Amelioration of Fluoride Induced Toxicity by trans‐Chalcone in Zebrafish Larvae and Its Gill Cell Line: An In Vivo and In Vitro Approach

ABSTRACT

Fluoride (F−), a common environmental contaminant resulting from both natural and human activities, poses a threat to animal and human health globally. Plant‐derived phytochemicals with pharmacological properties offer promising potential for mitigating various chemical toxicants. In this study, we explored the potential benefits of trans‐chalcone (TC) in counteracting sodium fluoride (NaF) induced toxicity in zebrafish models. The cytotoxic effects of NaF (0–5 mM) and TC (0–100 μM) were evaluated in DrG cells using MTT and AB assays. The larvae and DrG cells were treated with NaF alone and in combination with TC to evaluate for ROS generation, biochemical parameters, and the mRNA expression profiles of inflammatory genes (cox‐2a, cox‐2b, tnf‐α, and il‐1β) as well as apoptotic regulatory genes (bcl‐2, bax, p53, and cas3). Mitochondrial membrane integrity in DrG cells was analyzed using rhodamine 123. Additionally, the cardiac rate and tactile response were measured in zebrafish larvae. Our results demonstrated that TC mitigated the toxic effects of NaF by modulating cellular oxidant levels, preserving mitochondrial membrane integrity, and enhancing antioxidant responses in DrG cells and larvae. Furthermore, TC restored the cardiac rate and tactile response in fluoride‐treated larvae and normalized the expression of inflammatory and apoptotic regulatory genes in response to NaF toxicity. Overall, our findings suggest that TC is a promising candidate for reducing cellular oxidant levels, inflammation, and apoptotic stress associated with NaF derived toxicity, utilizing both in vivo and in vitro approaches.

Abbreviations

AMPK

AMP‐activated protein kinase

ARE

antioxidant response element

bak

BCL2 antagonist/killer

bax

BCL2‐associated X

bcl‐2

B‐cell lymphoma 2

bcl‐xl

B‐cell lymphoma‐extra large

cas3

caspase 3

CAT

catalase

cox‐2

cyclooxygenase‐2

Cyt c

cytochrome c

DMSO

dimethyl sulfoxide

FBS

fetal bovine serum

GPx

glutathione peroxidase

GSH

reduced glutathione

H₂DCFDA

2′,7′‐dichlorodihydrofluorescein diacetate

il‐1β

interleukin‐1 beta

il‐6

interleukin‐6

il‐8

interleukin‐8

iNOS

nitric oxide synthase

Keap

Kelch‐like ECH‐associated protein 1

LPO

lipid peroxidation

MAPK

mitogen‐activated protein kinase

mcp‐1

monocyte chemotactic protein

MDA

malondialdehyde

MTT

3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide

NAC

N‐acetyl‐l‐cysteine

NaF

sodium fluoride

NF‐κB

nuclear factor kappa B

NO

nitric oxide

Nrf2

nuclear factor erythroid 2‐related factor 2

p53

tumor protein p53

ROS

reactive oxygen species

SOD

superoxide dismutase

TC

trans‐chalcone

tnf‐α

tumor necrosis factor alpha

1. Introduction

Fluoride is an inorganic element with strong electronegativity, existing in the environment as fluoride ions (F⁻). It is commonly found in nature combined with other elements, such as sellaite (MgF₂), fluorapatite [Ca5(PO₄)3F], fluorspar (CaF₂), and cryolite (Na₃AlF₆), present in soils, rocks, water, and atmospheric precipitation [1, 2]. A higher concentration of fluoride acts as a significant environmental contaminant resulting from both natural and human activities, including volcanic eruptions, mining, industrial operations, pesticides, fertilizers, and pharmaceutical products, leading to severely polluted water sources [3, 4].

Endemic fluorosis poses a significant health issue across the globe. In India, fluoride levels can reach as high as 38.5 mg/L, impacting around 60 million individuals with dental fluorosis in various states [5, 6]. Elevated fluoride concentrations were observed in the groundwater of Telangana and Tamil Nadu [7]. Industrial effluents typically contain fluoride levels of approximately 96.8 ppm/L; concentrations as high as 3000–5000 ppm/L have also been recorded [8]. Research indicates that over 200 million people in roughly 20 countries regularly consume drinking water with elevated fluoride levels [9, 10]. Both humans and animals are frequently exposed to chronic fluoride levels that surpass the WHO's recommended limit of 1.5 mg/L in drinking water [11, 12]. The intake of groundwater contaminated with fluoride leads to harmful health effects, collectively known as fluorosis [11, 12, 13].

