Effect of neurotrophin-3 on bone healing in distraction osteogenesis

ABSTRACT

Distraction osteogenesis (DO) is a surgical technique used to repair skeletal defects by promoting bone and soft tissue regeneration. However, prolonged use of external fixators often causes complications such as infections and joint contractures. Neurotrophin-3 (NT-3) enhances osteoblast differentiation via bone morphogenetic protein-2 (BMP-2) and Akt signaling and may also modulate the Wnt/β-catenin pathway. In this study, we investigated the role of NT-3 in bone regeneration during DO. A DO model was established in 9-week-old male ICR mice, in which tibiae were osteotomized and stabilized with external fixators under anesthesia. After a 5-day latency period, distraction was performed at 0.2 mm every 12 hours for 8 days. RNA was extracted at defined time points post-osteotomy for quantitative polymerase chain reaction (qPCR) analysis, and NT-3 was administered post-distraction. Bone regeneration was evaluated by radiographic, histological, and biomechanical analyses. The effects of NT-3 and Dickkopf-1 were further examined in ST2 bone marrow–derived mesenchymal stem cells. NT-3 significantly enhanced bone formation, increased bone mineral density within the DO gap, and improved the mechanical stiffness of regenerated bone. Histological examination revealed earlier bone continuity and greater callus formation in the NT-3 group. Gene expression analysis demonstrated upregulation of Wnt/β-catenin pathway components, including Wnt10b, β-catenin, and low-density lipoprotein receptor-related protein 5 (LRP5). In ST2 cells, NT3 increased the expression of LRP5, LRP6, β-catenin, and Runx2, while cotreatment with Dickkopf1 abolished these effects. These findings suggest that NT-3 promotes bone regeneration during DO by activating the Wnt/β-catenin signaling pathway, highlighting its therapeutic potential to improve DO outcomes.

INTRODUCTION

Distraction osteogenesis (DO) is an established surgical technique for correcting deformities, defects, and discrepancies in bone length in the limbs and craniofacial region. The procedure involves three distinct phases: latency, distraction, and consolidation. During the latency phase, osteotomy is performed, and the two bone segments are stabilized using an external fixator. In the active distraction phase, the bone segments are gradually separated, creating a gap that serves as the site for new bone formation.¹ This process promotes angiogenesis and mobilizes endogenous mesenchymal stem cells² and progenitor cells.³ Furthermore, numerous growth factors are secreted, which initiate osteogenesis⁴ and lead to callus formation between the bone segments. In the consolidation phase, the newly formed bone undergoes remodeling and gradually matures. The DO technique is groundbreaking because it enables the generation of a substantial amount of bone tissue and facilitates soft tissue regeneration.¹ There has been growing interest in elucidating the biological mechanisms underlying bone regeneration during DO, particularly the roles of cytokines and cells within the distraction gap.^5,6

Bone healing is closely associated with blood flow restoration.⁷ Following bone injury, the vascular network is reconstructed, allowing the delivery of nutrients and reparative cells that support tissue repair. Furthermore, nerves extend to the site of bone injury before vascularization, suggesting a role for nerves in bone healing.^8,9 However, compared to the established role of blood vessels in the bone healing process, the role of nerves remains poorly understood.

Cytokines that act on bone and nerves can be broadly classified into three categories based on their functions: neurotrophic factors, neurotransmitters, and axon guidance molecules.¹⁰ Neurotrophic factors are involved in the extension of neuronal processes¹¹ and the survival and growth of cells. Moreover, neurotrophic factors may play a significant role in healing bone injuries.

One such neurotrophic factor, neurotrophin-3 (NT-3), was first reported in 1990 by Hohn et al and Maisonpierre et al as the third member of the neurotrophic factor family, following nerve growth factor and brain-derived neurotrophic factor.^12,13 NT-3 facilitates regeneration of damaged peripheral nerves¹⁴ and promotes bone healing by acting on mesenchymal stem cells and pre-osteoblasts.¹⁵ However, the precise mechanisms by which NT-3 supports bone healing remain unclear.

Several signaling pathways involved in osteoblast differentiation have been identified, including bone morphogenetic protein (BMP), Wnt, Hippo, fibroblast growth factor, Hedgehog, and NOTCH pathways.¹⁶ Previous studies have demonstrated that NT-3 promotes bone healing via BMP-2 signaling¹⁵ and the Akt signaling pathway.¹⁷ Akt is activated intracellularly upon binding of external signals to cell membrane receptors. Activated Akt inhibits Gsk-3β, thereby increasing free β-catenin levels and enhancing transcriptional activity related to bone differentiation.¹⁸ This signaling cascade overlaps with the canonical Wnt pathway.

