Neuroprotective role of Lactiplantibacillus plantarum C10-derived SCFAs: a functional food approach targeting gut-brain-axis disruption in rotenone-induced Parkinson's disease in-vivo in adult zebrafish

Abstract

Introduction

Parkinson's disease (PD) is a progressive neurodegenerative disorder characterized by dopaminergic neuronal degeneration, oxidative stress, neuroinflammation, and gut microbiota dysbiosis. Increasing evidence highlights the role of the gut-brain axis (GBA) and probiotic-derived short-chain fatty acids (SCFAs) in modulating neuroinflammation and disease progression. This study investigated the neuroprotective potential of SCFAs produced by Lactiplantibacillus plantarum C10 in a rotenone-induced PD zebrafish model.

Methods

SCFA-producing lactic acid bacteria were isolated from traditionally fermented cabbage (sauerkraut), and the most promising isolate was identified as L. plantarum C10 using morphological, biochemical, phylogenetic, and 16S rRNA gene sequencing analyses. Fermentation conditions were optimized to maximize SCFA production, and the metabolites were characterized using Fourier-transform infrared spectroscopy (FTIR) and high-performance liquid chromatography (HPLC). Antioxidant activity was evaluated using DPPH and ABTS assays. Developmental toxicity was assessed in zebrafish embryos, followed by therapeutic evaluation in rotenone-induced adult zebrafish through behavioural, biochemical, molecular, and histopathological analyses.

Results

L. plantarum C10 exhibited strong probiotic characteristics, including antimicrobial activity, acid and bile tolerance, homofermentative metabolism, and extracellular polysaccharide production. Optimized fermentation significantly enhanced SCFA-associated metabolite production, while FTIR and HPLC confirmed the presence of fermentation-derived organic acid metabolites. The metabolites demonstrated potent antioxidant activity and showed minimal developmental toxicity up to 30 mg/mL in zebrafish embryos. In the rotenone-induced PD model, C10-derived SCFAs restored antioxidant enzyme activities, reduced oxidative stress, improved locomotor and cognitive performance, modulated genes associated with neuronal function, inflammation, the NRF2 signalling pathway, intestinal barrier integrity, and gut microbiota, and preserved normal brain and intestinal histoarchitecture.

Discussion

These findings demonstrate that L. plantarum C10-derived SCFA metabolites exert antioxidant, anti-inflammatory, and neuroprotective effects through modulation of the gut-brain axis. This study highlights the potential of probiotic-derived SCFAs as functional food-based therapeutic candidates for managing Parkinson's disease and associated gut dysbiosis.

Highlights

• Gut microbiota dysbiosis and reduced SCFA levels are key contributors to Parkinson's disease progression.

• Lactiplantibacillus plantarum C10 isolated from fermented cabbage will be optimized for enhanced SCFA production.

• Cell-free SCFA extracts will exhibit antioxidant activity.

• SCFAs may alleviate rotenone-induced Parkinsonian deficits by modulating the gut-brain axis, oxidative stress, inflammation, and neuroprotective pathways in adult zebrafish.

1. Introduction

Parkinson's disease (PD) is a chronic and progressive disorder of the central nervous system (CNS) characterized by the selective degeneration of dopaminergic neurons in the substantia nigra pars compacta (1, 2). This degeneration results in a deficiency of dopamine, leading to impaired motor control and classic symptoms such as resting tremor, muscle rigidity, bradykinesia, and postural instability (3, 4). However, PD is not limited to motor dysfunction, non-motor symptoms also significantly impact patients' quality of life (5). Among these, gastrointestinal disturbances, particularly constipation, often emerge years before the onset of motor symptoms, indicating early involvement of the enteric nervous system (6, 7). Increasing evidence suggests that alterations in gut microbiota composition and microbial metabolite production contribute to immune dysregulation and neuroinflammation (8, 9). These findings strongly support the critical role of the gut-brain axis (GBA) in the initiation and progression of PD.

Current therapeutic approaches for PD are primarily focus on managing symptoms rather than modifying disease progression (10). The cornerstone of treatment is levodopa, which acts as a precursor to dopamine and helps replenish depleted dopamine levels in the brain (11). It is commonly administered in combination with carbidopa to prevent the peripheral metabolism of levodopa and enhance its availability in the CNS (12). This combination significantly improves motor symptoms, especially in the early stages of the disease. Patients often experience marked relief from tremors, rigidity, and bradykinesia following the initiation of therapy (10, 13). However, the beneficial effects of levodopa tend to decline over the long term with many patients developing motor complications such as wearing-off phenomena and on-off fluctuations (11, 14). Dyskinesia, characterized by involuntary movements, is another common adverse effect associated with prolonged therapy. Additionally, some individuals experience psychiatric side effects, including hallucinations and mood disturbances. Other classes of medications, such as dopamine agonists and MAO-B inhibitors, are also used but they provide limited long-term neuroprotection (15, 16). Importantly, these pharmacological treatments do not prevent the progressive loss of dopaminergic neurons. They primarily address dopamine deficiency without targeting neuroinflammation, oxidative stress, or mitochondrial dysfunction. As a result, the underlying pathological processes continue despite symptomatic improvement (17, 18). This limitation underscores the urgent need for alternative or adjunctive therapeutic strategies that can modify disease progression (19). Consequently, emerging research is increasingly focusing on novel approaches that address GBA dysfunction and neuroprotective mechanisms in PD.

Lactic acid bacteria (LAB) and probiotic-based interventions have garnered significant attention as potential therapeutic strategies for restoring gut microbiota balance in neurodegenerative disorders (20). LAB are beneficial microorganisms that help maintain intestinal homeostasis by inhibiting pathogenic bacteria and promoting the growth of commensal microbes (21). Probiotics derived from LAB enhance the integrity of the intestinal epithelial barrier by strengthening tight junction proteins and reducing gut permeability, which helps prevent the translocation of endotoxins and inflammatory mediators into systemic circulation (22). Additionally, LAB modulate both innate and adaptive immune responses by regulating cytokine production and suppressing pro-inflammatory signaling pathways. Through the production of bioactive metabolites, including short-chain fatty acids (SCFAs), probiotics can influence neuronal signaling and immune regulation (23, 24). By reducing systemic and neuroinflammation, LAB indirectly protect dopaminergic neurons from inflammatory damage (25). These mechanisms collectively support improved communication along GBA. As gut dysbiosis is increasingly recognized as a contributing factor in PD progression, probiotic interventions may help correct microbial imbalances (26, 27). Moreover, probiotics are considered safe, cost-effective, and suitable for long-term dietary supplementation. Therefore, LAB-based functional approaches represent a promising adjunct strategy for mitigating neurodegenerative processes associated with PD (28). Several probiotic strains have been investigated for their potential role in PD through modulating gut microbiota composition, inflammation, and GBA signaling (29). Among these, Lactiplantibacillus plantarum has been widely studied for its antioxidant, anti-inflammatory, and neuroprotective properties (30). Other lactic acid bacteria, including Lactobacillus rhamnosus, Lactobacillus casei, Lactobacillus acidophilus, and Bifidobacterium longum, have also demonstrated beneficial effects in experimental and clinical studies by improving gastrointestinal function, modulating microbial communities, and regulating inflammatory pathways. Furthermore, multi-strain probiotic formulations have shown potential to alleviate constipation and improve selected non-motor symptoms in PD patients (31, 32). These findings support the growing interest in probiotic-derived SCFA metabolites as potential modulators of PD-associated gut dysbiosis and neuroinflammation.

SCFAs, primarily acetate, propionate, and butyrate, are microbial metabolites generated through the fermentation of dietary substrates by beneficial gut bacteria. Increasing evidence suggests that SCFA concentrations are altered in PD and may contribute to disease progression by affecting on intestinal barrier integrity, immune regulation, neuroinflammation, and GBA communication (33). Reduced abundance of SCFA-producing bacteria and decreased fecal SCFA levels have been reported in many PD cohorts. Experimental studies indicate that SCFAs may influence microglial activation, oxidative stress responses, and epithelial barrier function; however, their effects appear to be context-dependent and may vary according to metabolite type, concentration, disease stage, and experimental model (34, 35). Consequently, the restoration of beneficial microbial metabolites has emerged as an area of growing interest in PD research.

Although SCFAs are generally considered beneficial metabolites, their biological effects in PD are increasingly recognized as context-dependent. Emerging evidence suggests that individual SCFAs, including acetate, propionate, and butyrate, may exert distinct physiological and immunological effects depending on their concentration, duration of exposure, disease stage, and host microbiota composition (36). While several studies have demonstrated that SCFAs enhance intestinal barrier integrity, reduce neuroinflammation, and support neuronal survival, other reports indicate that excessive SCFA levels or altered SCFA signaling may contribute to immune activation under certain experimental conditions (37). Furthermore, differences among animal models, microbial communities, and clinical populations may influence the observed outcomes. Therefore, the role of SCFAs in PD remains complex and requires careful evaluation of individual metabolites and disease-specific contexts. Understanding these factors is essential for developing effective microbiota-based therapeutic interventions targeting the GBA (32, 38).

Recent research has increasingly focused on probiotic-derived SCFA metabolites as promising candidates for managing PD. These approaches emphasize the use of bioactive microbial products and postbiotic metabolites that modulate gut microbial balance, intestinal barrier integrity, immune responses, and GBA signaling. Such metabolite-based interventions represent a potentially safe and non-invasive strategy for targeting mechanisms associated with neurodegeneration and gut dysbiosis (39–41). These approaches emphasize the use of beneficial probiotic strains that produce bioactive metabolites such as acetate, propionate, and butyrate. By enhancing SCFA production, researchers aim to correct metabolic deficiencies associated with gut dysbiosis in PD patients (32). Functional foods enriched with probiotic LAB are being investigated for their long-term safety and therapeutic potential. Such strategies target the GBA, a key pathway linking gastrointestinal health with neurodegeneration. Restoring SCFA levels may improve intestinal barrier integrity and reduce systemic inflammation. This reduction in peripheral inflammation can subsequently lower neuroinflammatory responses in the brain (42–44). Additionally, SCFAs have been shown to regulate immune signaling and oxidative stress pathways, and these metabolites may also influence neurotransmitter synthesis and mitochondrial function. Dietary modulation of the gut microbiota is considered a non-invasive and sustainable therapeutic approach (45, 46). Unlike conventional drugs, functional foods may offer additional benefits without severe side effects. Research is increasingly focusing on the strain-specific efficacy of probiotics for targeted metabolite production. Preclinical and clinical studies are assessing their effects on behavioral and molecular outcomes in PD models (41, 47, 48). Overall, probiotic-derived SCFAs represent a novel and integrative approach to addressing both gastrointestinal dysfunction and neuroinflammation in PD pathology.

The present study investigates the neuroprotective potential of SCFAs derived from L. plantarum C10 in a rotenone-induced PD model using adult zebrafish. Rotenone is employed to mimic PD-like neurodegeneration, oxidative stress, and motor impairments. The research evaluates the antioxidant capacity of the SCFA extract, as well as its effects on locomotor behavior and motor coordination. Biochemical and molecular analyses are conducted to assess oxidative stress markers, inflammatory cytokines, and neuroprotective gene expression. Histopathological examinations of brain and gut tissues further determines structural preservation following treatment. Overall, this study aims to explore a probiotic-derived functional strategy targeting GBA for potential management of PD.