Interestingly, moderate fluoride levels are advantageous for the development of teeth and bones. However, prolonged intake of fluoride‐contaminated water can lead to adverse health effects, including bone deformities, dental issues, nervous problems, thyroid dysfunction, and decreased fertility [14, 15]. Fluoride is primarily absorbed through mucous membranes via saliva and breast milk, after which it is deposited in the soft tissues and enters the bloodstream [16]. Studies have demonstrated that fluorosis can exacerbate the production of excess free radicals, disrupt cellular redox balance, and impair enzymatic and nonenzymatic functions [17].

Bioactive compounds extracted from plants possess pharmacological properties that show potential for treating a variety of human diseases and disorders. There is an increasing emphasis on the medicinal benefits of these phytochemicals, especially those with antioxidant properties that neutralize free radicals and help prevent diseases caused by oxidative stress. The trans‐chalcone (1–3‐diphenyl‐2‐propen‐1‐one) is a phytochemical found in plants such as Aniba riparia, Piper methysticum , and Didymocarpus corchorijolia (Table S1) [18, 19]. Numerous studies have indicated that TC, an open‐chain flavonoid, exhibits antifibrotic, antioxidant, antidiabetic, hepatoprotective, and anti‐inflammatory properties [18, 19, 20].

Zebrafish are widely used as model organisms because of their genetic similarity to humans and numerous experimental advantages such as low cost, small size, and ease of maintenance. They serve as a developmental model for research, addressing the physical and ethical challenges associated with human studies [21, 22]. Fish cell lines are well‐established in vitro models for evaluating strategies for environmental chemical risk assessment and quality monitoring [23]. Furthermore, the application of fish cell lines has advantages over whole‐organism studies, such as reduced variability, lower maintenance costs, reduced animal use, easier manipulation, and controlled experimental conditions [24].

This study aimed to determine how TC regulates fluoride‐induced toxicity in zebrafish larvae and the zebrafish gill cell line (DrG) as a model organism. We explored the intricate mechanisms of fluoride toxicity and evaluated the protective role of TC in mitigating oxidative stress, preventing apoptosis, and influencing gene expression, particularly in the pathways associated with apoptosis and inflammatory responses when exposed to fluoride. By elucidating these molecular interactions, we sought to highlight the therapeutic potential of TC and offer insights that could guide potential clinical interventions, nutraceutical development for preventing health issues related to fluoride exposure.

2. Materials and Methods

2.1. Chemicals and Reagents

NaF (Cat. no. 201 154), TC (Cat. no. 136 123), NAC (Cat. no. A9165), MTT, and H₂DCFDA were procured from Sigma‐Aldrich (St. Louis, USA); Alamar Blue, L‐15 media, FBS, Rhodamine 123, and Hoechst 33 258 were purchased from Thermo Fisher Scientific. All other chemicals used in the present study were of analytical grade.

2.1.1. Chemical Stock Preparation or Preparation of Standard Stock Solution

Stock solutions of NaF were prepared in milli‐Q water and TC in DMSO aseptically and filtered through a 0.2 μm filter. The DMSO concentration used for dilution did not exceed 0.1% in the experiments, which is a safer concentration used in most experimental studies.

2.2. Cell Culture

The zebrafish gill (DrG) cell line [25] was obtained from AAHL, C. Abdul Hakeem College, Ranipet, India. The cells were cultured under normal atmospheric conditions at 28°C in an incubator (Thermo Fisher Scientific) using Leibovitz L‐15 medium, supplemented with 10% FBS and a mixture of 100 μg/mL kanamycin and 2.5 μg/mL fungizone. The cells were tested for negative mycoplasmic contamination using Hoechst 33 258 stain (Data not shown) and harvested during the exponential growth phase for the experiments.

2.3. Cell Viability Assay

The optimum doses of NaF and TC were assessed by two end point assays, MTT and Alamar Blue, in DrG cells for 24 h. DrG cells (5 × 10³ cells per well) were seeded in 96‐well plates and incubated at 28°C overnight. Once 80% confluence was achieved, the old medium was replaced with fresh L‐15 medium containing NaF (0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, and 5 mM), TC (0, 20, 40, 60, 80, and 100 μM) alone and in combination (NaF + TC) was added separately to a 96‐well plate in triplicate, with eight technical replicates, for a duration of 24 h.

2.3.1. MTT Assay and Alamar Blue Reduction Assay

The viability of DrG cells after 24 h exposure to different concentrations of NaF, TC, or NAC was analyzed by MTT assay following the manufacturer's protocol with slight modification [26]. The purple formazan end product was then measured using a multiwell plate reader (Thermo Fisher Scientific) at 490 nm.

The cytotoxic effects of NaF and TC on the DrG cell line were evaluated after a 24‐h exposure using the AB assay following the manufacturer's instructions. Absorbance was measured using a fluorometric multiwell plate reader (Thermo Fisher) at excitation and emission wavelengths of 530 and 595 nm, respectively.