The canonical Wnt pathway, also known as the Wnt/β-catenin pathway, is a critical signaling cascade involved in cell fate determination, tissue development, and regeneration. This pathway functions by stabilizing β-catenin in the cytoplasm after the binding of Wnt ligands to receptors, allowing β-catenin to translocate into the nucleus and regulate the expression of specific target genes.¹⁹ The Wnt/β-catenin pathway is also crucial in bone formation and metabolism, as it contributes to osteoblast differentiation and maturation, as demonstrated in numerous studies.¹⁶ The Wnt/β-catenin pathway is one of the key signaling pathways involved in bone healing during DO. However, no studies have investigated the effects of NT-3 on this pathway in the context of DO.

In this study, we aimed to elucidate the role of NT-3 administration during the DO process and to investigate whether the Wnt/β-catenin signaling pathway is involved in its effects.

MATERIALS AND METHODS

Mouse tibia DO model

Male ICR mice (9 weeks old; Japan SLC, Hamamatsu, Japan) were used for this study. All animal experiments were reviewed and approved by the Animal Care and Use Committee of Nagoya University School of Medicine (Approval No. 240347-002) and conducted in accordance with institutional and national guidelines.

The mice were housed in a temperature-controlled facility under a 12-hour light/dark cycle with ad libitum access to food and water. The surgical DO procedure was performed based on previously described protocols.²⁰ For anesthesia, a combination of medetomidine hydrochloride (0.3 mg/kg), midazolam (4 mg/kg), and butorphanol tartrate (5 mg/kg) was administered intraperitoneally. After shaving and disinfecting the right hind limb with iodine solution, an anterior longitudinal incision was made, and the muscles were carefully separated while preserving the periosteum. The tibia was stabilized using a custom-made external fixator, which was secured proximally with 25-gauge needles and distally with 27-gauge needles, and fixed in place with acrylic resin (Fig. 1A).

Fig. 1.

Surgical procedures and DO schedule in the DO model

Fig. 1A: Photograph of an external fixator applied to the right tibia of a mouse.

Fig. 1B: DO schedule. Distraction was performed at 0.2 mm × 2/day for 8 days. Black triangles indicate the time points of sacrifice, and white triangles indicate NT-3 administration.

AD: distraction phase

CO: consolidation phase

DO: distraction osteogenesis

LA: latency phase

NT-3: neurotrophin-3

After the resin polymerized, a mid-diaphyseal osteotomy was performed using a thin cutting disc, followed by wound closure with 6–0 nylon sutures. Distraction commenced after a 5-day latency period and was performed at a rate of 0.2 mm every 12 hours for 8 days (Fig. 1B).

NT-3 local administration

Based on previous reports²¹ and the results obtained from our preliminary experiments, the dose of NT-3 was set at 0.5 µg (Fig. S1). After completion of the active distraction period, NT-3 (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) was dissolved in 20 µL of phosphatebuffered saline (PBS). The injection site within the distracted callus was determined by palpation during needle insertion. A single dose was injected into the distraction zone 1 day after the completion of distraction, followed by a second injection on the next day. The control group received PBS alone. The animals were sacrificed by cervical dislocation on days 20, 27, and 83 after osteotomy.

Gene expression analysis during DO

NT-3 and tropomyosin receptor kinase C (TrkC) gene expression were analyzed on days 1, 5, 9, 13, and 20 after osteotomy. Six mice were used at each time point, and untreated mice served as controls. Total RNA was extracted from tibial samples at each time point using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. Complementary DNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (FSQ-301; Toyobo, Osaka, Japan). Quantitative real-time polymerase chain reaction (PCR) was performed using the Alia MX system (Agilent Technologies, Santa Clara, CA, USA) with THUNDERBIRD SYBR qPCR Mix (QPS-201; Toyobo). The relative expression levels of the target genes were calculated using the 2^-ΔΔCT method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the reference gene. Expression levels in the control group were normalized to 1.

Gene expression analysis after NT-3 administration

Additionally, on day 16, the expression levels of each gene after NT-3 administration were analyzed using the same method, with the PBS group serving as a control. The primers used in these experiments are shown in Table 1.

Table 1.