2. Material and methods

2.1. Chemical used

Sodium chloride (NaCl; CAS no: 7647-14-5), hydrochloric acid (HCl; CAS no: 7647-01-0), hydrogen peroxide (H₂O₂; CAS no: 7722-84-1), methanol (CAS no: 67-56-1), ethyl acetate (CAS no: 141-78-6), potassium persulfate (CAS no: 7727-21-1), and dimethyl sulfoxide (DMSO; CAS no: 67-68-5) were purchased from Sigma-Aldrich (St. Louis, MO, USA). de Man, Rogosa, and Sharpe (MRS) agar and broth, nutrient agar (NA), phenol red indicator, proteose peptone, beef extract, yeast extract, dextrose, ammonium citrate, sodium acetate, magnesium sulfate, manganese sulfate, dipotassium phosphate, and agar were purchased from HiMedia Laboratories Pvt. Ltd. (Mumbai, India). Ferric chloride (FeCl₃; CAS no: 7705-08-0), ammonium sulfate (CAS no: 7783-20-2), ammonium carbonate (CAS no: 506-87-6), peptone, tryptophan (CAS no: 73-22-3), fructose (CAS no: 57-48-7), lactose (CAS no: 63-42-3), maltose (CAS no: 69-79-4), sucrose (CAS no: 57-50-1), starch (CAS no: 9005-25-8), inulin (CAS no: 9005-80-5), and fructo-oligosaccharide (FOS) were obtained from SRL Chemicals (Sisco Research Laboratories Pvt. Ltd., India). Nitro blue tetrazolium (NBT; CAS no: 298-83-9), riboflavin (CAS no: 83-88-5), L-methionine (CAS no: 63-68-3), reduced glutathione (GSH; CAS no: 70-18-8), 5,5′-dithiobis-(2-nitrobenzoic acid; DTNB; CAS no: 69-78-3), 1-chloro-2,4-dinitrobenzene (CDNB; CAS no: 97-00-7), thiobarbituric acid (TBA; CAS no: 504-17-6), trichloroacetic acid (TCA; CAS no: 76-03-9), Griess reagent, 2,2-diphenyl-1-picrylhydrazyl (DPPH; CAS no: 1898-66-4), and 2,2′-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid; ABTS; CAS no: 30931-67-0) were purchased from Sigma-Aldrich and SRL Chemicals. Tris-HCl buffer, potassium chloride (KCl; CAS no: 7447-40-7), Ethylenediaminetetraacetic acid (EDTA) (CAS no: 60-00-4), acetylcholine iodide (CAS no: 2260-50-6), and Bradford reagent were used for biochemical analyses. RDP Trio™ Reagent (SKU: MB566) was procured from HiMedia Laboratories, and AURA 2 × One-Step Reverse transcription polymerase chain reaction (RT-PCR) Master Mix (ABT-18S) was purchased from Aura Biotechnologies Pvt. Ltd., India. All glassware used in the study was purchased from Borosil^®, and 96-well Enzyme-linked immunosorbent assay (ELISA) plates were procured from Thermo Fisher Scientific (Waltham, MA, USA).

2.1.1. Sauerkraut fermentations

Fresh cabbage (Brassica oleracea var. capitata) was sourced from a local market in Chennai, India (13.0843° N, 80.2705° E). The samples were thoroughly washed, and the outer leaves were removed to minimize contamination. The cabbage was rinsed with sterile, cooled water and then shredded into small pieces. Approximately 350 g of shredded cabbage was submerged in a 3% (w/w) sterile sodium chloride solution in within a sterile container and allowed to ferment at 37 °C for 45 days under semi-anaerobic conditions. The container was loosely covered to restrict air entry. The pH was monitored periodically to ensure acidic conditions conductive to LAB growth. Conditions, such as high salt concentration, 70% moisture, and limited aeration, were maintained to promote LAB fermentation (49).

2.1.2. Isolation and identification of LAB

LAB were isolated using de Man, Rogosa, and Sharpe (MRS) agar medium which consisted of the following components (gL⁻¹): proteose peptone (10.0), beef extract (10.0), yeast extract (5.0), dextrose (20.0), polysorbate 80 (1.0), ammonium citrate (2.0), sodium acetate (5.0), magnesium sulfate (0.1), manganese sulfate (2.0), dipotassium phosphate (12.0), and agar (12.0), with a pH of 7 ± 1. After fermentation, 1 ml of the sample was serially diluted up to 10⁻³, and 100 μl from the appropriate dilution was aseptically spread onto MRS agar plates, which were then incubated at 37 °C for 48 h. Colonies were enumerated and expressed as cell-free supernatant (CFS)/ml. The same dilution series was also plated on nutrient agar (NA) to determine total bacterial load (49, 50). All procedures were conducted under aseptic conditions, utilizing sterilized media and glassware, with plating performed in a laminar airflow cabinet. Uninoculated media served as negative controls to monitor contamination. Pure cultures were obtained through repeated subculturing and were confirmed by consistent colony morphology and Gram staining. For SCFA production, sterile MRS broth was inoculated with 2% (v/v) of a 24-h-old culture (10⁸ CFU/ml) and incubated at 37 °C while shaking at 140 rpm. Bacterial growth was monitored by measuring optical density at 600 nm, followed by centrifugation at 5,000 rpm for 30 min to obtain the cell-free supernatant, which was used as the crude source of SCFA for further analysis.

2.1.3. Antimicrobial activity by agar diffusion method

The antimicrobial activity of the bacterial isolates was evaluated against Staphylococcus spp (HiMedia TKC030). and Pseudomonas spp (HiMedia TKC031) obtained from the Department of Microbiology, Saveetha Medical College, Chennai, using the agar well diffusion method. Briefly, overnight cultures of the test pathogens were prepared, and 100 μl of each culture was uniformly spread onto sterile NA plates to create a confluent bacterial lawn. After that, wells were aseptically punched using a sterile 200 μl pipette tip, and 20 μl of cell free supernatant (CFS) from the isolates was dispensed into each well. Ampicillin (1 mg/ml) served as the positive control, with 20 μl added to a separate well. The plates were incubated at 37 °C for 24–48 h, after which the zones of inhibition were measured in millimeters. The isolate exhibiting the largest inhibition zone was considered to have the highest antimicrobial activity and was selected for further identification and characterization.

2.1.4. Screening and identification of isolate

• A. Morphological analysis for SCFA-producing isolates

Morphological characteristics of the isolates, including cell size (length and width), shape, and cell count, were determined through micrometry, Gram staining and colony morphology analysis according to standard protocols. For preliminary screening of SCFA-producing isolates, colonies were grown on MRS agar and assessed for growth characteristics and acidification. The isolates were then inoculated into MRS broth supplemented with appropriate carbon sources (e.g., glucose or prebiotic substrates) and incubated at 37 °C for 24–48 h. SCFA production was initially inferred from a reduction in pH and confirmed through analysis of the CFS obtained after centrifugation. Potential SCFA-producing isolates were selected for further quantitative analysis using chromatographic techniques (51).

• B. Biochemical analysis

The biochemical characterization of the isolates involved evaluating catalase activity, gas production, bile salt tolerance, acid tolerance, and carbohydrate fermentation profiles to assess their metabolic capabilities.

• Catalase test

Catalase activity was assessed by placing a small amount of the bacterial isolate on a clean glass slide, followed by the addition of a drop of 3% hydrogen peroxide (H₂O₂). The immediate formation of bubbles indicated a positive catalase reaction, while the absence of bubbles confirmed a negative result (52).

• Gas production

Gas production was assessed to differentiate between homofermentative and heterofermentative LAB. MRS broth was adjusted to pH levels of 2, 4, and 7 and supplemented with 1% (w/v) carbohydrates. Selected isolates were inoculated into the medium, which contained inverted Durham tubes and incubated at 37 °C for 48 h with shaking at 140 rpm. Gas production was indicated by the presence of air bubbles in the Durham tubes (53).

• Acid tolerance

The acid tolerance of the isolates was evaluated by inoculating 1 ml of overnight culture (10⁸ CFU/ml) into 10 ml of MRS broth adjusted to different pH levels (2, 4, and 7). The cultures were incubated at 37 °C for 24 h with shaking at 140 rpm. Bacterial growth under varying acidic conditions was assessed by measuring the optical density at 600 nm using a spectrophotometer (54).

• Bile salt tolerance

The bile salt tolerance of the isolates was evaluated by inoculating them into MRS broth supplemented with 0.3%, 0.5%, and 0.7% (w/v) bile salts. The cultures were then incubated at 37 °C for 24 h while shaking at 140 rpm. Bacterial growth was assessed by measuring optical density at 600 nm using a spectrophotometer and was compared to control cultures grown in MRS broth without bile salts (54).

• Carbohydrate utilization

Carbohydrate utilization by the isolates was assessed to determine their fermentation profiles. MRS broth containing phenol red as an indicator, was individually supplemented with 1% (w/v) of various carbohydrates, including glucose, sucrose, lactose, maltose, fructose, and galactose. The medium was inoculated with the selected isolate and incubated at 37 °C for 24–48 h. A color change in the medium resulting from acid production, indicated carbohydrate fermentation. Additionally, the presence of lactic acid in the fermented broth was confirmed using the ferric chloride assay (55).

• C. Molecular analysis

Preliminary screening based on colony morphology, Gram staining, and biochemical characterization indicated that isolate C10 has potential for SCFA production. The selected isolate C10 was further identified through 16S rRNA gene amplification and sequencing. Genomic DNA was extracted using a bacterial DNA purification spin column kit and quantified. The 16S rRNA gene (1,500 bp) was amplified using universal primers F27 (5′-AGAGTTTGATCMTGGCTCAG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′). PCR amplification was performed in a 25 μl reaction mixture containing PCR master mix, template DNA (50–100 ng), forward and reverse primers (10 μM each), and nuclease-free water. The amplification conditions included an initial denaturation at 94 °C for 5 min, followed by 34 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1.5 min, and a final extension at 72 °C for 7 min. The amplified products were analyzed by electrophoresis on a 1% agarose gel in 1 × Tris–borate–EDTA (TBE) buffer and visualized using a gel documentation system (56, 57).

• D. Phylogenetic analysis

Sequencing files were edited using CHROMASLITE (version 1.5; Technelysium Pty Ltd., Headquarters: South Brisbane, Queensland, Australia) and subsequently analyzed with the Basic Local Alignment Search Tool (BLAST), retrieving closely related sequences from the National Center for Biotechnology Information (NCBI) database. BLAST was employed to identify regions of local similarity between sequences (58) and to compare nucleotide or protein sequences against database entries, enabling the evaluation of statistically significant matches. This approach facilitates the identification of related sequences and the inference of functional and evolutionary relationships. The analysis commenced with a BLASTN search to identify closely related type strain sequences (58), followed by pairwise alignment to determine sequence similarity between the query and reference sequences. The top five to 10 closest matches for each isolate were recorded (59). Additionally, multiple sequence alignment and phylogenetic analysis were conducted to ensure accurate species identification and establish evolutionary relationships (60, 61).

2.1.5. Optimization of fermentation conditions for SCFA production

Fermentation parameters influencing SCFA production were systematically optimized by evaluating the effects of incubation period, carbon and nitrogen sources, pH, and bile salt concentration. The selected isolate was cultured under varying conditions, and SCFA production was assessed from the cell-free supernatant. Optimal conditions were determined based on the maximum SCFA yield and bacterial growth.

• Effect of incubation period

The effect of incubation time on bacterial growth was evaluated by inoculating the C82 isolate into MRS broth and incubating it at 37 °C for varying durations ranging of 24 to 120 h under both static and shaking conditions (140 rpm) (62).

• Effect of carbon sources

The effect of different carbon sources on SCFA production by isolate C10 was evaluated by supplementing MRS broth with 1% (w/v) of various carbohydrates, including sucrose, starch, maltose, lactose, dextrose, fructose, inulin, and fructo-oligosaccharides (FOS). Additionally, FOS and inulin were tested at concentrations ranging from 1 to 6%. The cultures were incubated at 37 °C for 72 h with shaking at 140 rpm (63). A 1% carbon concentration was chosen to ensure sufficient fermentable substrate for active metabolism and SCFA production while minimizing the risk of substrate inhibition or osmotic stress (64).

• Effect of nitrogen sources

The influence of various nitrogen sources on SCFA production by isolate C10 was evaluated by culturing the strain in MRS broth supplemented with 0.1% (w/v) of different nitrogen sources, including ammonium sulfate, ammonium carbonate, ammonium ferrous sulfate, tryptophan, peptone, and a mixture of branched-chain amino acids (leucine, valine, and isoleucine in a 1:1:1 ratio). The cultures were incubated at 37 °C for 72 h (63). A concentration of 0.1% nitrogen source was chosen to maintain an optimal carbon-to-nitrogen balance, which supports metabolic activity and enhances SCFA production while preventing excessive biomass accumulation (65).

• Effect of pH

The effect of pH on SCFA production by isolate C10 was evaluated by inoculating the strain into MRS broth adjusted to different pH levels (2, 4, 6, 8, and 10). The cultures were incubated at 37 °C, and bacterial growth was monitored to assess both pH-dependent viability and its influence on SCFA production (66, 67).

• Effect of bile salt

The effect of bile salt on SCFA production by isolate C10 was evaluated by culturing the strain in MRS broth supplemented with varying concentrations of bile salts (0.1%−0.6%). The cultures were incubated at 37 °C, and bacterial growth was monitored to assess tolerance under bile stress and its influence on SCFA production (67, 68).

2.1.6. SCFAs from L. plantarum C10 using liquid-liquid extraction

The extraction of SCFAs produced by isolate C10 was optimized based on solvent efficiency and acidification conditions. Briefly, C10 was cultured in MRS broth, and the cell-free supernatant was obtained by centrifugation at 10,000 rpm for 10 min followed by filtration through a 0.22 μm membrane. Before extraction, the supernatant was acidified to a pH of 2–3 using 5 N HCl to enhance SCFA recovery. Among commonly used organic solvents, ethyl acetate was selected for extraction due to its superior efficiency in recovering SCFAs. The acidified sample was mixed with ethyl acetate in a 1:2 (v/v) ratio and vigorously vortexed for 10–15 min to ensure proper phase interaction. The mixture was then centrifuged to facilitate phase separation, and the upper organic layer was carefully collected. To improve extraction yield, this process was repeated twice, and the combined organic phases were dried over anhydrous sodium sulfate to remove residual moisture. The dried extract was subsequently concentrated and used for further gas chromatography (GC) analysis. All extraction steps were performed under controlled conditions to minimize variability and ensure reproducibility of SCFA recovery from the C10 culture supernatant (69).