Based on MTT and AB end point assays, the EC₅₀ value of NaF and minimum optimal dose for TC and NAC were determined respectively, and experimental groups were divided into six groups as follows:

Group 1: Control	Group 2: NaF (3 mM)
Group 3: TC (50 μM)	Group 4: TC (50 μM) + NaF (3 mM)
Group 5: NAC (250 μM)	Group 6: NAC (250 μM) + NaF (3 mM)

2.3.2. Cell Morphology

DrG cells (0.5 × 10⁵ cells/mL) were exposed to above mentioned groups in 24‐well plate for 24 h and incubated at 28°C. Following a 24 h incubation, the cell morphology was observed and captured in photographs using an inverted phase contrast microscope (Carl Zeiss, Germany) at ×100 magnification.

2.3.3. LDH Assay

The toxic effect of NaF alone or paired with TC or NAC on DrG cells was assessed by quantifying lactate dehydrogenase (LDH) levels according to the methodology established by [27].

2.4. Animal Housing and Embryo Collection

AB wild‐type, adult zebrafish (4–5 months old) were obtained from fish rearing center, Kanchipuram, India. The animal was housed at 28°C ± 1°C with a standard 14/10 h light–dark cycle in the oxygenated glass tanks. Fish were fed with commercial fish diet and fresh artemia twice a day. For embryo collection, adult female and male fish (1:2) were placed in the spawning tanks at the end of the light period, and the spacer was removed early morning. Healthy embryos were collected and rinsed with E3 water (5.03 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl₂, and 0.33 mM MgSO₄) and maintained at 26°C ± 1°C in an E3 media [28]. The experimental design was ethically approved by the Institutional Animal Ethics Committee (IAEC) of C. Abdul Hakeem College, Melvisharam, India (CAHC/IAEC/Zebrafish/NaF/2024‐02).

2.4.1. Developmental Toxicity

To assess developmental toxicity, zebrafish embryos at 4 h p.f. were divided into six different groups (Section 2.3.1). The concentrations of NaF and TC were determined based on in vitro assays. The larvae (n = 10) were randomly selected and heartrate was counted for 1 min at 72 h p.f. under light microscope. The feedback of zebrafish larvae to haptic touch stimuli was qualitatively measured by touch evoked response (TER) assay as described by [21]. Larvae (n = 10) at 72 h p.f. were transferred to a 24‐well plate and allowed to acclimatize for 1 min. Each larva received three haptic stimuli at the tail using microtip and the responses were recorded.

2.5. Measurement of Intracellular ROS

The level of intracellular ROS was quantified in control and treated zebrafish larvae and DrG cells using the fluorescent probe (H₂DCFDA) [29]. At 96 h p.f., zebrafish larvae (n = 10) treated with NaF alone or paired with TC were selected randomly from each group and incubated with 20 μg/mL of H₂DCFDA dye in a dark environment for 1 h. The stained larvae were washed with ice‐cold buffer. Similarly, DrG cells (0.5 × 10⁵ cells per ml) in 24‐well plate was labeled with 10 μM H₂DCFDA for 30 min in the dark. After washing, the cells were resuspended in PBS, and images were taken using a fluorescent microscope.

2.6. Measurement of Biochemical Parameters

After treatment with NaF alone or paired with TC or NAC, the DrG cell and zebrafish larvae were washed with PBS to remove excess test solutions. The cell extract was prepared using lysis buffer (pH 7.4), and the cell lysate was centrifuged at 8000g for 10 min. Similarly, the larvae (n = 100) were pooled together with phosphate buffer (pH 7.0), and the resulting homogenate was centrifuged at 3000g for 20 min. The supernatant was subsequently used to detect various biochemical parameters, including SOD [30], CAT [31], GPx [32], and GSH [33]. Additionally, LPO [34] and NO [35] were measured according to established protocols. Total protein concentration was estimated using the method described by [36].

2.7. Rhodamine 123 Staining

The mitochondrial membrane potential (MMP) in treated DrG cells was assessed using Rh123 dye, based on the method described by [37], with slight modifications. In brief, DrG cells were seeded at a concentration of 0.5 × 10⁵ cells/mL in a 24‐well plate containing a sterile coverslip and incubated at 28°C. Subsequently, cells were exposed to NaF alone or in combination with TC or NAC and incubated for 24 h. After this period, the medium was discarded, the cells were stained with 5 μM Rh 123, and the nuclei were counterstained using Hoechst 33 258 for 30 min. The cells were then washed, resuspended in PBS, and observed under a fluorescence microscope at ×100 magnification.

