascular smooth muscle cell line MOVAS (VSMC) cells. Cbfβ was detected in both intracellular and extracellular compartments, confirming its secretion. B ATDC5 cells were treated with brefeldin A (BFA) or GW4869 for 24 h to evaluate whether Cbfβ secretion occurs via the ER-Golgi pathway or through exosome-mediated export. Conditioned media were collected and subjected to trichloroacetic acid (TCA) precipitation. Cells were lysed in RIPA buffer to obtain total cellular protein. Both precipitated supernatants and cell lysates were analyzed by SDS-PAGE followed by transfer and Western blotting. Cbfβ was detected in both cell lysates and conditioned media, and β-actin was used as an internal loading control for cellular protein. C MTS assay demonstrating enhanced T/C-28A2 proliferation upon rhCBFβ treatment compared to untreated controls. D Quantitative real-time PCR (qRT-PCR) analysis of chondrogenic and catabolic markers in T/C28A2 treated with rhCBFβ. Expression levels of RUNX1, COL2α1, AGGRECAN and SOX9 were significantly upregulated, whereas RUNX2 and MMP13, a marker of cartilage degradation, was downregulated in the rhCBFβ-treated T/C28A2 group. Data are expressed as mean ± SD (*p < 0.05, n = 4/group). E Western blot analysis of SOX9, COL2A1, RUNX2, MMP13, and β-ACTIN expression in T/C-28A2 human chondrocytes treated with rhCBFβ. β-ACTIN was used as an internal loading control. Relative protein expression levels were quantified by using ImageJ and normalized to β-ACTIN
CBFβ maintains early chondrogenic identity and suppresses hypertrophy in hiPSC-derived chondrogenesis
hiPSCs represent a highly promising and versatile cell source for cartilage regeneration due to their self-renewal capacity and chondrogenic potential. To further evaluate the role of CBFβ in hiPSC-derived chondrogenesis, we conducted a chondrogenic differentiation using human iPSCs (Fig. 3A). The rhCBFβ-treated hiPSC-derived chondrogenic group exhibited significant resistance to hypertrophic changes and matrix mineralization compared to the control group, as demonstrated by Alcian Blue and Alizarin Red staining, respectively (Fig. 3B). In addition, rhCBFβ treatment enhanced the expression of early chondrogenic markers, including RUNX1 and SOX9, while downregulating hypertrophic markers such as RUNX2 (Fig. 3C). Consistently, qRT-PCR analysis revealed marked upregulation of SOX9, RUNX1, COL2α1, and AGGRECAN, accompanied by substantial suppression of hypertrophic markers RUNX2, MMP13, and COL10α1 (Fig. 3D). These findings underscore the capacity of CBFβ to stabilize early chondrogenic programs and inhibit hypertrophic maturation, a critical requirement for generating functional articular cartilage suitable for regenerative applications.
Fig. 3.