• a. Characterization of (C10) SCFA

The functional group characterization of metabolites produced by isolate C10, particularly SCFAs, was conducted using Fourier-transform infrared (FTIR) spectroscopy. Extracted and lyophilized SCFA samples were analyzed in attenuated total reflectance (ATR) mode using Nicolet™ iS10 FTIR spectrometer (Thermo Fisher Scientific, USA). The instrument was equipped with a deuterated triglycine sulfate (DTGS) detector and a SMART iTR™ sampling accessory. Spectral data were recorded in transmittance mode over a wavenumber range of 4,000–500 cm⁻¹ with a resolution of 4 cm⁻¹. Prior to analysis, samples were dried to eliminate residual solvents and moisture. The resulting spectra were used to identify characteristic functional groups associated with SCFAs, including carboxyl (–COOH) and aliphatic chain vibrations, thus confirming the presence of organic acid metabolites produced by isolate C10 (70).

• b. HPLC analysis of SCFA metabolites produced by L. plantarum C10

HPLC analysis was conducted using a reverse-phase HPLC system equipped with a photodiode array (PDA) detector set to 254 nm. Separation was achieved using a C18 analytical column maintained at ambient temperature. The mobile phase comprised of acidified ultrapure water and acetonitrile under isocratic elution conditions at a flow rate of 1.0 ml/min. The total chromatographic run time was 60 min, and the injection volume was set at 20 μl. Chromatographic peaks were recorded based on retention time and peak area. Because authentic SCFA standards were not included in this study, chromatographic peaks were interpreted as fermentation-derived organic acid metabolites rather than definitively identified as acetate, propionate, or butyrate (71).

• i. Antioxidant activity

• a) DPPH radical-scavenging activity

The antioxidant potential of SCFAs produced by isolate C10 was assessed using a modified DPPH radical-scavenging assay. Various concentrations of the SCFA extract (1.0, 2.0, 3.0, 4.0, 6.0, and 8.0 mg/ml) were mixed with a 0.02% (w/v) DPPH solution prepared in methanol and incubated at room temperature for 30 min in the dark. The absorbance was then measured at 517 nm. The percentage of DPPH radical-scavenging activity was calculated using the following equation:

$$\begin{array}{l}\mathrm{\text{DPPH radical}}-\mathrm{\text{scavenging activity}}(\%)\end{array}$$

$$\begin{array}{l}=\frac{({\mathrm{\text{A}}}_{\mathrm{\text{control}}}+{\mathrm{\text{A}}}_{\mathrm{\text{blank}}}-{\mathrm{\text{A}}}_{\mathrm{\text{sample}}})}{{\mathrm{\text{A}}}_{\mathrm{\text{control}}}}*100\end{array}$$ (1)

where A_control represents the absorbance of methanol instead of the sample, A_blank corresponds to the absorbance of the sample without DPPH, and A_sample denotes the absorbance of the sample with DPPH. Ascorbic acid was used as a positive control. All experiments were performed in triplicate (72).

• b) ABTS radical-scavenging activity

The ABTS radical-scavenging activity of SCFAs from isolate C10 was determined using a modified method. The ABTS radical solution was prepared by mixing equal volumes of 7 mM ABTS and 2.4 mM potassium persulfate, followed by incubation in the dark at room temperature for 16 h. Subsequently, 500 μl of SCFA extract at varying concentrations (0.5, 1.0, 2.0, 4.0, 6.0, and 8.0 mg/ml) was mixed with 1 ml of the ABTS radical solution and incubated for 10 min in the dark at room temperature. The absorbance was measured at 734 nm. A blank was prepared using distilled water instead of the ABTS solution, and the control contained ABTS solution with distilled water in place of the sample. Ascorbic acid was used as a reference standard. The ABTS radical-scavenging activity (%) was calculated using the same formula as described for the DPPH assay (73).

• ii. In vivo developmental toxicity studies

• a. Housing and maintenance of zebrafish (Danio rerio) and embryo collection

Adult zebrafish (Danio rerio) were obtained from a local fish supplier in Manimangalam, Chennai (“Latitude: N 12° 5′1, Longitude: E 80° 2′29”). The fish were kept in a 19 L transparent aquarium under controlled laboratory conditions at 28.5 °C with a photoperiod of 14 h of light and 10 h of darkness. They were fed live Artemia salina (brine shrimp) three times daily. After a 20 day acclimatization period, breeding was conducted using two separate mating pairs, each consisting of one male and one female, in spawning tanks equipped with a mesh base to prevent egg predation. Fertilized eggs were collected within 30 min after the onset of light, washed with freshly prepared E3 medium, and incubated at 26 ± 1 °C until further use, following OECD (2013) guidelines (74, 75). Adult zebrafish (Danio rerio) of both sexes, aged 3–4 months, were used for the rotenone-induced Parkinson's disease model. Fish were randomly distributed among experimental groups and maintained under identical environmental conditions throughout the study to minimize experimental bias and behavioral variability (76).

• b. Determination of C10 SCFA toxicity in the zebrafish model

Zebrafish embryos at 4 h post-fertilization (hpf) were transferred to 12-well culture plates, with 10 embryos per well (n = 30 per group). The embryos were exposed to various concentrations of C10 SCFA (1, 5, 10, 15, 20, 25, 30, 35, and 40 mg/ml). Fresh exposure solutions were renewed every 24 h, ensuring consistent concentrations throughout the experiment. Each treatment was conducted in triplicate. Embryonic development and morphological changes were monitored periodically under a microscope at 4 × magnification (77, 78).

2.1.7. Therapeutic evaluation of C10 SCFA in a rotenone-induced PD zebrafish model

To develop a PD model in zebrafish, a stock solution of rotenone was prepared by dissolving 1 mg of rotenone in 2 ml of dimethyl sulfoxide (DMSO). An initial dose optimization study was conducted using three concentrations (1, 2, and 4 μg/L). Based on observed survival rates, behavioral changes, and toxicity responses, 2 μg/L rotenone was selected as the optimal concentration for PD induction and was used throughout the 21-day experimental period (79). A vehicle control was maintained using aquarium water containing an equivalent concentration of DMSO to eliminate any solvent-related effects. The study included four groups: Group I (Control): consisted of untreated zebrafish, Group II (Rotenone) included zebrafish exposed to rotenone (2 μg/L); Group III (Rotenone + Standard) comprised zebrafish treated with rotenone along with levodopa (25 mg/L) (80) and Group IV (Rotenone + SCFA C10) involved zebrafish treated with rotenone along with C10 SCFA (30 mg/L). Oral administration of the metabolite extract was carried out once daily for 21 consecutive days during rotenone exposure to evaluate its neuroprotective effects (79, 81). A vehicle control containing an equivalent concentration of DMSO was maintained to exclude solvent-related effects. For each group, nine zebrafish were allocated for behavioral assessments, three pooled samples (each comprising six fish) were used for biochemical analyses, six fish were designated for gene expression studies, and nine fish were utilized for histopathological examination. After the treatment period, three independent biological replicates were prepared for each experimental group. Fish samples (n = 2/group for biochemical assays) were homogenized in ice-cold Tris-HCl buffer (100 mM, pH 7.8 at 4 °C) containing 150 mM potassium chloride and 1 mM EDTA. The homogenates were centrifuged at 10,000 rpm for 15 min, and the supernatants were collected for further analyses. Protein concentration was determined using Bradford's assay, and all biochemical experiments were performed in triplicate (73).

• i. In vivo antioxidant studies

• a) Experimental groups and treatment

Adult zebrafish were randomly divided into four experimental groups: Group 1 (control), Group 2 (rotenone-treated), Group 3 (rotenone + levodopa-treated), and Group 4 (rotenone + SCFA-treated; 30 mg/ml). SCFA was orally administered for 21 consecutive days to evaluate its neuroprotective potential against rotenone-induced toxicity. After the treatment period, zebrafish samples (n = 2/group) were homogenized in ice-cold 100 mM Tris-HCl buffer (pH 7.8 at 4 °C) containing 150 mM potassium chloride and 1 mM EDTA for enzymatic assays. The homogenates were centrifuged at 10,000 rpm for 15 min, and the resulting supernatants were collected for further biochemical analyses. Total protein concentration was determined using Bradford's method, and all experiments were conducted in triplicate.

• b) Estimation of superoxide dismutase (SOD) activity

SOD activity was assessed using a reaction mixture composed of 50 mM phosphate buffer (pH 7.8), 100 μM EDTA, 750 μM nitro blue tetrazolium (NBT), 130 mM methionine, and 20 μM riboflavin. Following this, 50 μl of the sample homogenate was added, and the mixture was exposed to light for 20 min. The absorbance was then measured at 560 nm (82).

• c) Estimation of catalase (CAT) activity

Catalase activity was assessed by adding 50 μl of the sample to 100 μl of a hydrogen peroxide solution prepared in buffer. The decrease in absorbance was monitored at 240 nm over a period of 2 min, with measurement taken at 15-s intervals using a spectrophotometer, following a standard protocol (83).

• d) Estimation of reduced glutathione (GSH) and glutathione S-transferase (GST) activity

To estimate GSH and GST levels, we prepared a reaction mixture containing 20 mM DTNB, 150 μl of 100 mM potassium phosphate buffer (pH 7.4), 10 μM reduced glutathione (GSH), and 60 μM 1-chloro-2,4-dinitrobenzene (CDNB). The homogenate was then added to this mixture, and absorbance readings were recorded at 412 nm and 340 nm, respectively (84).

• e) Lipid peroxidation (LPO) assay

Lipid peroxidation was quantified by measuring malondialdehyde (MDA) levels using the thiobarbituric acid (TBA) method. In brief, 100 μl of homogenate was mixed with 0.1 ml of 5% trichloroacetic acid and incubated on ice for 15 min. Following this, 0.2 ml of 0.67% thiobarbituric acid was added, and the mixture was heated in a boiling water bath at 100 °C for 30 min. After rapid cooling on ice for 20 min, samples were centrifuged at 2,000 rpm for 10 min at 4 °C, and absorbance was measured at 535 nm (78).

• f) Nitric oxide (NO) assay

Nitric oxide levels were determined using the Griess reagent method with minor modifications. Briefly, 100 μl of Griess reagent was added to the homogenized sample, which was then incubated at room temperature for 25 min. The absorbance was measured at 540 nm (85).

• ii. Gene expression study

Total RNA was isolated from adult zebrafish (n = 6 per group) using RDP Trio™ Reagent, following the manufacturer's instructions. Gene-specific primers were designed using the NCBI Primer-BLAST (Table 1). Quantitative gene expression analysis was performed using AURA 2 × One-Step RT-PCR Master Mix. Reverse transcription was conducted at 44–50 °C for 15 min, followed by an initial denaturation at 95 °C for 3 min to activate the polymerase. Amplification was proceeded for 40 cycles, which included denaturation at 95 °C for 10 s, annealing at 60 °C for 45 s, and extension at 72 °C for 15 s. Relative gene expression levels were calculated using the 2^−ΔΔCt method. All reactions were performed in technical triplicates for each biological replicate to ensure accuracy and reproducibility (86).

Table 1.

Primer sequence used in the real-time PCR analysis.