2.8. Real‐Time qPCR Detection

The qPCR was performed to measure the mRNA expression levels of immune genes and apoptotic stress markers (Table 1) using the SYBR Green Premix kit (Invitrogen) Quantum Studio 5 (Applied Biosystems, USA). Total RNA was extracted from DrG cells and zebrafish larvae (n = 50) using the TRIzol reagent (Invitrogen). The concentration and purity of the isolated RNA were measured employing the Nanodrop 2000c spectrophotometer (Thermo Fisher Scientific). Subsequently, cDNA was generated from total RNA in accordance with manufacturer protocols (Invitrogen, Carlsbad, CA, USA). The reverse transcription quantitative polymerase chain reaction (RT‐qPCR) reaction mixture comprised cDNA (2 μL), SYBR Green Premix (10 μL), primers (1 μL), and 7 μL of RNase/DNase‐free water. The RT‐qPCR program included an initial denaturation phase maintained at 95°C for 5 min, followed by 40 cycles of 95°C for 20 s and 60°C for 40 s [23]. Each sample was analyzed in triplicate, and the relative quantification of gene expression for each sample was standardized against β‐actin employing ΔΔCT quantification method [41].

TABLE 1.

List of primers used in this study.

SI. no.	Gene name	Primer sequence (5′–3′)	Product size	Accession number	References
1	tnf‐α	F: CAGGACAATCGCTGAAAT R: AGACGGCTCCAAGGTAAA	303 bp	NM_001024447.1	Present study
2	il‐1β	F: CCCCAATCCACAGAGTTT R: CACAGGCTGAGCAGAAGTAG	287 bp	NM_212844.2	Present study
3	cox2a	F: GAAAGTCCACCGACGTACA R: ATTTGGGAGATCAGGCGTTG	126 bp	NM_153657.1	Abdul et al. [23]
4	Cox2b	F: GCTTTATGCTGGTTTGCTGG R: TCTGGGGAACAGATGGGATT	123 bp	NM_001025504.2	Abdul et al. [23]
5	bcl2	F: GATGGCGTCCCAGGTAGATA R: GAGTCTCTCTGCTGACCGTA	129 bp	bc133848.1	Abdul et al. [23]
6	bax	F: ATGAGCTGGATGGAAATGCG R: GGCGACAGGCAAAGTAGAAA	156 bp	NM_131562.2	Abdul et al. [23]
7	p53	F: CTATAAGAAGTCCGAGCATGTGG R: GGTTTTGGTCTCTTGGTCTTTCT	320 bp	U60804.1	Sandrini et al. [38]
8	cas3	F: CCGCTGCCCATCACTA R: ATCCTTTCACGACCATCT	129 bp	NM_131877.3	Deng et al. [39]
9	β‐Actin	F: TCACCACCACAGCCGAAAG R: TCCGCAAGATTCCAAACCC	221 bp	AF057040.1	Nathiga nambi et al. [40]

2.9. Statistical Analysis

The experimental analyses were performed in biological triplicates, and the results are expressed as the mean ± SD. Data analysis was performed using GraphPad Prism version 8.1. A simple one‐way analysis of variance (ANOVA) followed by Duncan's multiple comparison test (DMCT) was employed to normalize the differences between the control and treatment groups. The levels of significance were established at *p < 0.05, **p < 0.01, and ***p < 0.001.

3. Results

3.1. Cell Viability and Morphological Observations

DrG cells were exposed to varying concentrations of NaF (0–5 mM) for a time of 24 h, and the impact on cell viability was measured by MTT and AB assays. The EC₅₀ values of NaF were determined to be 2.95 mM (2.61–3.11; 95% lower and upper confidence limit) and 2.88 mM (2.52–3.02), respectively, for MTT and AB assays (Figure 1A). Treatment with TC or NAC alone did not cause any significant changes in the survival rate of DrG cells (Figure S1A,B). However, the optimal effective dose of TC or NAC treated along with NaF (3 mM) was established at 50 and 250 μM, respectively, through cell viability assays conducted over 24 h (Figure 1B,C). Consequently, based on these findings, a concentration of 3.0 mM NaF, 50 μM TC, and 250 μM NAC was selected for further investigation in this study.

FIGURE 1.

The cytotoxic effect of different concentrations of NaF (A), NaF + TC (B) and NaF + NAC (C) in DrG cells was assessed using MTT and AB assays at 24 h. The asterisk indicated (^a p < 0.05, ^b p < 0.01 or ^c p < 0.001) significant differences between control and treated groups (one‐way ANOVA followed by Duncan's multiple comparison test).

A noticeable level of morphological changes was seen in the cells exposed to NaF. The addition of TC to the NaF treated group prevented these morphological alterations caused by F‐toxicity in the DrG cells (Figure 2A). Furthermore, no noticeable morphological changes were observed in cells treated solely with TC. The increase in LDH levels, which signifies enzyme release into the extracellular space due to damaged or compromised cell membranes, was notably higher in NaF treated DrG cells. However, LDH leakage was significantly reduced in the group treated with TC + NaF (Figure 2B).