CBFβ enhances early chondrogenesis and suppresses hypertrophic differentiation during hiPSC-derived chondrogenesis. A Schematic representation of the chondrogenic differentiation protocol using hiPSCs and ™-ACF Mesenchymal Induction Medium, as detailed in the Materials and Methods section. Recombinant human CBFβ (rhCBFβ) was added to the culture medium on day 20, and chondrogenic differentiation was assessed on day 40. B Alcian Blue staining was used to monitor hypertrophic changes and morphological alterations in hiPSC-derived chondrocytes cultured under chondrogenic conditions, with or without rhCBFβ treatment (n = 18/group). Alizarin red staining was used to monitor the chondrocytes’ matrix mineralization (black arrow) in hiPSC-derived chondrocytes cultured under chondrogenic conditions, with or without rhCBFβ treatment (n = 3/group). Scale bar: 1 mm. C RUNX1, SOX9 and RUNX2 expression was confirmed by Western Blotting in hiPSC-derived chondrocytes with or without rhCBFβ treatment. β-Actin served as an internal control. D qRT-PCR analysis of early chondrogenic and hypertrophic markers. Expression levels of SOX9, COL2α1, and AGGRECAN were significantly upregulated, whereas COL10α1 was downregulated in the rhCBFβ-treated group. *p < 0.05, n = 4/group
Cartilaginous organoids generated under rhCBFꞵ treatment demonstrated maintenance of articular cartilage identity
Although cartilage organoids represent a promising cell-based strategy for OA therapy, their clinical application has been limited by a propensity toward hypertrophic differentiation. To overcome this limitation, we investigated whether rhCBFβ could enhance the structural and phenotypic stability of cartilage organoids. To determine whether rhCBFβ enhances phenotypic stability in hiPSC-derived cartilage organoids, we evaluated structural integrity, matrix composition, and transcriptional regulation following treatment. Gross morphological assessment revealed that rhCBFβ-treated organoids formed more compact and structurally organized organoids compared with untreated controls. Alcian Blue and Safranin O staining demonstrated markedly enhanced glycosaminoglycan and proteoglycan deposition in the rhCBFβ group, indicating improved extracellular matrix (ECM) synthesis and cartilage-like tissue formation (Fig. 4A). Safranin O staining further demonstrated significantly increased proteoglycan deposition in the rhCBFβ-treated organoids (Fig. 4B), indicating improved matrix synthesis. Immunofluorescence analysis showed robust upregulation of COL2α1 and SOX9, key markers of articular cartilage identity, in rhCBFβ-treated organoids (Fig. 4C). Collectively, these findings suggest that rhCBFβ-treated organoids maintain a stable articular chondrocyte phenotype, underscoring their potential as a promising candidate for OA patient transplantation.
Fig. 4.
rhCBFβ treated cartilage organoids exhibit enhanced articular cartilage characteristics. A Gross morphology of hiPSC-derived cartilage organoids, cultured with or without rhCBFβ treatment, confirmed via optical image and Alcian Blue staining (n = 3/group). B Histological analysis of cartilage organoids stained using Hematoxylin and Eosin (H&E) staining and Safranin O staining to evaluate tissue integrity and proteoglycan composition. C Immunofluorescence staining of cartilage organoids for COL2α1 (green) and SOX9 (red), demonstrating cartilage-specific matrix and transcription factor expression in hiPSC-derived cartilage organoids cultured with or without rhCBFβ treatment (n = 3/group). Bar: 50 μm
CBFβ promotes cartilage matrix gene expression while inhibiting hypertrophic differentiation
To further investigate downstream signaling events associated with extracellular CBFβ, we performed RNA-sequencing analysis of hiPSC-derived cartilage organoids treated with rhCBFβ. Functional enrichment analysis revealed significant upregulation of gene ontology categories related to the extracellular space, extracellular matrix (ECM) organization, and collagen-containing ECM, indicating that rhCBFβ induces a broad ECM remodeling program (Fig. 5A). Heatmap visualization and gene-level analysis demonstrated enrichment of multiple regulators known to suppress mineralization and hypertrophic chondrocyte maturation. Notably, expression of MGP, a potent inhibitor of calcification and ectopic mineral deposition, was significantly increased. In addition, CILP, which contributes to articular cartilage ECM stabilization, was upregulated following rhCBFβ treatment (Fig. 5B). Quantitative real-time PCR further validated these transcriptomic findings. Expression of the articular cartilage maintenance genes COL2α1 and CILP were significantly increased in the rhCBFβ-treated group. Importantly, hypertrophic suppressors including PTHRP, HIF1α, and HDAC4, as well as the mineralization inhibitor MGP, were markedly upregulated. In contrast, the hypertrophic driver RUNX2 was significantly decreased following rhCBFβ exposure. Interestingly, expression of TGFꞵR1 (ALK5), the canonical receptor mediating TGF-β1 signaling, was also elevated in the rhCBFβ-treated organoids, suggesting potential reinforcement of TGF-β dependent articular maintenance signaling (Fig. 5C). Protein expression of SOX9, COL2A1, and HIF-2α was increased, whereas hypertrophic markers, including RUNX2, were decreased following rhCBFβ treatment (Fig. 5D). Collectively, these transcriptomic and validation data indicate that rhCBFβ promotes a non-mineralizing, articular cartilage stabilizing ECM program while suppressing hypertrophic maturation pathways in hiPSC derived cartilage organoids.
