Abstract
An infection with Helicobacter pylori (H. pylori) can lead to chronic gastritis, which, if not treated, can cause serious gastroduodenal diseases such as gastric mucosa-associated lymphoid tissue lymphoma, gastric cancer, and peptic ulcer. H. pylori infection usually occurs during childhood, and if left untreated, it can persist throughout a person’s lifetime. The main objective of this study was to determine the occurrence of H. pylori infections and the presence of virulence genes such as vacA and cagA. Additionally, the study aimed to investigate the connection between virulence factors and gastroduodenal issues in patients. Several virulent factors play a crucial role in the development of diseases associated with H. pylori. A total of 1308 gastric biopsy specimens were collected from patients with a history of gastritis in 10% normal saline aseptically. Tissue size was measured, and gross examined, which were processed in an automated tissue processor. After processing, the embedding of tissues was done in paraffin wax. 2 to 3 μm sections were prepared using a rotary microtome. Hematoxylin and eosin staining, and immunohistochemistry were performed. DNA was extracted from the tissue of H. pylori and their virulence factors (cagA and vacA) through PCR. Of 1308 biopsies, 374 (28.5%) were H. pylori infections confirmed by hematoxylin and eosin stain and immunohistochemistry. The mean age was 39.5 (± 15.1) years, and the male-to-female ratio was 1:0.9. Among positive samples, gastric samples (260; 69.5%) were taken from the antrum, followed by antrum and body (68; 18.1%), gastric mucosa (26; 7.0%), and body (10; 2.6%). The colonization of H. pylori was classified into three levels: mild (270; 72.2%), moderate (64; 17.1%), and severe (40; 10.7%). Among the antrum, mild active gastritis (78; 30%), and mild chronic active gastritis (60; 23.1%), while in the antrum and body samples, 28 (41.1%) were mild active gastritis (P < 0.0001). 16 S rDNA in biopsy samples of H. pylori isolates. Additionally, in mild gastric colonisation, cagA (103; 27.5%) and vacA (143; 38.2%), and in moderate colonisation, 27 (7.2%) and 24 (6.4%) of cagA and vacA were identified, respectively. There was a high prevalence of H. pylori infection in gastric biopsies with mild colonization, and isolates carried the virulence genes.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-025-34296-6.
Keywords: H. pylori, Gastric biopsies, CagA, VacA, Immunohistochemistry
Subject terms: Microbiology, Gastroenterology
Introduction
Nearly half of the world’s population has Helicobacter pylori (also known as H. pylori) infection, which affects around 4.4 billion people. In industrialized nations, the prevalence rate is 20–40%, but in developing nations, it can reach 90%1. The prevalence of H. pylori infection in children has been declining over the years, as a result of better sanitation and socioeconomic situations2. However, between 2014 and 2020, it was still found to be 34% worldwide. Most H. pylori infections are acquired during infancy and remain indefinitely, which is why older people tend to have a higher frequency of infection compared to children3. These are the primary cause of chronic gastritis and can potentially result in serious gastroduodenal conditions in certain individuals, such as gastric and duodenal peptic ulcer disease (PUD), gastric cancer, and gastric mucosa-associated lymphoid tissue (MALT) lymphoma and if left untreated, the infection can be passed from one generation of children to the next4. Chronic gastritis can manifest itself in various ways depending on the severity of the inflammation in different parts of the stomach. These different phenotypes are classified as antral-predominant, corpus-predominant, or pangastritis5. The most likely mode of transmission is through contaminated water, particularly in underdeveloped nations, while oral-oral transmission is also possible6. It is estimated that around 10% of those infected with H. pylori will experience PUD in their lifetime7. The risk of getting PUD increases to over 11% after 10 years for infected individuals, whereas it is only 1% for healthy individuals8. The diseases associated with H. pylori infection are a result of complex interactions between bacterial virulence, host genetics, and environmental factors9. Two important markers of virulence are vacuolating cytotoxin gene A (vacA) and cytotoxin-associated gene A (cagA), which have been the focus of extensive research10. The vacA toxin regulates the immune system and can cause gastric cancer. On the other hand, cagA is characterized as the first bacterial oncoprotein and is likely the most crucial virulence component of H. pylori11. Moreover, the cagA and vacA genes have been linked to gastrointestinal disorders in Pakistan12. Therefore, the purpose of this study was to examine H. pylori in stomach biopsies collected from the people of Pakistan by Hematoxylin and Eosin stain (H&E), immunohistochemistry (IHC) and molecular detection of associated virulence genes (vacA and cagA).