S.no	Primer type	Forward	Reverse	Accession number
1.	DRD2a	AGTGCCGTAAACCCAATC	GTATCATTTCCATCCCTTTCTG	NM_183068.1
2.	Th2	CTCCAGAAGAGAATGCCACATG	ACGTTCACTCTCCAGCTGAGT	XM_005164734.5
3.	Claudin 5a	GGTCATCTCCTCGGTCTTGA	GCACCTGCGGGTTATAGAAG	NM_213274.1
4.	IL10	CTTTAAAGCACTCCACAACCCCAA	CTTGCATTTCACCATATCCCGCTT	NM_001020785.2
5.	TNF-α	TCTCAGGGCAAGAAATTCGAC	TCTCACTGCATCGGCTTTGT	NM_212859.2
6.	ZO-1	CACGAGACAAACTGGCAAGA	TCCAGCACTGCATGCTTATC	BI706952.1
7.	NFE2L2a	GGCGATCCTCCTGTAAACCC	CGAAGGATCCGTCTTCGGTT	NM_182889.1
8.	HMOX1a	GCTTCTGCTGTGCTCTCTATACG	CAATCTCTCTCAGTCTCTGTGC	NM_001127516.1
9.	KEAP1a	CCTTTGCTCCGTCTGAAT	GTCTGGTTGTTTGGTGGG	NM_182864.2
10.	All Bifidobacteria	GGGATGCTGGTGTGGAAGAGA	TGCTCGCGTCCACTATCCAGT	DQ298393.1
11.	All Lactobacillus spp.	TGGATGCCTTGGCACTAGGA	AAATCTCCGGATCAAAGCTTACTTAT	AY365115.1
12.	All Enterococcus spp.	AGAAATTCCAAACGAACTTG	CAGTGCTCTACCTCCATCATT	HM007611.1
13.	Beta-actin	AAGCTGTGACCCACCTCACG	GGCTTTGCACATACCGGAGC	NM_131031.2

• iii. Locomotory and anxiety-like behavior analysis

• a) Estimation of acetylcholinesterase (AChE) activity

Acetylcholinesterase activity was assessed by adding the sample supernatant to a reaction mixture containing 3.3 mM DTNB and incubating it for 20 min. After the incubation, acetylcholine iodide was added as the substrate, and the absorbance was measured at 412 nm using a spectrophotometer (87).

• b) Light–dark preference test

Anxiety-like behavior was assessed using a light-dark preference assay. A rectangular glass tank (12 × 11 × 35 cm) was divided into two compartments: a dark zone covered with black tape and a light-exposed zone. Individual zebrafish (n = 9 per group) were placed in the tank and recorded for 180 s using a mobile camera. Behavioral parameters including time spent in the dark zone, latency to enter the light zone, and the number of transitions between compartments, were analyzed using UMA tracking software. All recordings were coded, and the observer analyzing the data was blinded to the treatment groups to eliminate bias and ensure objective interpretation. The light-dark preference test was conducted under controlled laboratory conditions with a consistent light–dark cycle. Ambient illumination was maintained uniformly throughout the experiment to ensure comparable testing conditions for all groups and to minimize behavioral variability. Water temperature was maintained at room temperature during the testing period. Furthermore, all behavioral assessments were performed during the same period of the light phase to minimize potential influences of circadian rhythm on zebrafish behavior (86).

• c) T-maze test

Learning and memory performance in adult zebrafish were assessed using a T-maze apparatus made of transparent Plexiglass. The maze consisted of a start chamber (12 × 11 × 11 cm) with a removable gate, a long arm (12 × 11 × 35 cm), and two short arms (12 × 11 × 20 cm) leading to square chambers (12 × 20 × 20 cm) designated as red (aversive) and green (reward) zones. Fish were trained over three consecutive days, during which entry into the red zone was discouraged, while the green zone was associated with a food reward. On day 21, behavioral testing was conducted (n = 9 per group) to evaluate the effects of rotenone and SCFA (C10) on cognitive function. Latency to reach the green zone and time spent within it were recorded and analyzed using UMA tracking software over a 180-s observation period. All video recordings were randomized and analyzed by an independent investigator who was blinded to the treatment groups to ensure unbiased assessment. The T-maze behavioral assessment was performed under standardized laboratory conditions with uniform ambient lighting and a consistent light–dark cycle. Water temperature was maintained at room temperature throughout the experiment. To reduce variability associated with circadian fluctuations, all fish were tested during the same period of the light phase. Identical environmental conditions were maintained for all experimental groups to ensure reproducibility and reliable comparison of learning and memory performance (86).

• iv. Histopathological analysis

Adult zebrafish (n = 9 per group) were euthanized using tricaine and fixed in 4% paraformaldehyde at room temperature for 24–48 h. After fixation, samples were dehydrated through a graded ethanol series, cleared in xylene, and embedded in paraffin at 58–60 °C overnight. Paraffin blocks were sectioned using a microtome, and the sections were mounted on glass slides after being floated in a warm water bath. Hematoxylin and eosin (H&E) staining was performed by immersing the sections in hematoxylin for 5–10 min, followed by rinsing, differentiation in acid alcohol, and counterstaining with eosin for 2 min. The sections were then dehydrated in ethanol, cleared in xylene, and examined under a bright-field microscope for histological evaluation (84).

2.2. Statistical analysis

Each experiment in this study was conducted in triplicate, and the results are presented as mean ± SD. Data analysis was performed using GraphPad Prism 5.0 (GraphPad Software, Inc., San Diego, CA) employing the Tukey Multiple Comparison Test and one-way analysis of variance (ANOVA). Results were marked with “^*” and considered significant when the p-value was less than 0.05.

3. Results

3.1. Isolation and screening of SCFA-producing LAB from Sauerkraut fermentation

In this study, approximately 245 × 10⁶ bacterial isolates were recovered from a 45-day fermented cabbage sample (Brassica oleracea var. capitata; Figures 1A–C) cultured on nutrient agar (NA) plates (Figure 1D). Of these, nearly 208 × 10⁶ colonies exhibited characteristic LAB morphology on MRS agar (Figure 1E). From the isolated colonies, 90 were selected for preliminary screening based on colony morphology, mucoid appearance, and fermentative characteristics. The selection of isolates for detailed characterization was based on predefined screening criteria rather than random sampling. Among the 90 presumptive LAB isolates, six strains (C10, C15, C24, C43, C68, and C85) demonstrated superior colony morphology, growth characteristics, and acidification capacity. Consequently, these isolates were prioritized for subsequent antimicrobial and probiotic characterization studies.

Figure 1.

Isolation, screening, morphological, biochemical, and molecular identification of SCFA-producing Lactiplantibacillus plantarum C10 from Sauerkraut fermentation. (A) Initial stage of cabbage fermentation (0 day), (B) intermediate fermentation stage (20 days), and (C) final fermentation stage (45 days), (D) Bacterial growth observed on nutrient agar (NA) plates at a 10⁻³ dilution, and (E) selective growth of LAB on MRS agar plates. (F, G) Antimicrobial activity of selected screened isolates against Streptococcus spp. and Pseudomonas spp (H) Growth kinetics and antimicrobial activity of selected isolates at different incubation periods, (I) Gram staining of isolate C10, (J) catalase test (K) Ferric chloride (FeCl₃) assay, (L) Gas production and fermentation. (M) Bile salt tolerance assay. (N) Acid and base tolerance assay, (O–S) Colony morphology and ropy phenotype of isolate C10. (T) Phylogenetic tree based on 16S rRNA gene sequencing. Data were considered statistically significant at p < 0.05 and are represented by the symbol “*.”

Further antimicrobial screening revealed that isolates C15, C10, C24, C43, C68, and C85 exhibited inhibitory activity against Streptococcus spp. and Pseudomonas spp. (Figures 1F, G). Among these, C10 demonstrated the highest antibacterial activity, producing a zone of inhibition measuring 1.5 cm against Streptococcus spp. and 1.0 cm against Pseudomonas spp. The antibacterial isolates were further characterized morphologically and identified as Gram-positive, rod-shaped, non-spore-forming bacteria, which are typical characteristics of LAB.

3.2. Morphological and biochemical characterization of LAB isolates

The screened isolates underwent morphological and biochemical characterization to identify potential SCFA-producing LAB strains. Growth kinetics analysis of isolates C15, C10, C24, C43, C68, and C85 at various incubation periods (24, 48, 72, 96, and 120 h) revealed differences in bacterial growth and antimicrobial potential. Among these, isolate C10 exhibited higher and more stable growth, reaching a maximum optical density (OD₆₀₀) of 1.04 at 72 h of incubation while maintaining consistent antimicrobial activity throughout the experimental period (Figure 1H). Microscopic examination and biochemical characterization confirmed that isolate C10 was Gram-positive, catalase-negative, rod-shaped, and non-spore-forming, which are characteristic features of LAB (Figures 1I, J). The production of lactic acid by isolate C10 was further validated using the ferric chloride (FeCl₃) assay, where the development of a light yellow-green coloration indicated the presence of organic acid metabolites (Figure 1K). Additionally, gas production analysis using Durham tubes demonstrated minimal gas accumulation, suggesting that isolate C10 predominantly exhibited homofermentative metabolism with potential SCFA-producing capabilities (Figure 1L).

A bile salt tolerance assay revealed that isolate C10 exhibited substantial resistance to bile salts, maintaining significant bacterial growth in MRS medium supplemented with various bile salt concentrations after 24 h of incubation (Figure 1M). The isolate showed optical densities (OD₆₀₀) of 0.98, 0.95, and 0.89 in the presence of 0.1%, 0.3%, and 0.5% bile salts, respectively. However, growth slightly decreased to an OD₆₀₀ of 0.72 at a 0.7% bile concentration compared to the control MRS medium (OD₆₀₀ = 1.0). Similarly, acid and base tolerance assays demonstrated that isolate C10 effectively survived under both acidic and neutral pH conditions (Figure 1N). The isolate exhibited minimal growth at pH 2 (OD₆₀₀ = 0.08), moderate growth at pH 4 (OD₆₀₀ = 0.61), and maximum growth at pH 5 and pH 7 with OD₆₀₀ values of 0.99 and 0.95, respectively. Additionally, colonies of isolate C10 displayed shiny, mucoid, and ropy textures on MRS agar plates, confirming extracellular polysaccharide secretion and exopolysaccharide (EPS)-production capability (Figures 1O–S). The production of EPS and the characteristic ropy phenotype suggest that isolate C10 possesses strong fermentative and metabolic potential associated with SCFA-producing LAB. The formation of long filamentous strands during colony lifting further confirmed the ropy phenotype of the isolate.

3.3. Identification of selected SCFA-producing isolate C10

Identification of the selected isolate C10 was based on its morphological, biochemical, and molecular characteristics. The screened isolate C10 was observed to be Gram-positive, catalase-negative, rod-shaped, and non-spore-forming, which are characteristic features of LAB. Additionally, the isolate exhibited strong antimicrobial activity, homofermentative metabolism, bile salt tolerance, acid tolerance, and the capacity to produce SCFA.

Molecular identification of isolate C10 was performed using 16S rRNA gene sequencing analysis. BLAST analysis of the obtained sequence revealed that strain C10 showed 99.86% similarity to L. plantarum strains available in the NCBI database. Phylogenetic analysis based on the maximum likelihood method demonstrated a close evolutionary relationship between isolate C10 and L. plantarum strains, confirming its taxonomic classification within the genus Lactiplantibacillus (Figure 1T). The obtained sequence was identified as a partial 16S ribosomal RNA gene of L. plantarum strain C10, and was submitted to GenBank under the accession number PP860578.1.

3.4. SCFA production optimization by L. plantarum C10

The working isolate L. plantarum C10 exhibited efficient growth and SCFA production under various fermentation conditions, including incubation time, carbon source, prebiotic supplementation, nitrogen source, pH, and bile salt concentration (Figures 2A–H). Growth and SCFA production patterns observed under shaking and static conditions indicated that shaking significantly enhanced metabolite production compared to static culture conditions (Figure 2A). Maximum bacterial growth and SCFA production occurred under shaking conditions, yielding approximately 5.1 g/L of SCFA compared to 4.3 g/L under static conditions.

Figure 2.

Optimization, characterization, and antioxidant activity of SCFA produced by L. plantarum C10. (A) Effect of rotation, (B) Effect of incubation period, (C) Effect of carbon sources, (D) Effect of inulin, (E) Effect of FOS, (F) Effect of nitrogen sources, (G) Effect of different pH conditions, and (H) Effect of bile salt. (I) FTIR spectrum analysis of C10-derived SCFA metabolites. (J) HPLC chromatogram of C10-derived SCFA-organic acid metabolites, (K) DPPH free radical scavenging activity and (L) ABTS radical scavenging activity. Data were considered statistically significant at p < 0.05 and are represented by the symbol “*.”

Optimization of incubation time showed that SCFA production gradually increased from 24 to 72 h, reaching a peak of approximately 5.0 g/L at 72 h, after which production slightly decreased during prolonged incubation (96–120 h; Figure 2B). Carbon source optimization indicated that supplementation with fructose and sucrose significantly enhanced SCFA production compared to other tested carbohydrates, while starch supplementation resulted in comparatively lower metabolite production (Figure 2C).

Among the tested prebiotic substrates, inulin supplementation markedly enhanced both bacterial growth and SCFA production in a concentration-dependent manner (Figure 2D). The maximum SCFA yield of approximately 5.8 g/L was recorded at 6% inulin supplementation. Similarly, fructo-oligosaccharide (FOS) supplementation also markedly improved SCFA production, with the highest yield observed at a 6% FOS concentration (Figure 2E).