Fig. 5.
CBFβ orchestrates cartilage homeostasis by activating matrix gene programs and restraining hypertrophic fate. A Transcriptomic profiling of chondrocytes treated with rhCBFβ. Gene ontology (GO) enrichment analysis of differentially expressed genes showing significant upregulation of cartilage development and extracellular matrix organization pathways. B Heatmap displaying representative cartilage matrix–related and hypertrophy-associated genes in control and rhCBFβ treated groups. C qRT–PCR analysis of early chondrogenic markers, hypertrophy inhibitors, and hypertrophic markers. Expression levels of COL2α1, PTHRP, MGP, HIF-1α, HIF-2α, HDAC4, RUNX2, ALK1, ALK5, and CILP were measured in organoids at day 40 of differentiation with or without rhCBFβ treatment. *p < 0.05, n = 3/group. D SOX9, COL2A1, HIF-2α and RUNX2 expression was confirmed by Western Blotting in hiPSC-derived chondrocytes with or without rhCBFβ treatment. β-Actin served as an internal control. Relative protein expression levels were quantified by using ImageJ and normalized to β-ACTIN
Discussion
In this study, we identified a novel, unconventional role of CBFβ in promoting early chondrogenesis and preventing hypertrophic maturation during hiPSC-derived cartilage differentiation. A critical bottleneck hindering the clinical translation of both MSC- and hiPSC-based cartilage tissue engineering is their inherent propensity to undergo hypertrophic maturation, which recapitulates transient growth plate-like chondrogenesis rather than maintaining a stable articular phenotype [10–13, 18, 19]. Beyond its established intracrine function in skeletal development, our findings demonstrate that CBFβ can act as an extracellular signaling molecule, serving as both an autocrine and paracrine regulator. It directly addresses this translational bottleneck by enhancing chondrocyte proliferation, driving ECM synthesis, and robustly suppressing hypertrophic maturation (Fig. 6), thereby positioning CBFβ as a promising therapeutic target for OA regeneration.
Fig. 6.
Mechanistic model of rhCBFβ in maintaining the articular chondrocyte phenotype. The diagram illustrates CBFβ as a key regulator of articular cartilage homeostasis and highlights its therapeutic potential for OA cartilage regeneration. rhCBFβ preserves early chondrogenic identity by inducing RUNX1 and SOX9, thereby enhancing COL2α1 expression (orange box), while concurrently suppressing RUNX2, which leads to downregulation of hypertrophic markers COL10α1 and MMP13 (blue box)
The observed reduction of CBFβ expression in degenerative articular cartilage from both mouse OA models and human OA samples reinforces its essential role in maintaining cartilage homeostasis (Fig. 1). This pathological decline correlated with the upregulation of Mmp13 and TNF-α, key markers associated with cartilage matrix degradation and joint inflammation [14, 15], further validating the protective, anabolic function of CBFβ. Crucially, articular cartilage-specific Cbfb conditional knockout CbfbΔac/Δac mice exhibited accelerated cartilage degradation in vivo, demonstrating that Cbfβ expression is indispensable for preserving articular cartilage structure. While previous literature has extensively documented the role of intracellular CBFβ in endochondral ossification and growth plate chondrocyte homeostasis via its physical interaction with RUNX proteins [20, 23, 24, 28], our study expands this paradigm into the context of adult articular cartilage protection and stem cell differentiation.