Materials & methods
Collection of clinical samples
We collected a total of 1,308 stomach samples from different clinical diagnostic institutions located in Lahore and Faisalabad. We used a sterile approach to collect the samples suspected to be associated with gastritis, including the stomach body, antrum, and gastric mucosa. The study aimed to gather endoscopic stomach samples that showed varying degrees of chronic inflammation, such as mild, moderate, or severe. Only the pieces measuring 2.0 mm or larger were considered, whereas the smaller fragments (less than 2.0 mm) and samples that had undergone autolysis were eliminated. After collection, the samples were carefully stored in a 10% formalin solution at a diagnostic clinic and sent to the histopathology lab for further processing.
Isolation and confirmation of the isolates
The tissue samples of everyone under suspicion were subjected to a macroscopic inspection to identify and choose the appropriate part of the tissue for subsequent tissue processing, microscopic analysis, and molecular analysis.
Tissue processing
The tissues were processed using the automated tissue processor Tissue-Tek VIP 6 AI Vacuum Infiltration Process (Sakura®, Japan). The process had four stages: dehydration, clearing, infiltration, and embedding. The temperature was set to 37 °C, and the procedure was conducted under fluctuating pressure conditions, followed by overnight vacuuming. Tissue embedding was performed using paraffin wax in the Tissue-Tek TEC 5 Tissue Embedding Console System (Sakura®, Germany) following the method described by13.
Microtomy
The embedded tissues were sectioned into sections measuring 1 to 3 μm using the Leica RM2125 RTS (Leica Biosystem, Germany). The thin tissue slices were immersed in a warm water bath to eliminate any creases. Subsequently, the slices were carefully transferred onto glass microscope slides and subjected to a drying process in a warm oven.
Haematoxylin and eosin staining
H&E stains were applied to the tissue samples utilizing the Tissue-Tek system (Sakura®, Germany). DPX media was used to mount the stained slides, which were then covered with a thin glass coverslip. The resulting slides were carefully inspected under an Olympus CX31 microscope with 40x magnification.
Immunohistochemistry of H. pylori
A histological section measuring 4 μm in thickness was carefully prepared and fixed onto silane-coated slides (Muto Pure Chemical, Tokyo, Japan). The sections underwent deparaffinization and rehydration processes and were then subject to antigen retrieval utilizing a 10 mM citrate buffer (pH 6.0) at 99 °C for 1 h through a PT Link system (Agilen DAKO, Denmark). To inhibit endogenous enzymes, a peroxidase-blocking reagent (DAKO Kit, Glostrup, Denmark) was employed. Pre-diluted DAKO-pAb was used for incubation with the sections at room temperature in a humidified chamber for 30 min. A secondary biotinylated horse antibody was then applied, specifically recognizing primary rabbit IgG (DAKO Kit, Glostrup, Denmark). To visualize the combination formed between the antibody and antigen, the DAB chromogen from Biocare Medical in Pacheco, California, USA was utilized. Hematoxylin counterstaining was conducted using the AutoStainer-Link 48 instrument manufactured by Dako, Denmark, to visualize the nuclei and overall tissue architecture. The tissue sections were affixed using a DPX mounting medium. The resulting slides were analyzed using a compound microscope (CX 31 Olympus) at a magnification of 40X.
Interpretation of the gastric biopsies was performed by the infiltration of gastric mucosa by mononuclear cells and polymorphonuclear leukocytes, atrophy, and intestinal metaplasia (IM) is graded as follows: 0 for no presence, 1 for slight presence, 2 for moderate presence, and 3 for significant presence. Chronic inflammation is characterized by the elevated presence of lymphocytes and plasma cells in the lamina propria, classified as mild, moderate, or marked based on their density. Chronic active gastritis is characterized by persistent inflammation in the lamina propria, pits, or surface epithelium, with the presence of neutrophilic polymorph infiltration. The classification of H. pylori colonization into mild, moderate, and severe was performed according to the Updated Sydney System. Mild colonization was defined as scattered bacteria in the mucus layer and superficial gastric epithelium, observed in low density. Moderate colonization referred to easily identifiable clusters of bacteria covering parts of the surface, with intermediate density. Severe colonization was characterized by dense, continuous sheets of bacteria covering the mucosal surface and glands. Atrophy is characterized as the depletion of natural glandular tissue, either with or without substitution by intestinal-type epithelium. Lymphoid aggregates are clusters of lymphocytes and plasma cells lacking a germinal center.