Nitrogen source optimization studies revealed that peptone and yeast extract supplementation significantly increased SCFA production compared to other nitrogen sources (Figure 2F). Among the tested supplements, peptone produced the highest SCFA yield, reaching approximately 5.7 g/L, followed by the medium containing yeast extract. In contrast, ammonium-based nitrogen sources, such as ammonium sulfate and ammonium carbonate, resulted in comparatively lower bacterial growth and SCFA production.

Furthermore, pH optimization studies showed that isolate C10 produced the maximum SCFA at pH 8, followed by pH 6, while lower production was observed under highly acidic conditions (Figure 2G). Bile salt tolerance analysis confirmed that isolate C10 maintained stable SCFA production in the presence of bile salts up to 0.4%, although higher concentrations of bile resulted in a reduction in metabolite yield (Figure 2H).

Overall, supplementation with inulin, FOS, and peptone significantly enhanced SCFA production by L. plantarum C10. Among all tested conditions, 6% inulin supplementation and peptone-containing medium yielded the highest SCFA production, indicating their strong influence on fermentative metabolite production and probiotic metabolic activity.

3.5. Purification of L. plantarum C10 SCFA

• a) Characterization and antioxidant potential

Fourier-transform infrared spectroscopy (FTIR) analysis of the SCFA extract produced by L. plantarum C10 revealed characteristic functional groups associated with organic acid metabolites (Figure 2I). A broad and intense absorption peak at 3,288.249 cm⁻¹ corresponded to O–H stretching vibrations, indicating the presence of hydroxyl groups typically associated with carboxylic acids and hydrogen-bonded compounds. The prominent absorption peak at 1,632.802 cm⁻¹ was attributed to C=O stretching vibrations of carbonyl groups, confirming the presence of carboxylic acid functionalities typical of SCFA metabolites. Additionally, peaks at 1,265.633 cm and 1,042.476 cm⁻¹ corresponded to C–O stretching and C–O–C functional group vibrations, respectively, indicating the presence of ester and carbohydrate-associated linkages within the metabolite profile. These FTIR spectral characteristics collectively confirm the presence of organic acid-based metabolites and support the SCFA-producing capability of L. plantarum C10.

• b) HPLC analysis of fermentation-derived SCFA metabolites

High-performance liquid chromatography (HPLC) analysis of the metabolite extract produced by L. plantarum C10 revealed prominent chromatographic peaks corresponding to fermentation-derived acidic metabolites associated with SCFA production (Figure 2J). The chromatogram recorded at 254 nm displayed two major peaks with retention times of 2.649 min and 2.856 min, respectively. Among the detected peaks, Peak 1 exhibited the highest chromatographic intensity, with a peak area of 22,844,280 and a peak height of 1,575,227 mAU, indicating it is the predominant metabolite in the extract. In contrast, Peak 2 showed a lower peak area of 3,422,808 and a peak height of 760,990 mAU, suggesting the presence of a secondary acidic metabolite in lower abundance. The total integrated chromatographic peak area was 26,267,088 with a cumulative peak height of 2,336,217 mAU. The sharp and symmetrical peak profiles indicate efficient chromatographic separation and confirm the presence of low molecular weight polar organic acid metabolites commonly associated with SCFA-producing LAB. Additionally, the early retention times observed for both peaks are characteristic of fermentation-derived short-chain acidic compounds, supporting the efficient fermentative and SCFA-producing capability of L. plantarum C10 under optimized growth conditions. These findings indicate that L. plantarum C10 produces acidic fermentation metabolites. However, because authenticated SCFA standards were not employed in this analysis, these peaks should be interpreted as SCFA-associated organic acid metabolites rather than definitive identifications of individual SCFAs.

• i. Antioxidant activity of C10-SCFA

The antioxidant potential of SCFA produced by L. plantarum C10 was evaluated using DPPH and ABTS radical scavenging assays, with ascorbic acid serving as the standard reference control. As shown in Figure 2K, the DPPH radical scavenging activity of C10-SCFA increased in a concentration-dependent manner. At a concentration of 1 mg/ml, C10-SCFA exhibited approximately 30% scavenging activity, while the standard showed nearly 40% inhibition. This activity progressively increased with higher concentrations of SCFA, reaching approximately 93% inhibition at 8 mg/ml, which was comparable to the standard antioxidant activity of 96%. The enhanced scavenging activity at elevated concentrations indicates the strong hydrogen- and electron-donating ability of the SCFA metabolites produced by isolate C10.

Similarly, the ABTS radical scavenging activity demonstrated a concentration-dependent increase for both the standard and C10-SCFA samples (Figure 2L). At 1 mg/ml, the standard exhibited approximately 82% inhibition, while C10-SCFA showed nearly 74% inhibition. As SCFA concentrations increased, the scavenging activity gradually improved, reaching approximately 95% inhibition for C10-SCFA and 98% for the standard at a concentration of 8 mg/ml. The strong antioxidant activity exhibited by C10-derived SCFA metabolites suggests its potential role in reducing oxidative stress and supports the functional probiotic properties of L. plantarum C10.

• ii. In vivo developmental toxicity assessment of C10-derived SCFA metabolites in zebrafish embryos

In vivo developmental toxicity of C10-derived SCFA metabolites was evaluated using zebrafish embryos exposed to various concentrations ranging from 1 to 40 mg/ml for 24, 48, and 72 h post-fertilization (hpf; Figures 3A, B). Embryos treated with lower SCFA concentrations (1–30 mg/ml) exhibited normal growth, morphology, pigmentation, and hatching patterns comparable to the control group, with survival rates consistently above 90%. No significant developmental abnormalities, such as spinal curvature, yolk sac edema, tail malformation, or delayed development, were observed within these concentration ranges. However, embryos exposed to higher concentrations of 35 mg/ml and 40 mg/ml exhibited mild developmental toxicity characterized by slight yolk sac enlargement, reduced pigmentation, delayed hatching, and altered larval morphology. Survival analysis indicated a gradual reduction in embryo viability at higher concentrations, with approximately 60% survival at 35 mg/ml and nearly 50% survival at 40 mg/ml compared to the control group (Figure 3B). These findings suggest that SCFA produced by L. plantarum C10 exhibits minimal developmental toxicity at lower and moderate concentrations and demonstrates favorable biocompatibility in zebrafish embryos.

Figure 3.

In vivo developmental toxicity. (A) SCFA in zebrafish embryos and larvae. (B) Percentage of survival. The data were considered significant (p < 0.05) and marked by the symbol “*.”

3.6. Therapeutic potential of C10-derived SCFA metabolites in a rotenone-induced PD zebrafish model

• I. In vivo antioxidant activity

• SOD assay

SOD activity was highest in the control group (Group 1), measuring approximately 92 U/mg protein. In contrast, the rotenone-induced zebrafish (Group 2) showed a significant reduction in SOD activity dropping to nearly 50 U/mg protein, which indicates increased oxidative stress (Figure 4A). Treatment with levodopa (Group 3) partially restored SOD levels to around 76 U/mg protein. Notably, treatment with C10-derived SCFA metabolites (Group 4) led to a greater restoration of SOD activity, reaching nearly 80 U/mg protein. This suggests significant antioxidative protection against rotenone-induced oxidative damage.

Figure 4.

Therapeutic potential of C10-derived SCFA metabolites in a rotenone-induced PD zebrafish model. In vivo antioxidant and gene expression analysis in zebrafish treated with C10-derived SCFA metabolites (Group 1: Control, Group 2: Rotenone, Group 3: Rotenone + Levodopa, and Group 4: Rotenone + SCFA). (A) SOD, (B) CAT, (C) GSH, (D) GST, (E) LPO, and (F) NO estimation (n = 2/group). Gene expression analysis (n = 6/group): (G) neuronal and inflammatory markers (DRD2a, TH2, IL10, and TNF-α), (H) NRF2 pathway-associated genes (Nfe2l2a, Hmox1a, and Keap1a), (I) tight junction-associated markers (Claudin-5a and ZO-1), and (J) gut microbiota-associated markers (Bifidobacteria, Lactobacillus, and Enterococcus). Data were considered statistically significant at p < 0.05 and are represented by the symbol “*.”

• CAT assay

CAT activity was significantly decreased in the rotenone-treated group (Group 2), which showed nearly 22 μmol/min/mg protein, compared to the control group (Group 1), that exhibited approximately 85 μmol/min/mg protein (Figure 4B). The administration of levodopa (Group 3) resulted in a notable increase in CAT activity, reaching nearly 52 μmol/min/mg protein. Similarly, SCFA-treated zebrafish (Group 4) displayed enhanced CAT activity reaching approximately 65 μmol/min/mg protein, indicating improved antioxidant defense mechanisms.

• Estimation of GSH activity

GSH levels were significantly lower in the rotenone-induced zebrafish (Group 2), measuring nearly 10 nmol/mg protein compared to approximately 18 nmol/mg protein in the control group (Figure 4C). Treatment with levodopa (Group 3) restored GSH levels to around 14 nmol/mg protein, while treatment with C10-derived SCFA metabolites (Group 4) further increased GSH levels to nearly 17 nmol/mg protein, indicating enhanced cellular antioxidant capacity.

• Estimation of GST activity

GST activity was highest in the control group (Group 1), with approximately 8 U/mg protein. In contrast, rotenone exposure significantly reduced GST activity to nearly 2.5 U/mg protein in Group 2 (Figure 4D). Zebrafish treated with levodopa (Group 3) exhibited improved GST activity reaching about 6.5 U/mg protein. Meanwhile, SCFA-treated zebrafish (Group 4) displayed GST activity around 5 U/mg protein, indicating a partial restoration of detoxification enzyme activity.

• LPO level estimation

MDA levels, an indicator of lipid peroxidation, were lowest in the control group (Group 1), measuring approximately 0.016 μmol/min/mg protein (Figure 4E). In the rotenone-induced zebrafish (Group 2), MDA levels were significantly elevated, reaching about 0.031 μmol/min/mg protein, which indicates increased oxidative membrane damage. Treatment with levodopa (Group 3) and C10-derived SCFA metabolites (Group 4) significantly reduced MDA accumulation to approximately 0.025 and 0.022 μmol/min/mg protein, respectively, suggesting a decrease in lipid peroxidation.

• NO level estimation

Nitric oxide (NO) levels were significantly elevated in rotenone-induced zebrafish (Group 2), reaching approximately 0.72 μmol/mg protein compared to the control group (Group 1), which exhibited nearly 0.25 μmol/mg protein (Figure 4F). Treatment with levodopa (Group 3) reduced NO accumulation to about 0.30 μmol/mg protein. Similarly, treatment with C10-derived (Group 4) effectively decreased NO levels to approximately 0.27 μmol/mg protein. These results indicate reduced nitrosative stress and improved antioxidant status in the zebrafish model.

• II. Gene expression analysis

Gene expression analysis revealed significant alterations in neuronal, inflammatory, Nuclear factor erythroid 2-related factor 2 (NRF2) pathway-associated, tight junction, and gut microbiota-related markers in the rotenone-induced PD zebrafish model following treatment with C10-derived SCFA metabolites (Figures 4G–J). The dopaminergic marker DRD2a was significantly downregulated in the rotenone-treated group (Group 2; 0.42-fold) compared to the control group (Group 1; 1.12-fold), indicating impaired dopaminergic signaling. In contrast, treatment with levodopa (Group 3) and C10-derived SCFA metabolites (Group 4) markedly restored DRD2a expression to 2.95-fold and 3.52-fold, respectively. Similarly, the anti-inflammatory cytokine IL10 was markedly reduced in Group 2 (0.38-fold) compared to the control group (1.25-fold), while Groups 3 and 4 exhibited significant upregulation to 4.32-fold and 2.45-fold, respectively. Conversely, the pro-inflammatory cytokine Tumor necrosis factor-alpha (TNF-α) was significantly elevated in the rotenone-treated group (3.18-fold) compared to the control group (1.18-fold), whereas levodopa and C10-derived SCFA metabolites treatment reduced TNF-α expression to 0.72-fold and 0.65-fold, respectively. Additionally, TH2 expression was decreased in Group 2 (0.45-fold) compared to the control group (1.28-fold), while Groups 3 and 4 restored expressions to 2.12-fold and 2.32-fold, respectively (Figure 4G).

NRF2 pathway-associated genes exhibited significant modulation following SCFA treatment (Figure 4H). The expression of Nfe2l2a was reduced in Group 2 (0.42-fold) compared to the control group (0.78-fold). In contrast, Groups 3 and 4 restored expression levels to 1.08-fold and 1.22-fold, respectively. Similarly, Hmox1a expression decreased in Group 2 (0.40-fold) compared to the control group (0.45-fold) and then increased in Group 3 (0.72-fold) and Group 4 (1.02-fold). Conversely, Keap1a expression was markedly elevated in the rotenone-treated group (1.58-fold) compared to the control group (0.72-fold). Treatment with levodopa and C10-derived SCFA metabolites treatment reduced Keap1a expression to 0.72-fold and 0.61-fold, respectively, indicating regulation of the NRF2 antioxidant signaling pathway.