A particularly novel finding of this study is active secretion of CBFβ by chondrocytes, directly support our hypothesis that CBFβ functions as an extracellular signaling mediator. This finding fundamentally challenges its traditional classification as a strictly intracellular transcription cofactor. Western blot analysis verified the presence of CBFβ in the culture supernatant of Cbfb-myc transfected cells (Fig. 2A), confirming its secretory nature. To delineate the underlying secretory pathway, cells were treated with brefeldin A (BFA) to disrupt conventional endoplasmic reticulum (ER)-Golgi-mediated transport, and with GW4869 to block exosome biogenesis. BFA treatment markedly reduced extracellular CBFβ levels in the conditioned medium while causing intracellular entrapment, demonstrating that extracellular CBFβ export relies on a vesicle-associated secretory pathway [37]. Conversely, GW4869 exerted no significant effect on extracellular CBFβ levels, indicating that its release occurs via direct non-canonical transport rather than exosome-mediated shedding (Fig. 2B). Given that CBFβ lacks a classical N-terminal signal peptide, it likely utilizes an unconventional protein secretion (UPS) pathway. Reflecting on the expanding functional versatility of CBFβ such as its recently uncovered role in cytoplasmic translation al regulation via hnRNPK [32]-it is highly plausible that CBFβ possesses an unrecognized ER-targeting motif, partners with specialized chaperone-mediated co-transport machinery, or is co-secreted as part of a multi-protein passenger complex. The precise molecular machinery governing this unconventional secretion remains an intriguing avenue for future structural studies. Consistent with its proposed role as an extracellular ligand, treatment with rhCBFβ successfully activated the downstream TGF-β1/Smad3 signaling cascade, as evidenced by elevated pSmad3 expression (data not shown). Given that the TGF-β1/Smad3 pathway is a canonical driver of early chondrogenesis and articular homeostasis [29–31], extracellular rhCBFβ appears to exert its protective effects by reinforcing this anabolic cascade. Functionally, rhCBFβ treatment stimulated chondrocyte proliferation (Fig. 2C) and upregulated RUNX1, COL2A1, AGGRECAN and SOX9 expression, while concurrently suppressing RUNX2 and MMP13, the primary catabolic enzyme implicated in driving OA progression (Fig. 2D). These results indicate that extracellular CBFβ effectively reprograms the chondrocyte microenvironment from a catabolic state toward a sustainable, stable anabolic state.
This anabolic reprogramming directly overcomes the phenotypic drift that typically plagues stem cell-derived chondrocytes. As established in the Introduction, hiPSC-derived chondrocytes frequently switch toward a hypertrophic fate, leading to detrimental matrix mineralization and vascular invasion [38]. In our differentiation system, rhCBFβ treatment successfully locked cells into an early chondrogenic state, marked by the robust upregulation of critical articular markers (SOX9, COL2α1, and AGGRECAN) and the profound suppression of RUNX2, MMP13 and COL10α1 (Fig. 3D). By demonstrating that extracellular CBFβ can actively block the transition into a transient, growth plate-like phenotype, these findings resolve a long-standing limitation in regenerative cartilage engineering.
We further validated this therapeutic potential using 3D cartilage organoids, which have emerged as advanced models for studying human chondrogenesis and disease pathogenesis [18, 19]. Although 3D organoids offer physiologically relevant structural organization, their long-term utility has been heavily constrained by spontaneous, core-localized hypertrophic differentiation [39, 40]. In our study, rhCBFβ supplementation significantly improved the structural quality of these 3D constructs, yielding rich proteoglycan accumulation as confirmed by Safranin O and Alcian Blue staining, alongside elevated COL2α1 and SOX9 expression (Fig. 4A-C). Importantly, rhCBFβ preserved early articular identity throughout the organoid matrix while actively arresting hypertrophic maturation (Fig. 5A-D). These data collectively indicate that rhCBFβ-treated cartilage organoids maintain phenotypic stability and structural integrity, making them highly biomimetic candidates for functional joint resurfacing and transplantation. Although rhCBFβ-treated cartilage organoids displayed enhanced cartilage matrix deposition and preservation of articular chondrocyte markers, the present study does not include long-term culture, biomechanical testing, or in vivo transplantation experiments. Therefore, the functional durability, mechanical properties, and integration capacity of these organoids remain to be established. Future studies will be required to evaluate long term phenotypic stability, load bearing capacity, and transplantation efficacy in relevant preclinical models.