Bacterial genomic DNA extraction
Initially, tissue sections were treated with xylene (Sigma-Aldrich™) for the removal of paraffin followed by proteinase K-based tissue digestion. Finally, samples were subjected to an alkaline lysis technique for the extraction of bacterial genomic DNA14.
16 S rDNA
Molecular-based confirmation of H. pylori was done using species-specific primers HPR-F GCGACCTGCTGGAACATTAC and HPR-R CGTTAGCTGCATTACTGGAGA in PCR.
Molecular detection of CagA and VacA gene
Molecular identification of cagA and vacA was done using specific primers; cagA1-F GGTCAAAATGCGGTCATGG and cagA1-R TTAGAATAATCAACAAACATCACGCCAT, cagA2-F AATACACCAACGCCTCCAAG and cagA2-R TTGTTGCCGCTTGCTCTC vacAm2-F GGAGCCCCAGGAAACATTG and vacAm2-R CATAACTAGCGCCTTGCAC by following conditions; initial denaturation: 95 °C for 3 min, secondary denaturation: 95 °C for 30 s, annealing: 55 °C for 30 s, primary extension: 72 °C for 30 s and final extension: 72 °C for 10 min. Amplicons were separated on ethidium bromide-stained 1.5% agarose gel using gel electrophoresis (Bio-Rad, UK) and DNA bands were visualized under UV light using the Gel Documentation system.
Results
Clinical information of the patients
According to the biopsy analysis of 1,308 samples, 374 (28.5%) showed positive results for H. pylori infection, while the remaining 934 (71.4%) tested negative. The age range of patients with positive cases was between 13 and 73 years, with a mean age of 39.5 (± 15.1) years. For negative cases, the age range was 12 to 85 years, with a mean age of 40.5% (± 15.7) years. The male-to-female ratio was 1:0.9. Amon the positive samples, most of the biopsy samples were collected from the antrum (260; 69.5%), while a combination of antrum and body (72; 19.2%), gastric mucosa (28; 7.4%), and body alone (10; 2.6%) samples were also collected. However, most of the negative results came from 614 (65.7%) samples obtained from the antrum, 214 (22.9%) samples from both the antrum and body and 52 (5.5%) samples from the body alone (Table 1).
Table 1.
Clinical history of the patients.
| H. pylori-positive (n = 374; 28.5%) | H. pylori-negative (n = 934; 71.4%) | p-value | |||
|---|---|---|---|---|---|
| n | % | n | % | ||
| Age (Years) | |||||
| Range | 13–73 | 12–85 | |||
| Mean (± SD) | 39.5 (± 15.1) | 40.5 (± 15.7) | 0.285 | ||
| Gender | |||||
| Male | 190 | 50.8 | 500 | 53.5 | 0.37 |
| Female | 184 | 49.2 | 434 | 46.5 | |
| Male to female ratio | 1:0.9 | 1:0.8 | |||
| Source of samples | |||||
| Antrum | 260 | 69.5 | 614 | 65.7 | 0.21 |
| Antrum and body | 72 | 19.2 | 214 | 22.9 | 0.16 |
| Stomach body | 10 | 2.6 | 52 | 5.5 | 0.04 |
| Gastric mucosa | 28 | 7.4 | 46 | 4.9 | 0.09 |
| Prepyloric | 2 | 0.5 | 2 | 0.2 | 0.69 |
| Pylorus | 2 | 0.5 | 4 | 0.4 | 0.9 |
| Antrum, body, and duodenum | 0 | 0 | 2 | 0.2 | - |
Age and gender base distribution of samples
From the 1308 biopsy samples obtained, 690 (52.7%) were from male patients and 618 (47.2%) were from female patients. There were no cases of H. pylori infection detected in children under the age of 10. Among the male patients, 130 (18.8%) were aged between > 40-≤50 years, 126 (18.2%) were between > 30-≤40 years, 122 (17.6%) were between > 20-≤30 years, and 94 (13.6%) were between > 50-≤60 years. However, there were 10 individuals (1.4%) aged between > 70-≤80 years, and 11 individuals (1.6%) aged over 80 years. Out of the total female population, 29.7% (184 out of 618) samples were obtained from the groups aged between 20-≤30 years and > 30-≤40 years. Additionally, 15.6% (108 samples) were obtained from the > 40-≤50 years age group and 13.9% (86 samples) were obtained from the > 50-≤60 years age group. However, 22 individuals (3.5%) aged between > 70-≤80 years, and 16 individuals (2.6%) aged over 80 years were observed (Fig. 1).