List of primers

Origin	Primer	Sequence (forward 5′-3′)	Sequence (reverse 5′-3′)
Mouse	GAPDH	GAACGGATTTGGCCGTATTG	AATGAAGGGGTCGTTGATGG
Mouse	NT-3	GCAACAGCATGGATCAAAGG	CCACCATCTGTTTGGAAAGC
Mouse	TrkC	GATCCTCGTGGATGGACAGC	CATGCCCGAGGCTATCTGAC
Mouse	Wnt5a	CAGCCCTGCTTTGGATTGTC	AGCCACTCCCGGGCTTAATA
Mouse	Wnt10b	GTGGATCCTGCACCTGAACC	CCCGACTGAACAAAGCCAAG
Mouse	LRP5	TTCACACTGCTGGGGGACTT	CTGGCCTTGACCTTGTGGAC
Mouse	LRP6	CCTCACCCCAGGCCTAAAAC	TTGAGGCCCAAAGTCCTTGA
Mouse	FZD4	ATGTGCCAGAACCTCGGCTA	ATGAGCGGCGTGAAAGTTGT
Mouse	RUNX2	CCCAGCCACCTTTACCTACA	TATGGAGTGCTGCTGGTCTG
Mouse	β-catenin	ACCTTTCAGATGCAGCGACT	TATCATCGGAACCCAGAAGC

GAPDH: glyceraldehyde-3-phosphate dehydrogenase

FZD: frizzled

LRP: low-density lipoprotein receptor-related protein 5

NT-3: neurotrophin-3

RUNX2: runt-related transcription factor 2

TrkC: tropomyosin receptor kinase C

Radiographic analyses

On days 20, 27, and 83 post-osteotomy, the sacrificed mice were perfused with 4% paraformaldehyde, and the lower limbs were harvested. Tibial segments undergoing DO were scanned using a micro-computed tomography (micro-CT) system (SkyScan1176; Bruker, Billerica, MA, USA) equipped with a 1-mm Al filter and a voxel size of 0.9 µm. Image reconstruction was performed using SkyScan NRecon software, and three-dimensional analyses were conducted using SkyScan CTAn software in accordance with the manufacturer’s instructions. The region of interest was defined as a cylindrical volume between the proximal and distal tibia, based on previous studies.²⁰ Bone volume/tissue volume (BV/TV) ratio, and bone mineral density (BMD) were quantified.

Histological analyses

Samples were collected on days 20 and 27, including approximately 3 mm each from the proximal and distal tibial segments. The samples were defatted in 90% ethanol, decalcified using K-CX solution (Pharma Corporation, Japan), and embedded in paraffin. Serial sections 5 µm thick were prepared using a microtome (CM3050S, Leica Biosystems) and stained with hematoxylin and eosin (H&E). Newly formed bone was observed under a microscope (BZ-X800, KEYENCE) and quantitatively evaluated using ImageJ software (National Institutes of Health, version 1.53k). The distraction zone was defined as the area enclosed in a quadrangle, with its four end points corresponding to the osteotomy lines. The cartilage- and bone-formation areas were calculated using the following equation: newly formed cartilage area (%) = (new cartilage area/distraction zone) × 100.

Biomechanical testing

Three-point bending tests were performed using an MZ-500S mechanical testing machine (Marutoh Tokyo, Japan) at the Kureha Analysis Center (Fukushima, Japan). Samples were shipped frozen with the periosteum removed. The distance between the fulcrums was set to 4 mm, and the load was applied at a rate of 2 mm/min. Maximum load (N) and stiffness (N/mm) were recorded for each specimen.

Gene expression in mouse bone marrow–derived mesenchymal stem cells

Mouse bone marrow–derived mesenchymal stem cells (ST2), obtained from RIKEN BRC (Ibaraki, Japan), were cultured in RPMI-1640 medium (Wako) supplemented with 10% fetal bovine serum (FBS; Wako) and 1% penicillin/streptomycin (Wako) at 37 °C in a humidified atmosphere containing 5% CO₂. Cells from passages four to six were used for experiments. ST2 cells were seeded at a density of 2.0 × 10⁵ cells/100-mm dish and cultured until 80% confluency. The cells were divided into three groups: PBS-treated, NT-3-treated, and NT-3 + Dickkopf-related protein 1 (DKK1, Wnt/β-catenin receptor inhibitor)–treated groups, and incubated for 24 hours. The concentrations of NT-3 used in this experiment were determined based on previous studies,¹⁵ with 100 ng/mL used in subsequent experiments. Accordingly, the same concentration of DKK1 was used. Complementary DNA synthesis and gene expression analysis were performed using the same methods as described for the mouse experiments.