Despite these promising breakthroughs, several limitations remain to be addressed before clinical translation. First, while rhCBFβ-treated cartilage organoids exhibited excellent short-term matrix composition and phenotypic stability, this study did not evaluate long-term culture kinetics, comprehensive biomechanical properties, or in vivo durability. Longitudinal studies using large animal models are required to verify their structural integration into host articular defects under load-bearing conditions. Second, although we proved that CBFβ is secreted and modulates chondrocyte behavior via autocrine/paracrine loops, the exact cell-surface receptor and immediate downstream membrane-bound signaling partners mediating extracellular CBFβ binding remain unknown. Future screening efforts must focus on identifying these high-affinity receptors. Third, while our investigation focused strictly on articular cartilage, OA is a whole-joint disease involving reciprocal signaling with the subchondral bone and synovium [5–7]. Investigating whether extracellular CBFβ exerts protective or anti-inflammatory effects on these adjacent tissues could uncover broader therapeutic utilities. Finally, before these engineered tissues can be considered for human transplantation, their functional competency must be validated through rigorous biomechanical testing, including assessments of compressive stiffness, Young’s modulus, and friction coefficients to ensure they can withstand the demanding mechanical environment of the native joint.
Conclusion
This study identified Cbfβ as a key regulatory factor in articular cartilage homeostasis, chondrogenesis, and OA prevention. By promoting early chondrogenic characteristics, inhibiting hypertrophic maturation, and enhancing cartilage organoid matrix composition, rhCBFβ emerges as a promising therapeutic candidate for OA cartilage regeneration. Future research should focus on preclinical validation, translational optimization, and mechanistic exploration of CBFβ-based therapies to facilitate their advancement toward clinical application in regenerative medicine.
Acknowledgements
Human iPSCs (CMC-hiPSC-009) were provided by Korea National Stem Cell Bank of (Korea National Institute of Health), originally provided from NIH-CRM (U.S.).
Informed consent statement
The Institutional Review Board of Kyungpook National University Hospital approved the use of human OA cartilage, and written informed consent was obtained from all patients prior to the surgical procedure (IRB File No: KNUH 2022-01-010-001).
Abbreviations
- OA
Osteoarthritis
- DMM
Destabilization of the medial meniscus
- Cbfꞵ
Core binding factor β
- OARSI
Osteoarthritis Research Society International
- hiPSCs
Human induced pluripotent stem cells
- F
Female
- M
Male
- ICRS
International Cartilage Repair Society
- RA
Rheumatoid arthritis
- HTN
Hypertension
- DM
Diabetes mellitus
- AF
Atrial fibrillation
Authors’ contributions
Conceptualization: XC, XJ, JC. Data curation: XC, XJ, DL, EH, and MP. Formal analysis: XC, JX, DL, EH, MP, OJ, HK (Hyun-Ju Kim), HK (Hee-Jun Kim), and JC. Investigation: XC, XJ, JC. Methodology: XC, XJ, DL, EH, MP, and HK (Hyun-Ju Kim). Resources: HK (Hee-Jun Kim). Software: XC, XJ, DL, EH, MP, and OJ. Supervision: HK (Hyun-Ju Kim) and HK (Hyung-Ryong Kim). Validation: XC, XJ, JC. Visualization: XC and XJ. Writing – original draft: XC, XJ, and JC. Writing – review & editing: XC, XJ, DL, EH, OJ, HK (Hyun-Ju Kim), HK (Hee-Jun Kim), HK (Hyung-Ryong Kim), JC. XC, XJ, and JC take responsibility for the integrity of data analysis. Funding acquisition: HK (Hee-Jun Kim), HK (Hyung-Ryong Kim), and JC. Project administration: HK (Hyung-Ryong Kim), HK (Hee-Jun Kim) and JC.