FIGURE 2.

(A) Protective effect of TC on NaF induced morphological changes such as cell detachment (red arrow), shrinkage (yellow arrow), cells rounded (white arrow), and (B) LDH leakage in DrG cells. The values are represented in mean ± SD of three independent experiments performed in triplicate. The asterisk indicated (**p < 0.01 or ***p < 0.001) significant different from control or NaF treated group (one‐way ANOVA followed by Duncan's multiple comparison test).

3.2. TC Restoring Heart Rate and Tactile Response in Zebrafish Larvae

The NaF exposure lowers the heart rate when compared to the control group of larvae. In contrast, the TC + NaF treatment group showed a similar heart rate to the control group (Figure 3A). Moreover, the touch response of the larvae treated with fluoride was significantly decreased. These observations indicate that a fluoride concentration of 3 mM reduces the heart rate and tactile response in zebrafish larvae. Interestingly, TC restores the touch response in fluoride‐treated larvae (Figure 3B).

FIGURE 3.

Protective effect of TC on NaF induced developmental impairment of zebrafish larvae (A) heart rate and (B) touch response. The values are represented in mean ± SD (three independent experiments performed in triplicate). The asterisk indicated (*p < 0.05 or **p < 0.01) significant difference from control or NaF treated group (one‐way ANOVA followed by Duncan's multiple comparison test).

3.3. TC Reducing Cellular Stress Against NaF

To assess intracellular ROS levels triggered by NaF, the fluorescence intensity of the DCF‐DA dye was measured in DrG cells and larvae. After 24 h of exposure, both DrG cells and larvae exhibited a marked increase in ROS production in the NaF treated groups. Conversely, the group treated with TC + NaF displayed relatively less oxidative damage in DrG cells and larvae. Treatment with TC alone did not cause any changes in ROS levels (Figure 4A,B). Similarly, the data shown in (Figure 5A,B) indicate a significant increase in LPO and NO levels in NaF treated DrG cells and larvae. However, TC + NaF treatment significantly reduced LPO and NO levels in NaF treated cells and larvae compared to the NaF group. Treatment with TC alone showed no significant difference in LPO and NO levels compared to the control.

FIGURE 4.

Protective effect of TC on NaF induced ROS generation in zebrafish larvae (A), DrG cells (C) and respective relative fluorescent intensity (B and D). The values are represented as mean ± SD of three independent experiments performed in triplicate. The asterisk indicated (**p < 0.01 or ***p < 0.001) significant differences from control or NaF treated group (one‐way ANOVA followed by Duncan's multiple comparison test).

FIGURE 5.

Alleviatory effect of TC on NaF induced oxidant level in zebrafish larvae and DrG cells (A) MDA and (B) NO level. The values are represented in mean ± SD of three independent experiments performed in triplicate. The asterisk indicated (*p < 0.05 or **p < 0.01) significant difference from control or NaF treated group (one‐way ANOVA followed by Duncan's multiple comparison test).

3.4. TC Restoring the Antioxidant Level Against NaF

The modulatory effects of TC on antioxidant levels (SOD, CAT, GPx, and GSH) were evaluated in both control and experimental groups. In DrG cells and larvae exposed to NaF, the levels of antioxidants were significantly reduced (Figure 6A–D). However, the TC + NaF‐treated group showed a significant increase in levels of SOD, CAT, GPx, and GSH, indicating its potential to maintain an antioxidant balance against NaF (Figure 6A–D). No differences were observed in the levels of antioxidants between the control and TC‐treated groups of DrG cells and larva.

FIGURE 6.

Mitigatory effect of TC on NaF induced antioxidant response in zebrafish larvae and DrG cells. (A) SOD, (B) CAT, (C) GPx, and (D) GSH. The values are represented in mean ± SD of three independent experiments performed in triplicate. The asterisk indicated (*p < 0.05 or **p < 0.01) significantly different from control or NaF treated group (one‐way ANOVA followed by Duncan's multiple comparison test).

3.5. TC Restores the Mitochondrial Function Against NaF Exposure

The MMP and bioenergetics of NaF treated cells were assessed using the fluorescent probe Rh123. The fluorescence strength of NaF treated cells was significantly lower than that of the TC + NaF treated group (Figure 7). The diminished intensity of the mitochondria represents the degree of apoptosis owing to the loss of membrane potential in the NaF treated group. Treatment with TC alone exhibited no alterations compared to the control.

FIGURE 7.