Fig. 1.
Age and gender-wise distribution of clinical samples.
Histological confirmation of H. pylori by H&E and IHC
In this investigation, 1308 biopsy samples were collected and out of those, 374 (28.6%) were found to be positive for H. Pylori through H&E and IHC staining. Among positive samples, most of the gastric samples (260; 69.5%) were taken from the antrum, followed by the antrum and body (68; 18.1%), the gastric mucosa (26; 7.0%), and the body (10; 2.6%). The colonization of H. pylori was classified into three levels: mild (270; 72.2%), moderate (64; 17.1%), and severe (40; 10.7%). Among antrum (n = 260; 69.5%), H. pylori were primarily found in mild active gastritis (78; 30%), mild chronic active gastritis (60; 23.1%), and moderate active gastritis (36; 13.8%). In the antrum and body (68; 18.1%), mild chronic active gastritis (28; 41.1%), mild active gastritis (10; 14.7%) and moderate chronic active gastritis (10; 14.7%). However, among body samples (10; 2.6%), mild chronic active gastritis was 4 (40%). Among the gastric mucosa (n = 26, 7.0%), unremarkable gastric mucosa in 12 (46.1%) in severe colonization. There was a statistically significant association between gastric biopsies and H. pylori infection (P < 0.0001) (Table 2; Figs. 2A, amp and B, 3A, amp and B, 4A, amp and B and 5).
Table 2.
Prevalence of H. pylori colonisation in gastric biopsies.
| Sources | Antrum (n=260, 69.5%) | Antrum & body (n=68, 18.1%) | ||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Diagnosis | Chronic active gastritis | Clinical suspicion of malignancy is high | Mild active gastritis | Mild chronic active gastritis | Mild chronic active gastritis | Mild chronic non-specific gastritis | Mild degree of moderate active gastritis | Mild gastritis | Mild to moderate active gastritis | Moderate active gastritis | Moderate chronic gastritis | Chronic active gastritis | Mild chronic active gastritis | Severe active gastritis | Severe chronic active gastritis | Clinical suspicious of malignancy | High-grade dysplasia | Moderate to severe active gastritis | Active gastritis | Severe gastritis | Sever active gastritis | Chronic active gastritis | Mild chronic active gastritis | Mild active gastritis | Moderate chronic active gastritis | Moderate active gastritis | Sever active gastritis | Mild chronic gastritis |
| Mild colonization (n=270, 72.2%) | 8 | 0 | 78 | 60 | 0 | 2 | 0 | 4 | 4 | 36 | 8 | 0 | 0 | 2 | 2 | 2 | 0 | 0 | 0 | 0 | 0 | 2 | 10 | 28 | 10 | 0 | 0 | 2 |
| Moderate colonization (n=64, 17.1%) | 0 | 0 | 2 | 0 | 4 | 0 | 0 | 2 | 0 | 28 | 0 | 0 | 0 | 2 | 0 | 0 | 2 | 2 | 0 | 0 | 0 | 0 | 0 | 10 | 2 | 2 | 0 | 0 |
| Sever colonization (n=40, 10.7%) | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 2 | 2 | 2 | 0 | 0 | 0 | 0 | 2 | 2 | 0 |
| Total | 8 | 0 | 80 | 60 | 4 | 4 | 0 | 6 | 4 | 66 | 8 | 0 | 0 | 6 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 10 | 38 | 12 | 4 | 2 | 2 |
| <0.00001* | ||||||||||||||||||||||||||||
*The chi-square statistic is 184.8984. The P-value is < 0.00001. The result is significant at p < .05.
Fig. 2 .
A shows the normal gastric mucosa indicated by the black arrows in H&E staining, while Fig. 2B depicts the normal gastric mucosa in IHC staining as black arrows indicated.
Fig. 3.
A shows mild H. pylori colonization indicated by black arrows in the H&E stain, while B shows mild colonization highlighted by yellow arrows in the IHC stain.
Fig. 4.
A shows moderate H. pylori colonization indicated by yellow arrows in the H&E stain, while B shows moderate colonization highlighted by yellow arrows in the IHC stain.