Funding
This work was supported by the National Research Foundation (NRF) grant funded by the Korea government (MSIT)( RS-2023-00225239, RS-2024-00353326, NRF-2022R1A2C1006105).
Data availability
All underlying data are available to reviewers and will be publicly released following acceptance.
Declarations
Ethics approval and consent to participate
The animal study protocol was approved by the Institutional Animal Care and Use Committee of Kyungpook National University (Approval No: KNU-201455). Human OA articular cartilage tissues were obtained from OA surgery patients through total knee arthroplasty. The Institutional Review Board (IRB) of Kyungpook National University Hospital approved the use of human OA cartilage, and written informed consent was obtained from all patients prior to the surgical procedure (IRB File No: KNUH 2022-01-010-001).
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Xiangguo Che and Xian Jin contributed equally to this work.
References
- 1.Hardy JG. Articular cartilage loss is an unmitigated risk of human spaceflight. NPJ Microgravity. 2024;10(1):104–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Pueyo Moliner A, Ito K, Zaucke F, Kelly DJ, de Ruijter M, Malda J. Restoring articular cartilage: insights from structure, composition and development. Nat Rev Rheumatol. 2025;21(5):291–308. [DOI] [PubMed] [Google Scholar]
- 3.Li G, Yin J, Gao J, Cheng TS, Pavlos NJ, Zhang C, Zheng MH. Subchondral bone in osteoarthritis: insight into risk factors and microstructural changes. Arthritis Res Ther. 2013;15(6):223–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hunter DJ, Bierma-Zeinstra S. Osteoarthritis. Lancet. 2019;393(10182):1745–1759. [DOI] [PubMed]
- 5.Tang S, Zhang C, Oo WM, Fu K, Risberg MA, Bierma-Zeinstra SM, Neogi T, Atukorala I, Malfait AM, Ding C et al. Osteoarthritis. Nat Rev Dis Primers. 2025;11(1):10–31. [DOI] [PubMed]
- 6.Courties A, Kouki I, Soliman N, Mathieu S, Sellam J. Osteoarthritis year in review 2024: Epidemiology and therapy. Osteoarthritis Cartilage. 2024;32(11):1397–404. [DOI] [PubMed] [Google Scholar]
- 7.Mobasheri A, Kapoor M, Ali SA, Lang A, Madry H. The future of deep phenotyping in osteoarthritis: How can high throughput omics technologies advance our understanding of the cellular and molecular taxonomy of the disease? Osteoarthr Cartil Open. 2021;3(4):100144–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Lou Z, Bu F. Recent advances in osteoarthritis research: A review of treatment strategies, mechanistic insights, and acupuncture. Med (Baltim). 2025;104(4):e41335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Thoene M, Bejer-Olenska E, Wojtkiewicz J. The Current State of Osteoarthritis Treatment Options Using Stem Cells for Regenerative Therapy: A Review. Int J Mol Sci. 2023;24(10):8925–38. [DOI] [PMC free article] [PubMed]
- 10.Yu YH, Wang J, Li YM, Chen YS, Cui WG. Cartilaginous Organoids: Advances, Applications, and Perspectives. Adv Nanobiomed Res. 2023;3(1):n/a – n/a.