Statistical analyses

All statistical analyses were conducted using SPSS Statistics 29.0 software (IBM Corporation, Armonk, NY, USA). Comparisons between two groups were performed using paired Student’s t-tests, whereas one-way analysis of variance with Tukey’s post hoc test was applied for comparisons among multiple groups. Data are presented as mean ± standard deviation, with statistical significance defined as P < 0.05.

RESULTS

Expression of NT-3 and TrkC at various time points of DO

Compared with intact tibiae, NT-3 expression was significantly elevated on day 1 after osteotomy. By day 5, at the onset of distraction, NT-3 expression had returned to levels comparable to those in intact tibiae. Subsequently, NT-3 levels increased approximately 1.5-fold (P < 0.05) by day 13, marking the end of the active distraction phase (Fig. 2A). TrkC expression followed a similar trend: it was elevated on day 1 after osteotomy, returned to baseline by day 5, and then increased approximately 2.3-fold (P < 0.05) by day 13 (Fig. 2B). After the distraction phase, NT-3 expression declined between days 13 and 20, whereas TrkC expression remained stable (Fig. 2). Overall, NT-3 and TrkC displayed closely parallel expression patterns during the distraction process.

Fig. 2.

Relative mRNA expression of NT-3 and TrkC

Quantitative PCR results for (A) NT-3 and (B) TrkC on days 1, 5, 9, 13, and 20 after osteotomy (n = 6). Expression levels of both NT-3 and TrkC were significantly increased on days 1 and 13.

Data are represented as the mean ± standard deviation. * and ** indicate statistical significance at P < 0.05 and P < 0.01, respectively.

NT-3: neurotrophin-3

PCR: polymerase chain reaction

TrkC: tropomyosin receptor kinase C

Effects of NT-3 administration on DO healing

NT-3-induced healing was evaluated in DO using micro-CT on postoperative days 20 and 27. The NT-3 group showed increased DO gap impermeability on both days compared to the PBS group (Fig. 3A, B). On day 27, continuity between cortical bone and callus was observed in both groups (Fig. 3C, D). BV/TV was approximately 1.7-fold (P < 0.01) and 2-fold (P < 0.01) higher on days 20 and 27, respectively, in the NT-3 group than in the PBS group (Fig. 3E, G). BV was approximately 1.8-fold (P < 0.01) and 1.9-fold (P < 0.05) higher on days 20 and 27, respectively, in the NT-3 group than in the PBS group (Fig. 3F, H).

Fig. 3.

Administration of NT-3 enhanced bone formation in the DO model

Fig. 3A–D: NT-3 accelerates DO healing. Micro-CT images of the PBS (A, C) and NT-3 (B, D) group on days 20 and 27.

Fig. 3E–H: Quantification of bone volume and bone volume/tissue volume (BV/TV) in the DO gap on days 20 (E, F) and 27 (G, H) (n = 6).

Fig. 3I–L: H&E staining of the PBS (I, K) and NT-3 (J, L) groups on days 20 and 27. Black dashed lines indicate the proximal (right) and distal (left) bone segments.

Fig. 3M, N: Histomorphometric analysis of callus formation on days 20 (M) and 27 (N) (n = 6).

Data are represented as the mean ± standard deviation. * and ** indicate statistical significance at P < 0.05 and P < 0.01, respectively.

ALP: alkaline phosphatase

CT: computed tomography

DO: distraction osteogenesis

H&E: hematoxylin and eosin

NT-3: neurotrophin-3

PBS: phosphate-buffered saline

H&E staining was performed on postoperative days 20 and 27 for histological evaluation. Callus was observed in both groups on days 20 and 27. On day 20, bone continuity was observed in the central region only in the NT-3 group (Fig. 3I, J). Callus continuity was observed in both groups on day 27 (Fig. 3K, L). Bone formation was approximately 1.4-fold (P < 0.05) and 1.6-fold (P < 0.01) higher on days 20 and 27, respectively, in the NT-3 group than in the PBS group (Fig. 3M, N).

Mechanical properties and BMD

Bone density was assessed using micro-CT on day 83 to investigate the long-term effects of NT-3 administration. Both groups exhibited continuous bone formation from the proximal to the distal region. The NT-3 group showed enhanced impermeability of the DO gap in the sagittal view and increased thickness of the cortical bone in the horizontal view (Fig. 4A, B). The NT-3 group exhibited approximately 1.5-fold higher BMD than the PBS group (P < 0.01; Fig. 4C). We also assessed bone strength on day 83 using a three-point bending test. No significant differences were observed in maximum load between the PBS and NT-3 groups (Fig. 4D). Stiffness was approximately 2.2-fold higher (P < 0.05) in the NT-3 group than in the PBS group (Fig. 4E). To further understand the molecular mechanisms underlying these findings, we analyzed the expression of Wnt-related genes in the DO gap.