Analysis of tight junction-associated genes revealed that rotenone exposure significantly downregulated Claudin-5a and ZO-1 expression in Group 2, with levels at 0.41-fold and 0.56-fold, respectively, compared to the control group (1.02-fold and 1.05-fold; Figure 4I). However, treatment with levodopa and C10-derived SCFA metabolites restored Claudin-5a expression to 1.56-fold and 1.32-fold, respectively, while ZO-1 expression increased to 1.42-fold and 1.30-fold, respectively, suggesting improved epithelial and barrier integrity.

Relative abundance analysis of selected gut microbiota-associated bacterial markers revealed that beneficial microbial markers, including Bifidobacteria, Lactobacillus, and Enterococcus were significantly downregulated in the rotenone-treated group, with expression levels at 0.45-fold, 0.44-fold, and 0.55-fold, respectively, compared to the control group (0.74-fold, 1.10-fold, and 1.02-fold, respectively; Figure 4J). Treatment with levodopa restored expression levels of Bifidobacteria (1.08-fold), Lactobacillus (0.72-fold), and Enterococcus (0.86-fold). Similarly, treatment with C10-derived SCFA metabolites enhanced the expression of Bifidobacteria (1.22-fold), Lactobacillus (1.05-fold), and Enterococcus (0.90-fold), indicating a restoration of gut microbial balance and modulation of GBA homeostasis.

• III. Locomotor and anxiety-related behavioral analysis in rotenone-induced zebrafish model

• AChE level estimation

AChE activity analysis revealed significant cholinergic dysfunction in zebrafish induced by rotenone, with subsequent recovery following treatment with C10-derived SCFA metabolites (Figure 5A). The control group (Group 1) exhibited the highest AChE activity, recording approximately 2.8 μmol/min, which indicates normal cholinergic neurotransmission and neuronal function. In contrast, rotenone-treated zebrafish (Group 2) showed a marked reduction in AChE activity to nearly 0.9 μmol/min, suggesting severe neurotoxicity, impaired cholinergic signaling, and oxidative stress-mediated neuronal damage. Treatment with levodopa (Group 3) significantly restored AChE activity to approximately 2.2 μmol/min, indicating partial recovery of neuronal function. Similarly, zebrafish treated with C10-derived SCFA metabolites (Group 4) demonstrated improved AChE activity reaching nearly 2.0 μmol/min, which suggests a restoration of cholinergic neurotransmission and neuroprotective activity against rotenone-induced neuronal impairment. These findings indicate that C10-derived SCFA metabolites effectively attenuated rotenone-associated neurochemical dysfunction and contributed to improved neuronal signaling and neurotransmitter regulation in the Parkinsonian zebrafish model.

Figure 5.

Neurobehavioral assessment of C10-derived SCFA metabolites in a rotenone-induced PD zebrafish model. (Group 1: Control, Group 2: Rotenone, Group 3: Rotenone + Levodopa, and Group 4: Rotenone + C10-SCFA). (A) Acetylcholinesterase (AChE) activity assay (n = 3/group). Light and dark: (B) latency toward the dark zone, (C) time spent in the dark zone, and locomotor tracking patterns of zebrafish from (D) Group 1, (E) Group 2, (F) Group 3, and (G) Group 4 (n = 9/group). T-maze; Day 21 (H) Group 1, (I) Group 2, (J) Group 3, and (K) Group 4, (L) latency toward the green zone and (M) time spent in the green zone (n = 9/group). Data were considered statistically significant at p < 0.05 and are represented by the symbol “*.”

• Light and dark preference

The light and dark preference test was conducted to evaluate anxiety-like behavior and locomotor responses in zebrafish following rotenone exposure and treatment with C10-derived SCFA metabolites treatment. The control group (Group 1) exhibited normal behavioral patterns, showing a higher latency to enter the dark zone (131.33 s) and minimal time spent in the dark compartment (19.67 s). This indicates balanced exploratory activity and reduced anxiety-like behavior. In contrast, the rotenone-treated group (Group 2) displayed a marked reduction in latency to the dark zone (4.67 s) and a prolonged preference for the dark compartment (171.33 s), suggesting severe anxiety-related behavior and locomotor impairment. Compared to Group 2, the rotenone-exposed zebrafish treated with levodopa (Group 3) demonstrated a significant increase in latency to the dark zone (65.67 s) and reduced time spent in the dark compartment (94 s). Similarly, the rotenone-exposed zebrafish treated with C10-derived SCFA metabolites (Group 4) exhibited increased latency toward the dark zone (64 s) and decreased dark zone retention time (87.67 s) compared to the rotenone-treated group. Locomotor tracking analysis further revealed that rotenone exposure induced restricted and disorganized swimming patterns predominantly within the dark zone, while the levodopa- and C10-derived SCFA-treated groups showed improved swimming trajectories, enhanced exploratory movement, and increased transitions between zones, comparable to the control group (Figures 5B–G). These findings indicate that C10-derived SCFA metabolites effectively alleviates rotenone-induced anxiety-like behavior and locomotor dysfunction in zebrafish.

• T-maze

The T-maze behavioral assay revealed significant cognitive and exploratory impairments in rotenone-treated zebrafish, while treatment with C10-derived SCFA metabolites improved spatial preference and behavioral performance (Figures 5H–M). The control group (Group 1) displayed normal exploratory behavior, with a lower latency toward the green zone (25.33 s) and a longer time spent in the green compartment (158.67 s), indicating intact memory retention, exploratory activity, and reduced anxiety-like behavior. In contrast, rotenone-treated zebrafish (Group 2) exhibited severe behavioral dysfunction characterized by a markedly increased latency toward the green zone (173.33 s) and minimal time spent in the green compartment (2.67 s), suggesting cognitive impairment, reduced exploratory motivation, and altered spatial memory. Treatment with levodopa (Group 3) significantly improved behavioral performance by reducing latency toward the green zone to 63.33 s and increasing the time spent in the green zone to 112 s. Similarly, zebrafish treated with C10-derived SCFA metabolites (Group 4) showed substantial behavioral recovery, with a reduced latency toward the green zone (83 s) and increased retention time in the green compartment (110.33 s) compared to the rotenone-treated group. Locomotor trajectory analysis further supported these findings, as the control group demonstrated organized and frequent transitions toward the green zone, while rotenone-treated zebrafish exhibited restricted and disorganized movement patterns with limited exploration. In contrast, the levodopa- and C10-derived SCFA-treated groups displayed improved swimming trajectories, enhanced exploratory movement, and increased preference for the green compartment. These results indicate that C10-derived SCFA metabolites effectively attenuates rotenone-induced cognitive dysfunction.

• IV. Histopathological analysis

Histopathological evaluation of zebrafish gut and brain tissues using Hematoxylin and Eosin (H&E) staining revealed significant tissue damage induced by rotenone, along with subsequent recovery following treatment with C10-derived SCFA metabolites (Figures 6A, B). The control group (Group 1) exhibited normal organization of intestinal villi, intact epithelial architecture, and well-preserved neuronal morphology. In contrast, the rotenone-treated group (Group 2) displayed severe pathological alterations, including degeneration of intestinal villi, necrosis of epithelial cells, cellular shedding, partial tissue lysis, vacuolar degeneration, and pyknotic neurons, indicating substantial intestinal and neuronal damage. Treatment with levodopa (Group 3) resulted in partial restoration of tissue architecture, although mild disruption of villi and occasional neuronal degeneration were still observed. Notably, zebrafish treated with C10-derived SCFA metabolites (Group 4) demonstrated marked histological recovery, characterized by restorated integrity of intestinal villi, reduced epithelial damage, preserved neuronal organization, and minimal pathological alterations compared to the rotenone-treated group. These findings indicate that C10-derived SCFA metabolites exert significant protective effects against rotenone-induced intestinal and neurodegenerative histopathological damage in zebrafish.

Figure 6.

Histopathological evaluation of gut and brain tissues in a rotenone-induced PD zebrafish model following treatment with C10-derived SCFA metabolites using hematoxylin and eosin (H&E) staining. (A) Histological sections of gut tissue from Group 1 (Control), Group 2 (Rotenone), Group 3 (Rotenone + Levodopa), and Group 4 (Rotenone + C10-SCFA). (B) Histological sections of brain tissue from the respective treatment groups. Red arrows indicate intestinal villi, red circles represent columnar epithelial cell necrosis, shedding, and partial lysis in gut tissues. Black circles indicate vacuolar degeneration in neuronal tissue, and black star represents pyknotic neurons.

4. Discussion

The present study demonstrated that traditionally fermented cabbage (Brassica oleracea var. capitata) represents an important natural reservoir of probiotic lactic acid bacteria (LAB) with functional potential. The predominance of LAB observed following fermentation is consistent with previous reports demonstrating that the acidic environment, salt concentration, and anaerobic fermentation conditions selectively enrich beneficial LAB populations in fermented vegetables such as sauerkraut and kimchi (88, 89). The recovery of diverse LAB isolates further supports the microbial richness of fermented cabbage and its suitability as a source of functionally important probiotic strains. Similar studies have reported that fermented vegetable matrices harbor metabolically active LAB capable of producing antimicrobial compounds, exopolysaccharides, and fermentation-derived SCFA metabolites with potential applications in gut health and functional food development (90, 91). These findings reinforce the value of traditionally fermented cabbage as a promising source for the isolation of probiotic bacteria with potential postbiotic and neuroprotective applications.

The strong antagonistic activity of isolate C10 may be attributed to its production of antimicrobial metabolites such as organic acids, SCFAs, hydrogen peroxide, and bacteriocin-like inhibitory compounds, which LAB commonly synthesizes during fermentation (92, 93). Similar findings have been reported for LAB derived from fermented vegetables, where L. plantarum strains isolated from kimchi and cabbage exhibited broad-spectrum inhibitory activity against pathogenic bacteria through acidification and the secretion of antimicrobial peptides (94). The inhibition zones observed in this study are comparable to those reported by Azat et al. (95), who found that LAB isolated from fermented vegetables produced inhibition zones ranging from 0.8 to 1.6 cm against foodborne pathogens, indicating potent antimicrobial functionality. Furthermore, Behera et al. (96) reported that L. plantarum strains derived from fermented cabbage exhibited enhanced inhibitory effects against both Gram-positive and Gram-negative pathogens due to the production of active metabolite and fermentative adaptation. The antimicrobial activity observed in isolate C10 may also be linked to SCFA production, as SCFAs such as acetate, propionate, and butyrate are known to reduce intracellular pH, disrupt membrane integrity, and suppress pathogenic bacterial growth while supporting beneficial gut microbiota (97). Collectively, the high LAB density, diversity of isolate, and potent antimicrobial activity demonstrated by isolate C10 suggest that traditionally fermented cabbage serves as an efficient natural reservoir of functionally significant LAB strains, with promising applications in SCFA production, gut microbiota modulation, and the development of neuroprotective probiotics.

The morphological and biochemical characterization conducted in this study demonstrated that isolate C10 possesses significant probiotic and fermentative properties associated with SCFA-producing LAB. Growth kinetics analysis revealed that isolate C10 exhibited comparatively higher and more stable growth. Similar growth patterns have been reported for LAB isolated from fermented rice and vegetable products, where enhanced biomass accumulation during the late exponential phase was linked to active carbohydrate metabolism and metabolite production (98). Microscopic and biochemical analyses confirmed that isolate C10 was Gram-positive, catalase-negative, rod-shaped, and non-spore-forming, characteristics commonly associated with probiotic LAB species. Comparable morphological features were observed in LAB isolates from fermented rice cultures, where most isolates were identified as Gram-positive rod-shaped bacilli arranged singly or in short chains (98). The ferric chloride assay further confirmed the production of lactic acid and related acidic metabolites, indicating active fermentative metabolism. Organic acid production is a key functional property of LAB, contributing to environmental acidification, pathogen inhibition, and enhanced probiotic activity (99). These homofermentative characteristics are particularly beneficial for functional probiotic strains, as they support facilitate efficient carbohydrate utilization and the production of SCFA-associated metabolites under controlled fermentation conditions. Overall, the morphological, biochemical, and fermentative characteristics observed in isolate C10 strongly support its classification as a promising SCFA-producing LAB strain with potential applications in probiotic and functional food development.