Regulatory effect of TC against NaF induced mitochondrial dysfunction. Representative image of DrG cells labeled with Rh123 and counterstained with Hoechst 33258 (A) and respective relative fluorescent intensity (B). The values are represented in mean ± SD (three independent experiments performed in triplicate). The asterisk indicated (*p < 0.05, **p < 0.01 or ***p < 0.001) significant different from control or NaF treated group (one‐way ANOVA followed by Duncan's multiple comparison test).

3.6. TC Modulates the mRNA Levels of Inflammatory and Apoptotic Genes

RT‐PCR was used to evaluate the mRNA expression levels of inflammatory and apoptosis genes. In the NaF treated group, a significant upregulation was observed in inflammatory genes including cox‐2a, cox‐2b, tnf‐α, and il‐1β (Figure 8A–D) compared to controls in both DrG cells and embryos. In contrast, NaF treatment with TC group substantially attenuated the expression of mRNA compared to the NaF group. The expression level of mRNA of bax, p53, and cas3 genes was significantly increased in the NaF treated group, whereas bcl‐2 expression level was significantly downregulated in DrG cells and embryos (Figure 9A–D). However, the bax, p53, and cas3 genes of the NaF treated with TC group showed decreased levels of mRNA expression, while the bcl‐2 mRNA expression level was upregulated significantly (Figure 9A–D). Moreover, treatment with TC alone showed no significant changes in level of mRNA expression compared to the control.

FIGURE 8.

TC modulates NaF induced inflammatory gene response in zebrafish larvae and DrG cells. (A) cox2a, (B) cox2b, (C) tnf‐α, and (D) il1‐β. The values are represented in mean ± SD of three independent experiments performed in triplicate. The asterisk indicated (*p < 0.05, **p < 0.01 or ***p < 0.001) significant different from control or NaF treated group (one‐way ANOVA followed by Duncan's multiple comparison test).

FIGURE 9.

TC modulates NaF induced apoptotic regulatory genes levels in zebrafish larvae and DrG cells. (A) bcl2, (B) bax, (C) p53, and (D) cas3. The values are represented in mean ± SD of three independent experiments performed in triplicate. The asterisk indicated (*p < 0.05, **p < 0.01 or ***p < 0.001) significant different from control or NaF treated group (one‐way ANOVA followed by Duncan's multiple comparison test).

4. Discussion

Fluoride is a major groundwater contaminant spread across the globe and is a serious threat to both aquatic and terrestrial ecosystems. Higher doses of fluoride exposure are linked to cellular redox imbalance, increasing ROS production and suppression of the antioxidant defense mechanism, leading to cell death [42]. The studies on the application of phytochemicals in mitigating the detrimental effect of F‐toxicity are restricted due to limited experimental data.

Previous experimental evidence suggests that increase in concentration for individuals treated with fluoride is clearly lower the viability of cells exposed at concentrations of ranges from 0.5 to 5 mM in various cell lines (SH‐SY5 Y, A549 and Neuro‐2 A) [43, 44, 45]. In our present study, a reduction in DrG cells viability was observed for NaF at concentrations above 1.0 mM, with an EC₅₀ of 2.95 and 2.88 mM for MTT and AB assays, respectively, at 24 h. However, studies have reported that fluoride exhibits cytotoxic effects at concentrations of 0.12 mM on primary mouse hippocampal neuron cells [46]. The viability of the cell decreases in a dose and time‐dependent manner. This 3.0 mM NaF concentration is comparable to levels found in heavily contaminated groundwater in endemic areas [5, 6] and in industrial effluents [8], which can range from 96.8 mg/L to as high as 3000–5000 mg/L. The cell viability assays (MTT and AB) show that a 50 μM concentration of TC restores the survival rate against F‐toxicity without any adverse effects. The cell morphological changes induced by NaF were prevented by administration of TC in DrG cells (Figure 2A). Similarly, Unsal et al. [18] reported that a 40 μM concentration of TC restores the survival rate against arsenic toxicity using TC in the 3T3 embryonic cell line.

In recent years, zebrafish have been extensively used as a vertebrate model to investigate human cardiovascular and neuroglial diseases [47]. NaF dose of 335.75 mg/L causes severe deformities, morphological changes and cardiotoxicity when exposed to zebrafish embryos for 96 h which is approximately 8 mM concentration [48]. Cardiomyocytes, the primary consumers of molecular oxygen, are vulnerable to ROS‐mediated oxidative tissue injury due to their oxygen demand. High NaF concentrations have been linked to decreased cardiac output, heart block, and arrhythmias [49]. Touch‐evoked swimming relies on chemical synaptic inputs, which are primarily dependent on neurotransmitters. This means that acetylcholine and acetylcholinesterase (AChE) play a more major part in the formation of TER [50]. Experimental study shows fluoride exposure influence on the cholinergic system and associated locomotor deficits which are linked to brain AChE expression [51]. In our study, a decrease in the level of cardiac rate and response to touch was observed in the fluoride‐treated group. Recently Wang et al. [48] have reported fluoride‐induced cardiac dysfunction in zebrafish larvae. Moreover, larvae treated with TC have alleviated the heart rate and tactile response against fluoride‐derived toxicity. However, the current study did not directly measure AChE; the observed improvements in tactile response are a strong functional indicator of neuroprotection and warrant future specific investigations into the impact of TC on the cholinergic system and AChE expression to solidify this neurological impact.