Fig. 4.

Long-term effects of NT-3 administration on DO

Fig. 4A, B: Micro-CT images of the PBS (A) and NT-3 (B) groups on day 83.

Fig. 4C: Quantification of bone mineral density (n = 6).

Fig. 4D, E: Three-point bending test results showing maximum load (D) and stiffness (E) (n = 6).

Data are represented as the mean ± standard deviation. * and ** indicate statistical significance at P < 0.05 and P < 0.01, respectively.

CT: computed tomography

DO: distraction osteogenesis

NT-3: neurotrophin-3

PBS: phosphate-buffered saline

TrkC: tropomyosin receptor kinase C

Wnt-related gene expression in the DO gap

To investigate the effects of NT-3 on gene expression in the DO gap, we performed quantitative PCR on day 16. No significant differences were observed in the expression level of Wnt5a, a Wnt signal in the non-canonical Wnt pathway, between the two groups (Fig. 5A). However, significant increases were observed in the expression levels of Wnt10b, β-catenin, and low-density lipoprotein receptor-related protein5 (LRP5) in the canonical Wnt pathway (Fig. 5B-D), with higher levels in the NT-3 group. No significant difference was observed in Frizzled4 (FZD4) expression following NT-3 administration (P < 0.05; Fig. 5E).

Fig. 5.

NT-3 regulates Wnt pathway gene expression in vivo

Quantitative PCR analysis of Wnt signaling-related genes (A–E) in the DO gap following NT-3 administration (n = 6).

Data are represented as the mean ± standard deviation. * and ** indicate statistical significance at P < 0.05 and P < 0.01, respectively.

DO: distraction osteogenesis

FZD: frizzled

LRP5: low-density lipoprotein receptor-related protein 5

NT-3: neurotrophin-3

PBS: phosphate-buffered saline

PCR: polymerase chain reaction

Wnt-related gene expression in ST2 cells

We further investigated the effects of NT-3 on ST2 cells. NT-3 administration increased the expression levels of LRP5 and LRP6; however, there was no significant difference in the expression level of Wnt10b (Fig. 6A-C). Additionally, NT-3 administration significantly increased the expression levels of RUNX2 and β-catenin, whereas coadministration of DKK1 resulted in no changes in expression levels compared with the PBS group (P < 0.05; Fig. 6D, E).

Fig. 6.

NT-3 regulates Wnt pathway gene expression in vitro

Quantitative PCR analysis of Wnt signaling-related genes in ST2 cells treated with NT-3 or NT-3 + DKK1 (n = 6).

Data are represented as the mean ± standard deviation. * and ** indicate statistical significance at P < 0.05 and P < 0.01, respectively.

DKK1: dickkopf-1

LRP: low-density lipoprotein receptor-related protein

NT-3: neurotrophin-3

PCR: polymerase chain reaction

RUNX2: runt-related transcription factor 2

DISCUSSION

To the best of our knowledge, this study is the first to report the effects of NT-3 on bone healing in a mouse tibial DO model. The temporal expression of NT-3 and its receptor TrkC during the DO process was evaluated, and the effects of local NT-3 administration on DO healing were analyzed. NT-3 administration promoted bone formation, suggesting the involvement of the Wnt/β-catenin pathway.

Temporal expression of NT-3/TrkC during DO

Previous studies have demonstrated the expression patterns of NT-3 in fracture models²² and during the distraction and consolidation phases in DO models.²³ This study is the first to report data analyzing the expression of NT-3 and TrkC at each time point during DO. The expression levels of NT-3 and TrkC transiently increased on day 1 after osteotomy, then declined during the latency phase preceding the onset of distraction. Furthermore, these levels peaked at the end of the distraction phase. NT-3 expression gradually decreased during consolidation, whereas TrkC expression remained unchanged. Based on these findings, NT-3 was locally administered at the beginning of the consolidation phase in this study. Administration of growth factors that promote bone mineralization during the latency phase may lead to premature bone union, which is undesirable.²⁴ The consolidation phase is critical for bone maturation²⁵; therefore, it is presumed to be an effective time for NT-3 administration.