Fig. 5.
Shows the sever H. pylori colonization indicated by black arrows in IHC.
Molecular detection of cagA and vacA of H. pylori.
The presence of 16 S rDNA in biopsy samples confirmed that 374/1308 (28.5%) H. pylori isolates were confirmed as presented in Supplementary Figure S1. Additionally, virulence genes such as cagA and vacA were identified as presented in Supplementary Figure S2. For mild gastric colonisation, 103 (27.5%) and 143 (38.2%) of the cagA and vacA virulence genes were found, respectively. In moderate colonisation, 27 (7.2%) and 24 (6.4%) of the cagA and vacA were identified, while in severe colonisation, 17 (4.5%) and 22 (5.9%) of the cagA and vacA were detected. Moreover, 24 (6.4%) of the cagA and vacA co-existed in moderate colonisation, and 7 (1.9%) of each virulent genes co-existed in severe colonisation (Table 3).
Table 3.
Coexistence of CagA and VacA virulent genes of H. pylori in gastric biopsies.
| Severity | cagA+/vacA- | cagA-/vacA+ | cagA+/vacA+ |
|---|---|---|---|
| Mild | 103 (27.5%) | 143 (38.2%) | 24 (6.4%) |
| Moderate | 27 (7.2%) | 24 (6.4%) | 7 (1.9%) |
| Severe | 17 (4.5%) | 22 (5.9%) | 7 (1.9%) |
Discussion
H. pylori is becoming a serious public health concern particularly to cause gastric cancer15. It continues to be a major threat to human and environmental health worldwide, even in developed countries16. Historically, these illnesses have been linked to high rates of illness and death, particularly in countries with low per capita incomes and large populations living in poverty17. To effectively treat gastrointestinal issues, it is crucial to accurately diagnosed H. pylori infection. Among the various procedures developed, the most precise way to diagnose H. pylori is through direct detection of the bacteria in the stomach mucosa18. In this study total of 1308 biopsies were collected from the antrum, antrum & and body, gastric, and body followed by pylorus. In the present study, we have observed that out of 1308 biopsy samples, most of the gastric biopsies from the male patients were 690 (52.7%) compared to females. In the male patients, most of them 130 (18.8%) were collected from the age between > 40-≤50 years and 126 (18.2%) were between > 30-≤40 years. However, in females, 184 (29.7%) samples were from the age group between 20-≤30 years and > 30-≤40 years. A study conducted in Norway they have found a low prevalence of H. pylori infection in children (0.6%) and a high of 20%−45% in adolescent age19. Recently a 10-year comprehensive study on atrophic gastritis caused by H. pylori infection in different age groups revealed that most of the infection was present in male patients compared to females however most of the gastritis cases were found in > 80 years followed by 70years and 6o years while lowest prevalence was observed in children. According to documented evidence, retrospective cohort research found that spontaneous clearance occurred in 9 out of 58 children, which accounts for 15.5% of the total, over a 20-year follow-up period20. However, several global published studies reported that the frequency of H. pylori infection among adults has decreased significantly over the years, dropping from 50 to 55% in 2014 to 43% in 2020. This reduction can mostly be attributed to the improvement in sanitation, income, and living conditions. Additionally, the increased use of antibiotics, particularly in eradication therapy for infected individuals, might have contributed to the decrease in cases2,21–24. The findings of our study are consistent with global evidence highlighting H. pylori as a persistent public health concern due to its role in chronic gastritis and gastric cancer development. In the present study out of all the gastric samples collected, 69.5% of them were from the antrum, while 18.1% were from antrum and body samples. The degree of H. pylori colonisation was mild in 72.2% of cases, moderate in 17.1%, and severe in 10.7% (P-value-<0.00001). A study from Iran determined the correlation of H. pylori with colonisation they revealed that 203 (37.32%) had mild gastritis, 278 (10.51%) moderate, and 16 (2.94%) severe. Mild H. pylori colonization rates had the highest mild activity (33.52%), whereas severe colonization rates had the most severe activity (43.75%). 93.96% of severe H. pylori colonization patients had moderate and severe chronic gastritis25. However, Another study from Tunisia found that 43% of patients exhibited mild H. pylori colonization, 47% moderate, and 9% severe colonization26. Globally, the distribution of H. pylori virulence factors has shown marked variability across regions, influenced by host genetics, environmental factors, and bacterial strain diversity. Gastric cancer is most strongly correlated with long-term infection with H. pylori cagA-positive strains27. Further, H. pylori releases a toxic substance called vacA, which can induce various effects on human cells28. In this study, the prevalence of cagA (27.5%) and vacA (38.2%) in H. pylori was predominantly observed in cases of mild gastric colonization. Further, 27 (7.2%) and 24 (6.4%) were found to be cagA and vacA, in moderate colonization respectively. A study conducted in Pakistan found that the vacA gene was present in 54.5% of the cases, while the cagA gene was positive in 24.2% of the cases12. A study in Iran found that 79% of H. pylori samples were positive for cagA. Additionally, the most common combination of vacA alleles was observed in 63 cases of H. pylori isolates29. Out of 192 clinical H. pylori strains identified in a study conducted in China, cagA was detected in all cases of gastric illnesses, representing 87% of the strains30. Further, there are several studies reported from other parts of the world including Japan31, Vietnam32, Algeria33, and Thailand34.