Several in vitro and animal studies have reported that F− exposure significantly increases ROS levels [44, 52]. The overproduction of ROS in response to fluoride (F–) exposure has an impact not only on cell functions but also on various organ systems, resulting in the oxidation of cellular macromolecules, which causes tissue damage [17]. In this present study, we found elevated levels of ROS generation in NaF treated cells and larvae, which correlates with the earlier in vitro and animal studies [44, 53, 54]. The antioxidant nature of chalcone by neutralizing the free radical and its ability to donate hydrogen atoms, thereby reducing oxidative stress [55]. Similarly, our results show the protective effect of TC on oxidative stress by mitigating the detrimental effects against NaF induced toxicity.

F– has the ability to cross the cell membrane and accumulate into the cells by interfering critical metabolic processes, resulting in cellular damage by affecting enzyme function and protein synthesis [42, 56]. Fluoride poisoning enhances ROS accumulation by inhibiting antioxidant enzymes' activity like SOD, CAT, and GPX. Excessive ROS generation causes macromolecule oxidation, resulting in phospholipid membrane damage through the induction of lipid peroxidation [42, 57]. In our study, we observed decreased levels of antioxidants (SOD, CAT, GPx, and GSH) and elevated levels of LPO and NO in F– treated DrG cells and larvae. F− interacts with metal ions, such as Mg²⁺, located in the active site of enzymes, thereby inhibiting their activity. Studies show that higher F– concentration decreased the enzyme activities of SOD, CAT, and GPx in zebrafish [19], Wistar albino rat [58], and A549 cells [44].

Several studies have revealed the protective effect of antioxidant phytochemicals against oxidative stress, which is ascribed to their ability to limit the generation of ROS by scavenging free radicals and regulating proapoptotic signals [59]. Interestingly, the TC treated groups show considerable modulation in the levels of antioxidants (SOD, CAT, GPx, and GSH) and reduced MDA and NO levels against the F– toxicity. This suggests that TC protects the cell from F– induced free radical damage and maintains cellular homeostasis by balancing antioxidant levels. Similarly, TC reduced the cellular damage against arsenic exposure by lowering the extracellular lactate dehydrogenase activity, reactive oxygen species, and upregulating antioxidative enzyme levels in the 3T3 embryonic cell line [18].

Although recent investigations into phytochemicals such as esculin [54] and mangiferin [60] mitigate fluoride‐induced toxicity, this effect is often attributed to direct free‐radical scavenging. However, our findings suggest a more potent mechanism that works further upstream. trans‐Chalcone is an α,β unsaturated carbonyl compound, which makes it a “Michael acceptor.” This structure allows chalcones to react with and modify cysteine residues on the Keap1 protein, and release of Nrf2. This free Nrf2 then travels into the cell's nucleus, where it binds to the ARE. This binding switches on a wide range of protective genes, including those for detoxification, antioxidant defense, anti‐inflammation, and clearing damaged proteins [61, 62]. We observed not only a reduction in ROS but, more importantly, a significant restoration of endogenous antioxidant enzyme levels (SOD, CAT, GPx, and GSH). This robust activation of the cell's own defense machinery is a hallmark of the Keap1/Nrf2‐ARE signaling pathway.

Excessive ROS production leads to the attack of membrane phospholipids by free radicals, causing lipid peroxidation and mitochondrial membrane depolarization [63]. Intracellular ROS generation induced by fluoride impacts both the MMP and the mitochondrial permeability transition pore (MPTP). The opening of MPTP results in the release of cytochrome c, which activates caspase proteins, leading to proteolysis through cell apoptosis [17, 42]. Numerous mitochondrial metalloproteins, including respiratory complexes I–IV and F‐ATPase, have been associated with fluoride inhibition [52, 64, 65]. Our findings indicate that mitochondrial membrane integrity was significantly compromised, and caspase activity was increased in the NaF‐treated group. Fluoride diminishes mitochondrial activity, hinders cellular respiration, and causes leakage of free radicals and cytochrome c, ultimately leading to cell apoptosis [11, 66, 67]. According to previous reports, addition of antioxidants will prevent the apoptotic stress induced by fluoride toxicity [19, 44]. Interestingly, the addition of TC with NaF remarkably restores mitochondrial function and alleviates caspase activity in DrG cells.