Local administration of NT-3 promoted bone healing during DO

Late complications of DO, such as refractures and deformities, are significant clinical issues.⁴ Simpson and Kenwright²⁶ reported that fractures occurred in 9.4% of cases following DO, with some instances involving gradual deformation of the distraction segment, ultimately resulting in fractures. Thus, the mechanical strength of newly formed bone tissue following DO is a critically important clinical issue. In this study, we evaluated the effects of local administration of NT-3 on the mechanical properties of bone. Although no significant difference was observed in maximum load, an increase in stiffness was confirmed in the NT-3 group. Stiffness is an indicator of the stress a material can withstand before failure. Therefore, increased stiffness may reduce occurrences of cases like the one described above, in which the traction segment gradually deforms and eventually fractures. These results suggest that NT-3 administration may have enhanced the mechanical properties of bone.

These findings demonstrate that NT-3 promotes early bone healing and accelerates bone maturation. Moreover, NT-3 reduces the risk of refracture following DO and enables the early removal of external fixators.

Multifaceted effects of NT-3 on bone

NT-3 promotes angiogenesis and induces osteogenic differentiation of mesenchymal stem cells in the rat bone injury model.¹⁵ Specifically, vascular endothelial growth factor has been identified as a key factor in NT-3-induced angiogenesis, while BMP-2 has been implicated in NT-3-induced bone formation. Another study reported that NT-3 directly induces osteogenic differentiation through the Akt signaling pathway.¹⁷ These findings suggest that NT-3 may regulate bone formation through multiple signaling pathways.

The results of this study demonstrated that NT-3 promotes bone formation via the Wnt/β-catenin pathway. The Wnt signaling pathway interacts with the BMP signaling pathway,²⁷ and the synergistic effects of these pathways may further enhance bone formation. NT-3-induced bone formation involves crosstalk between these signaling pathways and angiogenesis. In particular, angiogenesis is a critical factor in bone formation, and NT-3-mediated promotion of angiogenesis via vascular endothelial growth factor is presumed to play an important role in shaping the microenvironment for bone formation. Overall, these findings suggest that NT-3 is involved in bone formation through multifaceted mechanisms, including angiogenesis, the Wnt/β-catenin pathway, and the BMP signaling pathway. Furthermore, the role of the nervous system in bone formation should not be overlooked. Nerve outgrowth precedes angiogenesis during bone formation,^8,9 and NT-3 promotes nerve outgrowth.¹⁴ Thus, NT-3 may indirectly regulate bone formation by promoting nerve outgrowth. However, further studies are needed to elucidate the role of the nervous system in NT-3-mediated bone formation.

Limitations

This study has some limitations. First, the in vivo results were based on local administration of NT-3 for only 2 consecutive days, and the optimal dosage and frequency for DO have not been fully explored. Although the current regimen demonstrated bone healing potential, adjusting the dosage and administration schedule may further enhance the therapeutic effects.

Second, in vitro experiments were performed using cell lines, which may not fully replicate the responses of primary cells from tissues closer to the in vivo environment. Previous studies have reported differences in signaling pathway responses between cell lines and primary cells,²⁸ highlighting the need for future validation under conditions that better mimic the in vivo environment.

Third, while this study suggests that NT-3 promotes bone healing via the Wnt/β-catenin pathway at the genetic level, further research is required to elucidate the detailed signaling mechanisms and protein-level expression.

Finally, the crosstalk between the Wnt/β-catenin pathway and other NT-3–mediated signaling pathways, particularly its interaction with BMP signaling, remains unclear. It also remains to be determined whether this interaction occurs via the Akt signaling pathway, warranting further investigation.

Overall, these findings indicate the potential of NT-3 to enhance DO healing, possibly through Wnt/β-catenin pathway activation. However, further studies are necessary to clarify the detailed mechanisms, optimize administration conditions, and ensure safety for clinical applications.

AUTHOR CONTRIBUTIONS

Study conception and design: MW, MF, and HH. Data acquisition: MT, HB, and YL. Data analysis and interpretation: MW, MF, MT, QC, HB, and YL. Drafting and revision of the manuscript: MW and MF. All authors approved the final manuscript.

CONFLICT OF INTEREST

All authors have no conflict of interest.

Abbreviations

BMP

bone morphogenetic protein

DO

distraction osteogenesis

NT-3

neurotrophin-3

PBS

phosphate-buffered saline

TrkC

tropomyosin receptor kinase C

Funding Statement

This work was supported by Japan Society for the Promotion of Science KAKENHI Grant-in-Aid for Scientific Research (C) (grant number 21K10090) and Scientific Research (B) (grant number 19H03851).