- 11.Pelttari K, Winter A, Steck E, Lorenz H, Hennig T, Aigner T, Richter W. Premature induction of hypertrophy during in vitro chondrogenesis of mesenchymal stem cells correlates with calcification and vascular invasion of ectopic transplants. Cytotherapy. 2006;8:6–6. [DOI] [PubMed] [Google Scholar]
- 12.Kronenberg HM. Developmental regulation of the growth plate. Nature. 2003;423(6937):332–6. [DOI] [PubMed] [Google Scholar]
- 13.Dong DL, Jin GZ. Targeting Chondrocyte Hypertrophy as Strategies for the Treatment of Osteoarthritis. Bioeng (Basel). 2025;12(1):77–103. [DOI] [PMC free article] [PubMed]
- 14.Lach MS, Rosochowicz MA, Richter M, Jagiello I, Suchorska WM, Trzeciak T. The Induced Pluripotent Stem Cells in Articular Cartilage Regeneration and Disease Modelling: Are We Ready for Their Clinical Use? Cells. 2022;11(3):529–55. [DOI] [PMC free article] [PubMed]
- 15.Ali EAM, Smaida R, Meyer M, Ou W, Li Z, Han Z, Benkirane-Jessel N, Gottenberg JE, Hua G. iPSCs chondrogenic differentiation for personalized regenerative medicine: a literature review. Stem Cell Res Ther. 2024;15(1):185–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hu Y, Zhang H, Wang S, Cao L, Zhou F, Jing Y, Su J. Bone/cartilage organoid on-chip: Construction strategy and application. Bioact Mater. 2023;25:29–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zeng D, Chen Y, Liao Z, Wei G, Huang X, Liang R, Lu WW, Yi D, Chen Y. Cartilage organoids and osteoarthritis research: a narrative review. Front Bioeng Biotechnol. 2023;11:1278692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Speck NA, Terryl S. A new transcription factor family associated with human leukemias. Crit Rev Eukaryot Gene Expr. 1995;5(3–4):337–64. [DOI] [PubMed] [Google Scholar]
- 19.Bae SC, Ito Y. Regulation mechanisms for the heterodimeric transcription factor, PEBP2/CBF. Histol Histopathol. 1999;14(4):1213–21. [DOI] [PubMed] [Google Scholar]
- 20.Zheng C, Zhang C, He Y, Lin S, Zhu Z, Wang H, Chen G. Cbfbeta: A key regulator in skeletal stem cell differentiation, bone development, and disease. FASEB J. 2025;39(4):e70399. [DOI] [PubMed] [Google Scholar]
- 21.Wu M, Li C, Zhu G, Wang Y, Jules J, Lu Y, McConnell M, Wang YJ, Shao JZ, Li YP, et al. Deletion of core-binding factor beta (Cbfbeta) in mesenchymal progenitor cells provides new insights into Cbfbeta/Runxs complex function in cartilage and bone development. Bone. 2014;65:49–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Park NR, Lim KE, Han MS, Che X, Park CY, Kim JE, Taniuchi I, Bae SC, Choi JY. Core Binding Factor beta Plays a Critical Role During Chondrocyte Differentiation. J Cell Physiol. 2016;231(1):162–71. [DOI] [PubMed] [Google Scholar]
- 23.Tian F, Wu M, Deng L, Zhu G, Ma J, Gao B, Wang L, Li YP, Chen W. Core binding factor beta (Cbfbeta) controls the balance of chondrocyte proliferation and differentiation by upregulating Indian hedgehog (Ihh) expression and inhibiting parathyroid hormone-related protein receptor (PPR) expression in postnatal cartilage and bone formation. J Bone Min Res. 2014;29(7):1564–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Guo T, Xing Y, Chen Z, Wang X, Zhu H, Yang L, Yan Y. Core-binding factor beta is required for osteoblast differentiation during fibula fracture healing. J Orthop Surg Res. 2021;16(1):313–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lim KE, Park NR, Che X, Han MS, Jeong JH, Kim SY, Park CY, Akiyama H, Kim JE, Ryoo HM, et al. Core Binding Factor beta of Osteoblasts Maintains Cortical Bone Mass via Stabilization of Runx2 in Mice. J Bone Min Res. 2015;30(4):715–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yoshida CA, Furuichi T, Fujita T, Fukuyama R, Kanatani N, Kobayashi S, Satake M, Takada K, Komori T. Core-binding factor beta interacts with Runx2 and is required for skeletal development. Nat Genet. 2002;32(4):633–8. [DOI] [PubMed] [Google Scholar]