Increased levels of ROS caused by F– toxicity trigger downstream cellular pathways such as MAPK, AMPK, NF‐κB, and Nrf2 [68]. NF‐κB plays a crucial role in cellular responses to various stressors and pathogen‐derived signals as well as in regulating the expression of proinflammatory cytokines [62, 66]. The activation of these proteins results in the production of several inflammatory mediators, including il‐1β, il‐6, il‐8, mcp‐1, and cox‐2 [11, 69, 70]. TNF‐α is a proinflammatory cytokine that stimulates the release of various interleukins, such as il‐1β, il‐6, and il‐8, and enhances the expression of inducible iNOS, which subsequently generates NO [60]. Our results show TC has an anti‐inflammatory effect which normalizes the expression of inflammatory genes (cox‐2a, cox‐2b, tnf‐α, and il‐1β) in zebrafish larvae and its gill cells against fluoride‐derived toxicity, which agrees with the previous report [18]. Therefore, we hypothesize that TC's protective effect is not merely passive (scavenging radicals) but active; it modulates the Nrf2 pathway to “pre‐condition” the cells and enhance their intrinsic resilience to fluoride‐induced oxidative stress. This specific, Nrf2‐mediated activity would also explain the potent downstream anti‐inflammatory effects we observed; specifically, the normalization of cox‐2a, tnf‐α, and il‐1β as the Nrf2 and NF‐κB inflammatory pathways are extensively cross‐regulated [66]. While our study did not measure Nrf2 activation directly, the comprehensive restoration of the antioxidant enzyme profile provides strong evidence for this specific mechanism, differentiating TC from general antioxidants and warranting future investigation.

Fluoride is known to trigger an intracellular apoptotic signaling cascade regulated by Bcl‐2 family proteins, which consist of both proapoptotic (bax and bak) and antiapoptotic (bcl‐2, bcl‐xl) members [60, 71]. An experimental study demonstrated that mouse ameloblast‐derived cell line (LS8) treated with sodium fluoride upregulated the gene expressions of cas9, cas3, and bax. An in vitro and in vivo study demonstrated that downregulation of bcl‐2 gene expression leads to apoptosis, indicating that fluoride also triggers apoptosis through an intrinsic pathway [57, 72]. In the present study, the mRNA level of bcl2 gene was downregulated, whereas the expression of bax, p53, and casp3 was elevated in fluoride treated groups. Interestingly, NaF treated along with TC group showed reduced expression level of apoptotic stress genes in both DrG cells and zebrafish larvae. Similarly, mangiferin treatment significantly lowered the expression of the proapoptotic protein bax, while simultaneously increasing the levels of the antiapoptotic protein bcl‐2. Furthermore, mangiferin successfully counteracted the NaF‐induced rise in caspases 3 and 9 levels in human neuroblastoma SHSY5Y cells [20].

5. Conclusion

In conclusion, the present study indicates the protective role of TC against NaF‐induced toxicity on DrG cells and zebrafish larvae models. A survey of literature shows that this is the first study unraveling the molecular mechanisms involved in the protective effect of TC on experimental fluoride toxicity. Our results show the antioxidant effect of TC by scavenging free radicals and maintaining the antioxidant enzyme levels. Furthermore, TC normalizes the expression level of inflammatory and apoptotic genes against fluoride toxicity. Our findings suggest that TC is a promising candidate which has antioxidant, anti‐inflammatory, and antiapoptotic effects against fluoride‐derived toxicity. A more comprehensive study involving molecular approaches and clinical trials is necessary to confirm the potential of this compound as a promising therapeutic agent against fluorosis.

Author Contributions

Mohamed Jaffer Abdul Wazith: conceptualization, investigation, methodology, and writing – original draft. Gani Taju: supervision, conceptualization, validation, formal analysis, and writing – review and editing. Seepoo Abdul Majeed: data curation, methodology, and validation. Venkatesan Rajkumar: resources and formal analysis. Sivaraj Mithra: data curation and formal analysis. Kumaraswamy Kanimozhi: resources. Sathar Zaheer Ahmed: formal analysis. Azeez Sait Sahul Hameed: supervision, project administration, and funding acquisition.

Funding

This work was supported by the Department of Biotechnology, Ministry of Science and Technology, India (BT/PR40452/NDB/39/750/2020, BT/PR41899/AAQ/3/1006/2021).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: The cytotoxicity of different concentration of TC (A) and NAC (B) in DrG cells was determined by MTT and AB assays at 24 h. No significant difference was observed between control cells and treated groups.

Table S1: Physicochemical properties of trans‐chalcone.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.