These findings highlight the importance of monitoring H. pylori virulence factors as part of gastric disease surveillance. The prevalence of the cagA and vacA in cases of mild colonization suggests that these genes could serve as early indicators of pathogenicity. This underscores the necessity for timely diagnosis and eradication therapy to prevent the progression of chronic gastritis and gastric cancer. Furthermore, by comparing our results to international studies, we emphasize the global relevance of our work and reinforce the significance of H. pylori as a critical health challenge, even in developed countries.
Conclusion
This study concluded the high prevalence of H. pylori infection in the Pakistani dyspeptic population through H&E and IHC techniques. Further, our analysis shows that vacA and cagA were the most common virulent genes typically associated with mild moderate and severe gastritis. On the other hand, patients with vacA and cagA genes also displayed gastritis. The advanced molecular approaches have become reliable tools for characterizing virulent strains of H. pylori due to their growing sensitivity and specificity. To predict the severity of a disease, it is necessary to identify the environmental and host factors along with the bacterial characteristics.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
The authors would like to extend their sincere appreciation to the Institute of Microbiology, Government College University Faisalabad, Pakistan and extend appreciation to the Deanship of Scientific Research and Graduate Studies at King Khalid University for funding this work through the Large Research Project under grant number RGP2/40/47. The authors would like to extend their sincere appreciation to the Ongoing Research Funding Program (ORF-2026-437), King Saud University, Riyadh, Saudi Arabia.
Abbreviations
- H. pylori
Helicobacter pylori
- vacA
vacuolating cytotoxin gene A
- cagA
Cytotoxin-associated gene A
- H&E
Hematoxylin and Eosin stain
- IHC
Immunohistochemistry
- PUD
Peptic ulcer disease
- MALT
Mucosa-associated lymphoid tissue
Author contributions
All authors contributed to the study conception; the design was developed by A.R., M.U.Q; Z.T., and M.S. Analysis and interpretation of data was undertaken by A.R; M.U.Q; K.J; S.M; Z.T; A.A; M.A.N. The manuscript was drafted by A.R; A.A; MB; and T.A.S; while revisions were made by M.U.Q; M.A.N; D.O.A. A.A; S.M; E.M.A; prepared all figures. Funding and resources were provided by AMS, TAS. All authors, A.R; Z.T; D.S.A; M.S; D.O.A; K.J; A.A; S.M; Z.T; T.A.S; K.A.A; E.M.A; and M.U.Q read and approved the final manuscript.
Funding
This work is financially supported by the Deanship of Scientific Research and Graduate Studies at King Khalid University through the Large Research Project under grant number RGP2/40/47. This work is financially supported by the Ongoing Research Funding Program (ORF-2026-437), King Saud University, Riyadh, Saudi Arabia.
Data availability
All data generated or analyzed during this study are included in this published article.
Declarations
Competing interests
The authors declare no competing interests.
Ethical consideration
The Ethical Review Committee (ERC) at the Government College University Faisalabad approved the study. All methods were performed in accordance with the Declaration of Helsinki.