- 27.Che X, Jin X, Park NR, Kim HJ, Kyung HS, Kim HJ, Lian JB, Stein JL, Stein GS, Choi JY. Cbfbeta Is a Novel Modulator against Osteoarthritis by Maintaining Articular Cartilage Homeostasis through TGF-beta Signaling. Cells. 2023;12(7):1064–78. [DOI] [PMC free article] [PubMed]
- 28.Li G, Zhang M, Huang Y, Yang J, Dong L, Shi H, Li L, Liu R, Li J. The relationship between abnormal Core binding factor-beta expression in human cartilage and osteoarthritis. BMC Musculoskelet Disord. 2021;22(1):174–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ye L, Cao Z, Tan X, Zhao C, Cao Y, Pan J. Kartogenin potentially protects temporomandibular joints from collagenase-induced osteoarthritis via core binding factor beta and runt-related transcription factor 1 binding - A rat model study. J Dent Sci. 2023;18(4):1553–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Malik N, Yan H, Moshkovich N, Palangat M, Yang H, Sanchez V, Cai Z, Peat TJ, Jiang S, Liu C, et al. The transcription factor CBFB suppresses breast cancer through orchestrating translation and transcription. Nat Commun. 2019;10(1):2071–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Rountree RB, Schoor M, Chen H, Marks ME, Harley V, Mishina Y, Kingsley DM. BMP receptor signaling is required for postnatal maintenance of articular cartilage. PLoS Biol. 2004;2(11):e355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Naoe Y, Setoguchi R, Akiyama K, Muroi S, Kuroda M, Hatam F, Littman DR, Taniuchi I. Repression of interleukin-4 in T helper type 1 cells by Runx/Cbf beta binding to the Il4 silencer. J Exp Med. 2007;204(8):1749–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Glasson SS, Blanchet TJ, Morris EA. The surgical destabilization of the medial meniscus (DMM) model of osteoarthritis in the 129/SvEv mouse. Osteoarthritis Cartilage. 2007;15(9):1061–9. [DOI] [PubMed] [Google Scholar]
- 34.Che X, Chi L, Park CY, Cho GH, Park N, Kim SG, Lee BH, Choi JY. A novel method to detect articular chondrocyte death during early stages of osteoarthritis using a non-invasive ApoPep-1 probe. Arthritis Res Ther. 2015;17:309–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Che X, Park NR, Jin X, Jung YK, Han MS, Park CY, Chun JS, Kim SG, Jin J, Kim HJ, et al. Hypoxia-inducible factor 2alpha is a novel inhibitor of chondrocyte maturation. J Cell Physiol. 2021;236(10):6963–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mandoli A, Singh AA, Jansen PW, Wierenga AT, Riahi H, Franci G, Prange K, Saeed S, Vellenga E, Vermeulen M, et al. CBFB-MYH11/RUNX1 together with a compendium of hematopoietic regulators, chromatin modifiers and basal transcription factors occupies self-renewal genes in inv(16) acute myeloid leukemia. Leukemia. 2014;28(4):770–8. [DOI] [PubMed] [Google Scholar]
- 37.Chen RH, Costa-Filho AJ, Debnath J, Galli T, Ge L, Goberdhan D, Guo W, He K, Jacob R, Kang T, et al. Beyond the Secretory Pathway: New Insights Into Protein Release. Traffic. 2025;26(10–12):e70022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Diederichs S, Klampfleuthner FAM, Moradi B, Richter W. Chondral Differentiation of Induced Pluripotent Stem Cells Without Progression Into the Endochondral Pathway. Front Cell Dev Biol. 2019;7:270–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Lamande SR, Ng ES, Cameron TL, Kung LHW, Sampurno L, Rowley L, Lilianty J, Patria YN, Stenta T, Hanssen E, et al. Modeling human skeletal development using human pluripotent stem cells. Proc Natl Acad Sci U S A. 2023;120(19):e2211510120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Hojo H, Tani S, Ohba S. Modeling of skeletal development and diseases using human pluripotent stem cells. J Bone Min Res. 2024;40(1):5–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All underlying data are available to reviewers and will be publicly released following acceptance.