The ability of C10 to tolerate acidic pH and bile salt conditions indicates a high probability of surviving gastrointestinal transit, an essential prerequisite for probiotic efficacy. Similar findings were reported by Boke et al. (100), where EPS-producing LAB strains displayed enhanced survival under bile salt stress due to the protective role of extracellular polysaccharides in maintaining membrane integrity. Additionally, the isolate demonstrated efficient survival under both acidic and neutral pH conditions, with maximum growth observed at pH 5 and pH 7, while minimal growth was recorded at pH 2. Comparable acid and bile tolerance characteristics have been identified in probiotic LAB isolated from fermented foods, suggesting their suitability for gastrointestinal survival and colonization (101). Furthermore, isolate C10 exhibited shiny, mucoid, and ropy colony morphology on MRS agar, confirming its capacity to produce EPS. The formation of long filamentous strands during colony lifting further validated the ropy phenotype of the isolate. Similar EPS-associated ropy characteristics have been widely documented in probiotic LAB strains, where EPS production contributes to stress tolerance, bacterial adhesion, biofilm formation, and enhanced fermentative metabolism (100). Collectively, the strong bile tolerance, acid resistance, and EPS-producing ability observed in isolate C10 indicate its promising probiotic potential and support its application as a functionally important SCFA-producing LAB strain.

The identification of isolate C10 through morphological, biochemical, and molecular analyses confirmed that the strain belongs to the genus Lactiplantibacillus, known for its probiotic and fermentative potential. Isolate C10 was characterized as Gram-positive, catalase-negative, rod-shaped, and non-spore-forming, hallmark characteristics commonly associated with L. plantarum strains isolated from fermented foods (96). Molecular identification using 16S rRNA gene sequencing revealed that isolate C10 shares 99.86% similarity with L. plantarum strains in the NCBI database, confirming its taxonomic identity. Comparable sequence similarity values have been widely reported in recent LAB characterization studies, underscoring the reliability of 16S rRNA sequencing for the accurate identification of probiotic LAB isolates (98). Furthermore, phylogenetic analysis demonstrated a close evolutionary relationship between isolate C10 and reference L. plantarum strains, supporting its classification within the genus Lactiplantibacillus. Previous studies have shown that L. plantarum strains isolated from fermented vegetables exhibit strong antimicrobial activity, high fermentative efficiency, and tolerance to acid and bile, as well as the ability to produce SCFAs, all of which contribute to gut microbiota modulation and probiotic functionality (94). The deposition of the sequence under GenBank accession number PP860578.1 further validates the molecular identification and serves as a reference for future comparative probiotic and genomic studies. Overall, the phenotypic and molecular characteristics observed in isolate C10 strongly support its classification as a functionally important SCFA-producing L. plantarum strain with promising probiotic and therapeutic applications.

The optimization of fermentation conditions demonstrated that nutrient composition and environmental factors play critical roles in regulating fermentation-derived SCFA metabolite production by L. plantarum C10. Similar findings have been reported in LAB isolated from fermented foods, where controlled aeration enhanced biomass accumulation and organic acid production by stimulating carbohydrate metabolism and maintaining redox balance (102). The gradual increase in SCFA production up to 72 h of incubation further suggests active metabolic adaptation during the late exponential growth phase, after which metabolite production declined due to nutrient depletion and acid accumulation. Optimization of the carbon source revealed that fructose and sucrose significantly enhanced SCFA production compared to other carbohydrates, supporting previous findings that substrate availability strongly influences LAB fermentative metabolism and acid production profiles (103). Fructose has been shown to improve Nicotinamide adenine dinucleotide (NAD⁺) regeneration and redirect carbon flow toward organic acid synthesis, thereby boosting SCFA-associated metabolite production (104). Among the tested prebiotic substrates, inulin and fructo-oligosaccharides (FOS) significantly increased SCFA production, indicating efficient utilization of prebiotic carbohydrates by isolate C10. Similar studies have shown that oligosaccharide supplementation enhances LAB fermentative activity and promotes the production of acetate, propionate, and related SCFA metabolites through carbohydrate fermentation and cross-feeding mechanisms (102). Nitrogen source optimization further demonstrated that peptone and yeast extract significantly improved SCFA production compared to ammonium-based nitrogen sources. This observation alligns with previous reports indicating that complex nitrogen sources provide essential amino acids, vitamins, peptides, and cofactors necessary for efficient LAB growth and metabolite biosynthesis, whereas inorganic ammonium salts offer limited nutritional support (105, 106). Furthermore, pH optimization studies revealed that isolate C10 produced maximum SCFA under alkaline to near-neutral pH conditions, while acidic conditions reduced metabolite production due to physiological stress and metabolic inhibition. The ability of isolate C10 to maintain SCFA production under moderate bile salt concentrations further underscores its probiotic adaptability and potential for gastrointestinal survival. Overall, these findings demonstrate that medium optimization through appropriate carbon, nitrogen, and prebiotic supplementation significantly enhances SCFA production by L. plantarum C10, supporting its potential application in functional foods, postbiotic production, and gut microbiota-targeted therapeutic development.

The FTIR and HPLC analyses provided preliminary chemical evidence that the fermentation-derived SCFA metabolite preparation produced by L. plantarum C10 contains organic acid-associated compounds generated during bacterial fermentation. The observed FTIR absorption bands corresponding to hydroxyl, carbonyl, and C–O functional groups are consistent with previous reports describing fermentation-derived SCFA organic acid metabolites produced by probiotic LAB (107, 108). The HPLC analysis conducted in this study confirmed the efficient production of fermentation-derived SCFA metabolites by L. plantarum C10, supporting its capability to produce SCFAs. The chromatogram displayed two major peaks at retention times of 2.649 min and 2.856 min, indicating the presence of low molecular weight polar organic acids commonly associated with LAB fermentation. Similar retention profiles for SCFA-associated metabolites, including propionic and butyric acid derivatives, have been reported in previous HPLC-MS/MS analysis, where propionic acid exhibited a retention time of 2.62 min and butyric acid eluted at 3.76 min (71). The high peak area and symmetrical peak profile observed in the current chromatogram indicate efficient chromatographic separation, metabolite stability, and active fermentative metabolism by isolate C10. Previous studies have demonstrated that probiotic LAB strains such as Lactobacillus reuteri, Lactobacillus rhamnosus, and Bacillus clausii actively produce acetate, propionate, and butyrate during carbohydrate fermentation, contributing to gut microbial modulation and postbiotic functionality (71).

The antioxidant activity of the SCFA fraction derived from L. plantarum C10 demonstrated a clear concentration-dependent radical scavenging potential in both DPPH and ABTS assays, indicating the presence of bioactive metabolites capable of neutralizing free radicals. The strong DPPH scavenging activity observed at higher concentrations suggests that the SCFA metabolites possess effective hydrogen- and electron-donating abilities, stabilizing DPPH radicals and interrupting oxidative chain reactions. Similar findings have been reported in recent studies, where LAB-derived postbiotic metabolites exhibited significant antioxidant potential due to their redox-active organic acid components (109). The ABTS radical scavenging assay further confirmed the antioxidant efficacy of C10-SCFA, as the extract efficiently quenched ABTS cation radicals at increasing concentrations. Since the ABTS assay is sensitive to both hydrophilic and lipophilic antioxidant compounds, the high scavenging activity suggests that the SCFA fraction contains multifunctional antioxidant metabolites with broad radical neutralization capacity. Recent reports have shown that metabolites produced by Lactiplantibacillus strains exhibit strong ABTS scavenging activity associated with fermented metabolite production and postbiotic functionality (110, 111). The nearly comparable antioxidant activity of C10-SCFA to ascorbic acid at higher concentrations highlights its potent antioxidative capability and supports its potential application as a natural antioxidant source.

The developmental toxicity assessment conducted in this study demonstrated that SCFAs produced by L. plantarum C10 exhibit minimal embryotoxic effects and favorable biocompatibility in zebrafish embryos. Embryos exposed to SCFA concentrations ranging from 1–30 mg/ml displayed normal morphology, pigmentation, hatching, heartbeat, and survival comparable to those of the control group, indicating that the metabolite fraction was well-tolerated during early vertebrate development. These findings have been reported for pure SCFAs such as acetate, propionate, and butyrate, which show low acute and sub-acute toxicity with high biological safety margins (112). The absence of major developmental abnormalities such as spinal curvature, yolk sac edema, or tail malformation suggests that the C10-derived SCFA metabolites fraction does not significantly interfere with embryonic organogenesis at biologically relevant concentrations. Similar dose-dependent effects of SCFAs have been previously reported under prolonged or high-dose exposure conditions (113). The comparatively lower toxicity observed here may also be attributed to the balanced composition of fermentation-derived metabolites present within the SCFA fraction, rather than exposure to a single concentrated organic acid.

The present study demonstrated that C10-derived SCFA metabolites has significant antioxidant potential against rotenone-induced oxidative stress in zebrafish, as evidenced by the restoration of endogenous antioxidant enzyme activities and a reduction in oxidative damage markers. Rotenone exposure markedly decreased levels of SOD, CAT, GSH, and GST while significantly increasing lipid peroxidation and nitric oxide accumulation, confirming severe oxidative and nitrosative stress. Similar findings have been widely reported in rotenone-induced PD models, where the inhibition of mitochondrial complex I leads to excessive reactive oxygen species (ROS) generation and neuronal oxidative damage (114). Treatment with C10-derived SCFA metabolites significantly restored antioxidant enzyme activities, particularly SOD, CAT, and GSH, indicating improved cellular antioxidant defense and the maintenance of redox homeostasis. Comparable antioxidative effects of SCFAs have been previously reported in GBA and neuroprotection studies, where acetate, propionate, and butyrate reduced oxidative stress and protected neuronal tissues by enhancing antioxidant defense pathways (115). The elevated activities of SOD and CAT observed following SCFA treatment may be linked to improved scavenging of superoxide radicals and hydrogen peroxide, thereby reducing oxidative injury and mitochondrial dysfunction. Additionally, the restoration of GSH and GST levels suggests enhanced glutathione-mediated detoxification and cellular defense against reactive metabolites. Previous studies have shown that SCFAs can regulate oxidative stress and inflammatory signaling by modulation of the antioxidant pathway, which leads to increased expression of cytoprotective and detoxification enzymes involved in cellular defense mechanisms (116). The significant reduction in MDA and NO levels following SCFA treatment further indicates a decrease in lipid peroxidation and nitrosative stress, both of which are major contributors to dopaminergic neurodegeneration in Parkinsonian conditions. Similar reductions in oxidative membrane damage and inflammatory nitric oxide accumulation have been reported in zebrafish and rodent models treated with probiotic-derived metabolites and postbiotic SCFAs (117). Notably, the antioxidative effect observed in the SCFA-treated group was comparable to or greater than that of levodopa treatment for several parameters, suggesting that C10-derived SCFA metabolites may provide neuroprotective activity by regulating oxidative stress pathways, protecting mitochondria, and enhancing cellular antioxidant defense mechanisms. Collectively, these findings indicate that SCFA produced by L. plantarum C10 possesses strong in vivo antioxidant potential and may contribute to neuroprotection in rotenone-induced PD conditions.

Gene expression analysis conducted in this study revealed that C10-derived SCFA metabolites significantly modulated genes related to neuronal function, inflammation, NRF2-associated antioxidants, tight junctions, and gut microbiota in a rotenone-induced PD zebrafish model. This finding indicates strong neuroprotective and GBA regulatory activity. Rotenone exposure notably downregulated DRD2a expression while significantly increasing TNF-α levels, confirming dopaminergic dysfunction and heightened neuroinflammation, which are recognized pathological hallmarks of PD. Similar changes in dopaminergic signaling and inflammatory cytokine expression have been observed in rotenone-induced neurodegenerative models and are closely linked to oxidative stress-mediated neuronal injury and microglial activation (114). Treatment with C10-derived SCFA metabolites significantly restored DRD2a expression, suppressed TNF-α and enhanced IL10 expression, suggesting a reduction in inflammatory signaling and a recovery of neuronal homeostasis. Recent studies have shown that SCFAs regulate neuroimmune responses through communication along the microbiota–gut–brain axis and modulation of glial cell activation, ultimately reducing neuroinflammation and neuronal degeneration in Parkinsonian conditions (117, 118). NRF2 pathway-associated genes, including Nfe2l2a and Hmox1a were significantly restored following SCFA treatment, while Keap1a expression was markedly reduced, indicating the activation of NRF2-mediated antioxidant defense pathways. Similar observations have been reported in recent studies where microbiota-derived metabolites regulated oxidative stress and inflammatory signaling through modulation of the Keap1–NRF2 pathway, leading to enhanced cytoprotective gene expression and neuronal protection (119, 120). Furthermore, rotenone exposure significantly downregulated tight junction-associated genes Claudin-5a and ZO-1, whereas C10-derived SCFA metabolites restored their expression, indicating improved epithelial and Blood–brain barrier (BBB) integrity. Recent reports have similarly demonstrated that SCFAs enhance tight junction protein expression and reduce intestinal permeability associated with gut dysbiosis and neurodegeneration (121, 122). Gut microbiota-associated markers, including Bifidobacteria, Lactobacillus, and Enterococcus, were also significantly restored following SCFA treatment, suggesting recovery of microbial balance and modulation of GBA homeostasis. The microbiota-restorative effects of SCFAs have been extensively reported in recent studies on PD and microbiota-targeted therapies, where beneficial microbial metabolites promoted gut homeostasis, reduced the inflammatory burden, and improved neuronal signaling (27, 48, 123, 124). Collectively, these findings indicate that C10-derived SCFA metabolites exerts neuroprotective effects through coordinated regulation of dopaminergic signaling, inflammatory responses, NRF2-associated antioxidant pathways, epithelial barrier integrity, and gut microbiota composition in rotenone-induced Parkinsonian conditions.