Informed consent
was obtained from all participants. The relevant information was explained to the participants in a language that they could understand. Each participant willingly gave a specimen for examination and permission for the isolates collected to be used in the study. Furthermore, participants were assured that their private information would be kept confidential and that the samples they provided would only be used for research purposes.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Khoder, G., Muhammad, J. S., Mahmoud, I., Soliman, S. S. M. & Burucoa, C. Prevalence of Helicobacter pylori and its associated factors among healthy asymptomatic residents in the united Arab Emirates. Pathogens810.3390/pathogens8020044 (2019). [DOI] [PMC free article] [PubMed]
- 2.Park, J. S., Jun, J. S., Seo, J. H., Youn, H. S. & Rhee, K. H. Changing prevalence of Helicobacter pylori infection in children and adolescents. Clin. Experimental Pediatr.64, 21–25. 10.3345/cep.2019.01543 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Borka Balas, R., Meliț, L. E. & Mărginean, C. O. Worldwide prevalence and risk factors of Helicobacter pylori infection in children. Child. (Basel). 910.3390/children9091359 (2022). [DOI] [PMC free article] [PubMed]
- 4.Malfertheiner, P. et al. Helicobacter pylori infection. Nat. Reviews Disease Primers. 9, 19. 10.1038/s41572-023-00431-8 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Watari, J. et al. Helicobacter pylori associated chronic gastritis, clinical syndromes, precancerous lesions, and pathogenesis of gastric cancer development. World J. Gastroenterol.20, 5461–5473. 10.3748/wjg.v20.i18.5461 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Aziz, R. K., Khalifa, M. M. & Sharaf, R. R. Contaminated water as a source of Helicobacter pylori infection: A review. J. Adv. Res.6, 539–547. 10.1016/j.jare.2013.07.007 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Narayanan, M., Reddy, K. M. & Marsicano, E. Peptic ulcer disease and Helicobacter pylori infection. Mo. Med.115, 219–224 (2018). [PMC free article] [PubMed] [Google Scholar]
- 8.Xie, X., Ren, K., Zhou, Z., Dang, C. & Zhang, H. The global, regional and National burden of peptic ulcer disease from 1990 to 2019: a population-based study. BMC Gastroenterol.22, 58. 10.1186/s12876-022-02130-2 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Baj, J. et al. Helicobacter pylori virulence Factors-Mechanisms of bacterial pathogenicity in the gastric microenvironment. Cells1010.3390/cells10010027 (2020). [DOI] [PMC free article] [PubMed]
- 10.Idowu, A. et al. Detection of Helicobacter pylori and its virulence genes (cagA, dupA, and vacA) among patients with gastroduodenal diseases in Chris Hani Baragwanath academic Hospital, South Africa. BMC Gastroenterol.19, 73. 10.1186/s12876-019-0986-0 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ansari, S. & Yamaoka, Y. Helicobacter pylori virulence factors exploiting gastric colonization and its pathogenicity. Toxins (Basel). 1110.3390/toxins11110677 (2019). [DOI] [PMC free article] [PubMed]
- 12.Ahmad, T. et al. Prevalence of Helicobacter pylori pathogenicity-associated CagA and VacA genotypes among Pakistani dyspeptic patients. FEMS Immunol. Med. Microbiol.55, 34–38. 10.1111/j.1574-695X.2008.00492.x (2009). [DOI] [PubMed] [Google Scholar]
- 13.Chen, Y. J. et al. An introduction of an easy-operating and economical technique for tissue microarray Preparation. J. Clin. Pathol.73, 403–407 (2020). [DOI] [PubMed] [Google Scholar]
- 14.Nocera, A. L. et al. Cystatin SN is a potent upstream initiator of epithelial-derived type 2 inflammation in chronic rhinosinusitis. J. Allergy Clin. Immunol.150, 872–881 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Reyes, V. E. Helicobacter pylori and its role in gastric cancer. Microorganisms1110.3390/microorganisms11051312 (2023). [DOI] [PMC free article] [PubMed]
- 16.Öztekin, M., Yılmaz, B., Ağagündüz, D. & Capasso, R. Overview of Helicobacter pylori infection: clinical Features, Treatment, and nutritional aspects. Dis. (Basel Switzerland). 910.3390/diseases9040066 (2021). [DOI] [PMC free article] [PubMed]