The behavioral and neurochemical assessments conducted in this study demonstrated that C10-derived SCFAs exert significant neuroprotective effects against rotenone-induced Parkinsonian alterations in zebrafish. Rotenone exposure markedly reduced AChE activity, indicating cholinergic dysfunction and impaired neurotransmission linked to oxidative neuronal damage. In contrast, treatment with C10-derived SCFAs metabolites significantly restored AChE activity, suggesting a recovery of cholinergic signaling and neuronal integrity. Recent studies have emphasized that gut microbiota-derived SCFAs regulate neuronal homeostasis, neurotransmitter metabolism, neuroinflammation, and GBA communication, thereby contributing to neuroprotection in PD models (32, 125, 126). The restoration of AChE activity may therefore be related to the ability of SCFAs to modulate oxidative stress and enhance neuronal signaling pathways.

The light–dark behavioral assay further demonstrated that rotenone exposure induced severe anxiety-like behavior and locomotor dysfunction, characterized by increased dark-zone preference and restricted exploratory movement. In contrast, treatment with C10-derived SCFA metabolites significantly improved exploratory behavior, reduced dark-zone retention, and enhanced locomotor activity, indicating anxiolytic and neurobehavioral protective effects. Similar findings have been reported in recent studies showing that SCFAs influence dopaminergic and serotonergic signaling pathways and regulate stress-associated behavior through microbiota–GBA interactions (127). Furthermore, SCFA-mediated reductions in reactive oxygen species and inflammatory signaling have been shown to improve neuronal resilience and behavioral outcomes in zebrafish and other neurodegenerative models (128).

The T-maze assessment further confirmed that rotenone exposure led to significant cognitive impairment and spatial memory deficits. In contrast, treatment with C10-derived SCFAs metabolites markedly improved learning ability, exploratory preference, and cognitive performance. Previous studies have shown that microbiota-derived SCFAs play a crucial role in maintaining BBB integrity, suppressing neuroinflammation, regulating microglial activation, and enhancing cognitive function through GBA signaling pathways (129). Additionally, recent investigations have highlighted that SCFA-producing probiotic strains may mitigate Parkinsonian pathology by modulating gut microbial composition, inflammatory pathways, and neuronal communication networks (121, 130, 131). Collectively, these findings suggest that C10-derived SCFA metabolites possesses significant neuroprotective, anxiolytic, and cognition-enhancing properties, potentially mediated through the modulation of oxidative stress, neurotransmitter regulation, and microbiota–GBA signaling.

Histopathological evaluation demonstrated that rotenone exposure induced severe intestinal and neuronal damage in zebrafish. In contrast, treatment with C10-derived SCFAs significantly attenuated these pathological alterations. Rotenone-treated zebrafish exhibited degeneration of intestinal villi, epithelial cell necrosis, cellular shedding, and partial tissue lysis, indicating disruption of intestinal barrier integrity and inflammation-mediated tissue injury. Similar intestinal abnormalities, such as thinning of the intestinal wall and epithelial erosion, have been reported in zebrafish inflammatory models induced by Trinitrobenzene sulfonic acid (TNBS) exposure, where oxidative stress and inflammatory responses caused severe intestinal damage (132). Conversely, SCFA treatment in this study restored villi organization and reduced epithelial degeneration, suggesting improved intestinal protection and epithelial homeostasis. Brain histology further revealed that rotenone exposure caused vacuolar degeneration and pyknotic neurons, reflecting neurodegenerative damage and oxidative stress-mediated neuronal injury. Comparable neuronal alterations, including astrocytosis, edema, necrosis, and inflammation-mediated neuronal disruption, have been observed in zebrafish neuroinflammation models following bacterial outer membrane vesicle (OMV) exposure (133). Treatment with C10-derived SCFA metabolites significantly reduced neuronal degeneration and restored normal brain architecture, indicating potent neuroprotective activity. The observed protective effects may be attributed to the antioxidative and anti-inflammatory properties of SCFAs, which are known to regulate gut barrier integrity, suppress oxidative stress, and maintain neuronal homeostasis through GBA modulation. Collectively, these findings demonstrate that C10-derived SCFA metabolites exert significant gut-protective and neuroprotective effects against rotenone-induced histopathological damage in zebrafish.

5. Limitations and future perspectives

The present study has several limitations that should be considered when interpreting its findings. The probiotic-derived SCFA metabolite preparation evaluated in this work was a crude, fermentation-derived extract produced by L. plantarum C10. Individual metabolites were neither separated nor quantitatively characterized using authenticated analytical standards. Although FTIR and HPLC analyses indicated the presence of organic acid-associated metabolites, definitive identification and quantification of specific SCFAs, such as acetate, propionate, and butyrate, were not performed. Consequently, the precise chemical composition of the metabolite preparation remains partially characterized, and the specific bioactive compounds responsible for the observed biological effects could not be conclusively identified. It is also possible that the observed neuroprotective activity resulted from the synergistic action of multiple fermentation-derived SCFA metabolites rather than individual SCFAs alone. Additionally, strain identification relied primarily on 16S rRNA gene sequencing of the lead isolate (C10), and higher-resolution taxonomic characterization using whole-genome sequencing was not conducted. Gut microbiota assessment was restricted to selected bacterial markers and did not include comprehensive microbiome sequencing, metagenomic analyses, or absolute bacterial quantification. Furthermore, direct measurements of intestinal permeability, circulating metabolites, and protein-level validation were not performed. Key PD biomarkers, including α-synuclein aggregation, tyrosine hydroxylase-positive dopaminergic neuron quantification, and dopamine measurements, were also not evaluated. Although behavioral, biochemical, molecular, and histopathological analyses supported the rotenone-induced Parkinsonian phenotype, the absence of these disease-specific biomarkers limits definitive confirmation of neurodegeneration and prevents conclusive demonstration of ameliorative effects on PD. Moreover, the proposed mechanisms involving microbiota-GBA modulation were inferred from the observed biological responses and comparisons with previous literature, rather than being directly demonstrated in this study. Accordingly, these mechanistic interpretations should be regarded as hypothesis-generating and require further experimental validation. Therefore, these findings should be regarded as preliminary preclinical evidence from a rotenone-induced adult zebrafish model, supporting the neuroprotective potential of C10-derived SCFAs, while warranting further validation using disease-specific pathological markers.

Future studies should focus on comprehensively characterizing the C10-derived SCFA metabolite preparation. This can be achieved using validated GC-MS, GC-FID, LC-MS/MS, or targeted HPLC approaches that incorporate authentic standards and calibration curves to identify and quantify individual bioactive compounds. Comprehensive chemical profiling should also be performed to identify additional fermentation-derived metabolites and evaluate their individual and synergistic biological activities. Targeted metabolomics, chromatographic purification, and dose-response studies will be necessary to determine the specific contribution of individual metabolites to the observed neuroprotective effects. Additionally, whole-genome sequencing of strain C10, high-throughput microbiome profiling, intestinal permeability assays, circulating metabolite quantification, and microbiota-transfer experiments should be incorporated to clarify the role of microbiota-GBA interactions. In addition to that, investigations should also integrate causal pathway analyses, including pathway inhibition, genetic manipulation, or microbiota depletion/transfer strategies, to directly validate the molecular mechanisms underlying the observed neuroprotective effects. Further validation using protein-level analyses-including Western blotting, immunohistochemistry, immunofluorescence, and ELISA-together with assessment of α-synuclein pathology, tyrosine hydroxylase-positive neurons, and dopamine levels, will provide deeper mechanistic insights. Finally, validation in mammalian PD models will be essential to establish causality, confirm therapeutic relevance, and evaluate the translational potential of L. plantarum C10-derived SCFA metabolites for neurodegenerative disorders.

6. Conclusion

This study successfully isolated and characterized L. plantarum C10 from traditionally fermented cabbage, demonstrating its probiotic potential, including antimicrobial activity, tolerance to gastrointestinal stress, and the production of SCFA metabolites with antioxidant properties. Optimizing fermentation conditions further enhanced metabolite production, highlighting the isolate's functional adaptability and its promise as a source of bioactive postbiotic compounds. Preliminary preclinical evaluation in a rotenone-induced zebrafish model showed that C10-derived metabolites improved behavioral, biochemical, molecular, and histopathological parameters relevant to PD pathology. Because the metabolite preparation consisted of a chemically uncharacterized crude fermentation-derived extract, the observed biological effects cannot be attributed to any individual SCFA or specific bioactive metabolite. The observed biological responses are consistent with previous reports describing beneficial effects of probiotic-derived SCFA metabolites in experimental PD models; however, the precise molecular mechanisms and causal pathways remain to be established. These findings suggest that fermentation-derived SCFA metabolites from L. plantarum C10 may help modulate oxidative stress, inflammatory responses, and gut-associated molecular markers commonly implicated in rotenone-induced neurodegenerative disorders. Overall, the study highlights the potential of L. plantarum C10-derived SCFA metabolites as promising postbiotic candidates for further investigation in PD and other neurodegenerative disorders. Future studies involving comprehensive metabolite characterization, targeted metabolomics, mechanistic validation, microbiome sequencing, protein-level analyses, disease-specific PD biomarkers, and mammalian disease models will be essential to establish causality, identify the principal bioactive metabolites, and determine their translational relevance.

Funding Statement

The author(s) declared that financial support was not received for this work and/or its publication.

Data availability statement

All data generated or analyzed during this study are included in this article. Data for this article, including 16S rDNA sequencing of isolate C10 were submitted to the gene bank under the accession ID PP860578.1 (https://www.ncbi.nlm.nih.gov/nuccore/PP860578), qPCR primers, are available at NCBI (NCBI: NM_183068.1; NCBI: XM_005164734.5; NCBI: NM_213274.1; NCBI: BI706952.1; NCBI: DQ298393.1; NCBI: AY365115.1; NCBI: HM007611.1; NCBI: NM_131327.1; NCBI: NM_001020785.2; NCBI: NM_212859.2; NCBI: NM_131031.2) at https://www.ncbi.nlm.nih.gov/; DRD2a: https://www.ncbi.nlm.nih.gov/nuccore/NM_183068.1; Th2: https://www.ncbi.nlm.nih.gov/nuccore/XM_005164734.5; Claudin 5a: https://www.ncbi.nlm.nih.gov/nuccore/NM_213274.1; ZO-1: https://www.ncbi.nlm.nih.gov/nuccore/BI706952.1; All Bifidobacteria: https://www.ncbi.nlm.nih.gov/nuccore/DQ298393.1; All Lactobacillus spp.: https://www.ncbi.nlm.nih.gov/nuccore/AY365115.1; All Enterococcus spp.: https://www.ncbi.nlm.nih.gov/nuccore/HM007611.1; NFE2L2a: https://www.ncbi.nlm.nih.gov/nuccore/NM_182889.1; HMOX1a: https://www.ncbi.nlm.nih.gov/nuccore/NM_001127516.1; KEAP1a: https://www.ncbi.nlm.nih.gov/nuccore/NM_182864.2; IL10: https://www.ncbi.nlm.nih.gov/nuccore/NM_001020785.2; TNF-α: https://www.ncbi.nlm.nih.gov/nuccore/NM_212859.2; Beta-actin: https://www.ncbi.nlm.nih.gov/nuccore/NM_131031.2.

Ethics statement

The animal study was approved by Institutional Ethical Committee under SU/CLAR/RD/001/2023. The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

AR: Conceptualization, Writing – review & editing, Methodology, Investigation, Validation, Formal analysis, Data curation, Writing – original draft, Software. SU: Software, Writing – original draft, Investigation, Formal analysis, Methodology, Writing – review & editing, Data curation. IP: Investigation, Validation, Project administration, Conceptualization, Supervision, Writing – review & editing, Funding acquisition, Resources, Methodology, Writing – original draft, Formal analysis, Software, Data curation, Visualization.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that Generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher's note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.