- 17.Khalifa, M. M., Sharaf, R. R. & Aziz, R. K. Helicobacter pylori: a poor man’s gut pathogen? Gut Pathogens. 2 (2). 10.1186/1757-4749-2-2 (2010). [DOI] [PMC free article] [PubMed]
- 18.Talebi, B. & Abadi, A. Diagnosis of Helicobacter pylori Using Invasive and Noninvasive Approaches. J Pathog 9064952, (2018). 10.1155/2018/9064952 (2018). [DOI] [PMC free article] [PubMed]
- 19.Breckan, R. K. et al. The All-Age Prevalence of Helicobacter pylori Infection and Potential Transmission Routes. A Population-Based Study. Helicobacter 21, 586–595, (2016). 10.1111/hel.12316 [DOI] [PubMed]
- 20.Malaty, H. M. et al. Age at acquisition of Helicobacter pylori infection: a follow-up study from infancy to adulthood. Lancet359, 931–935. 10.1016/s0140-6736(02)08025-x (2002). [DOI] [PubMed] [Google Scholar]
- 21.Hooi, J. K. Y. et al. Global prevalence of Helicobacter pylori infection: systematic review and Meta-Analysis. Gastroenterology153, 420–429. 10.1053/j.gastro.2017.04.022 (2017). [DOI] [PubMed] [Google Scholar]
- 22.Liou, J. M. et al. Screening and eradication of Helicobacter pylori for gastric cancer prevention: the Taipei global consensus. Gut69, 2093–2112. 10.1136/gutjnl-2020-322368 (2020). [DOI] [PubMed] [Google Scholar]
- 23.Parsonnet, J. et al. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl. J. Med.325, 1127–1131. 10.1056/nejm199110173251603 (1991). [DOI] [PubMed] [Google Scholar]
- 24.Eusebi, L. H., Zagari, R. M. & Bazzoli, F. Epidemiology of Helicobacter pylori infection. Helicobacter19 (Suppl 1), 1–5. 10.1111/hel.12165 (2014). [DOI] [PubMed] [Google Scholar]
- 25.Ghasemi Basir, H. R., Ghobakhlou, M., Akbari, P. & Dehghan, A. & Seif Rabiei, M. A. Correlation between the Intensity of Helicobacter pylori Colonization and Severity of Gastritis. Gastroenterology research and practice 8320496, (2017). 10.1155/2017/8320496 (2017). [DOI] [PMC free article] [PubMed]
- 26.Souissi, S., Makni, C., Belhadj Ammar, L., Bousnina, O. & Kallel, L. Correlation between the intensity of Helicobacter pylori colonization and severity of gastritis: results of a prospective study. Helicobacter27, e12910. 10.1111/hel.12910 (2022). [DOI] [PubMed] [Google Scholar]
- 27.Park, J. Y., Forman, D., Waskito, L. A., Yamaoka, Y. & Crabtree, J. E. Epidemiology of Helicobacter pylori and CagA-Positive infections and global variations in gastric cancer. Toxins10, 163 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Necchi, V. et al. Natural history of Helicobacter pylori VacA toxin in human gastric epithelium in vivo: vacuoles and beyond. Sci. Rep.7, 14526. 10.1038/s41598-017-15204-z (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ghotaslou, R. et al. Diversity of Helicobacter pylori CagA and VacA genes and its relationship with clinical outcomes in Azerbaijan, Iran. Adv. Pharm. Bull.3, 57–62. 10.5681/apb.2013.010 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Qiao, W. et al. CagA and VacA genotype of Helicobacter pylori associated with gastric diseases in xi’an area. World J. Gastroenterol.9, 1762–1766. 10.3748/wjg.v9.i8.1762 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Yamazaki, S. et al. Distinct diversity of vacA, cagA, and cage genes of Helicobacter pylori associated with peptic ulcer in Japan. J. Clin. Microbiol.43, 3906–3916. 10.1128/jcm.43.8.3906-3916.2005 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Phan, T. N. et al. Genotyping of Helicobacter pylori shows high diversity of strains Circulating in central Vietnam. Infect. Genet. Evol.52, 19–25. 10.1016/j.meegid.2017.04.014 (2017). [DOI] [PubMed] [Google Scholar]
- 33.Bachir, M. et al. Primary antibiotic resistance and its relationship with < span class=elsevierStyleItalic>cagA and < span class=elsevierStyleItalic>vacA genes in < span class=elsevierStyleItalic>Helicobacter pylori isolates from Algerian patients. Brazilian J. Microbiol.49, 544–551. 10.1016/j.bjm.2017.11.003 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Chomvarin, C. et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, IceA and babA2 genotypes in Thai dyspeptic patients. Int. J. Infect. Dis.12, 30–36. 10.1016/j.ijid.2007.03.012 (2008). [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data generated or analyzed during this study are included in this published article.





