Mitigating copper toxicity in Carthamus tinctorius L. through 6-benzylaminopurine during seed germination and vegetative growth

Abstract

Cytokinins are essential regulators of plant growth and development and are actively involved in plant responses to both biotic and abiotic stresses. In the present study, the role of 6-Benzylaminopurine (BAP) in modulating growth performance and copper (Cu) tolerance in Carthamus tinctorius L. was examined. Treatments consisted of four CuSO₄ levels and three BAP levels in a factorial design. High Cu levels significantly reduced seed germination parameters, growth characteristics, photosynthetic pigments, root and shoot protein content, and peroxidase (POX) activity, while increasing soluble carbohydrates, polyphenol oxidase (PPO) activity, Cu accumulation, total phenolic content, anthocyanin levels, and the relative expression of SOD and PAL genes. BAP application markedly improved seed germination and growth under Cu stress, likely by modulating biochemical, physiological, and molecular mechanisms. Treatment with 350 µM BAP under severe Cu toxicity (0.016 g kg^− 1) enhanced Chl a (78.30%), Chl b (160%), total chlorophyll (166%), carotenoids (100%), soluble carbohydrates (116%), root protein (106%), shoot protein (59.23%), root POX (112%), shoot POX (229%), root PPO (97%), shoot PPO (65.38%), and the relative expression of PAL (43.05%) and SOD (5.51%). Conversely, BAP reduced total phenolic content (41.50%) and anthocyanin content (31.42%) in the shoots. Overall, the results demonstrate that BAP effectively mitigates Cu-induced toxicity in C. tinctorius by enhancing antioxidant activity and regulating defense-related gene expression, thereby improving plant tolerance to heavy metal stress.

Introduction

Copper (Cu) is an essential micronutrient required for normal plant growth and development, as it contributes to major physiological processes such as photosynthesis, respiration, and enzyme activation. In plant cells, Cu functions as a redox-active cofactor and is involved in electron transport reactions, thereby playing a central role in carbon assimilation and ATP production^1–4. However, despite its essentiality, Cu becomes highly toxic when accumulated beyond the physiological threshold, mainly due to its strong ability to trigger the formation of reactive oxygen species (ROS)^1,2.

Excess Cu in the growth medium disrupts cellular homeostasis and negatively affects plant establishment and productivity. Cu toxicity is commonly associated with reduced germination performance, growth retardation, chlorosis, and disturbances in nutrient uptake and metabolism⁴. At the cellular level, Cu stress promotes ROS generation, leading to oxidative damage in membranes, proteins, and nucleic acids. This oxidative burst results in lipid peroxidation and structural injuries that impair multiple metabolic pathways and limit plant survival^5,6. In addition, elevated Cu levels can interfere with photosynthesis and respiration, compromise membrane integrity, and alter enzymatic activity, ultimately causing severe physiological dysfunction⁷. Therefore, maintaining Cu at controlled levels is critical for plant health and performance.

In recent decades, climate change and increasing climate variability have emerged as major threats to agricultural sustainability by intensifying the frequency and severity of abiotic stresses worldwide. These stresses, including drought, salinity, heat, and heavy metal contamination, often occur in combination and severely limit crop productivity and stability. Such environmental challenges have become a critical concern for global food security due to their negative impacts on crop yield and quality under field conditions^8,9. In this context, the use of plant growth regulators has gained considerable attention as a promising approach to mitigate stress-induced damages in plants. Among these stresses, heavy metal contamination has received increasing attention due to its persistence in agricultural soils, with copper (Cu) toxicity being one of the most relevant examples¹⁰.

In recent years, exogenous application of plant growth regulators has been increasingly investigated as an effective strategy to improve plant tolerance to environmental stresses. Hormonal treatments have been reported to alleviate the adverse effects of several abiotic stress factors, such as heavy metals, drought, salinity, and temperature fluctuations by modulating antioxidant metabolism and stress-responsive signaling pathways^11–14. Since Cu toxicity induces multiple physiological disorders, the severity of its harmful effects may be modified through hormonal regulation¹⁵.

Among phytohormones, cytokinins (CKs) play fundamental roles in regulating cell division, organ formation, and developmental transitions, while also acting as important mediators of plant adaptation under stress conditions¹⁶. Several investigations have suggested that CK supplementation can reduce heavy metal toxicity by enhancing physiological performance and strengthening detoxification systems. For example, kinetin application alleviated cadmium-induced stress in tomato seedlings through stimulation of antioxidant pathways and regulation of the ascorbate–glutathione cycle¹⁷. Similarly, exogenous treatment with 6-benzylaminopurine (BAP), a synthetic cytokinin, in combination with abscisic acid (ABA), reduced cobalt uptake and accumulation in tomato shoots¹⁸. In addition, CK application improved Cu tolerance in Ricinus communis seedlings by promoting the accumulation of secondary metabolites involved in stress defense¹⁹. These findings highlight the potential role of CKs as effective regulators of stress tolerance mechanisms under heavy metal exposure.

Safflower (Carthamus tinctorius L.), a medicinal and industrial plant belonging to the Asteraceae family, is widely recognized for its use as a natural dye source²⁰. It is also considered an important oilseed crop due to its high seed oil content, which can reach approximately 27–32%²¹. Because of its diverse applications in pharmaceutical, cosmetic, and food industries, safflower is regarded as an economically valuable domesticated species²². However, its germination and vegetative growth can be adversely affected by heavy metal contamination, particularly Cu stress.

Therefore, the present study aimed to evaluate the protective role of exogenous BAP in alleviating Cu-induced toxicity in safflower during both germination and vegetative growth stages. The outcomes of this study may provide useful insights into cytokinin-mediated mechanisms of Cu tolerance and may contribute to developing practical strategies for improving safflower performance in Cu-contaminated environments.

Materials and methods

Experimental design and treatments

The study consisted of two independent experiments (germination and greenhouse) arranged in a completely randomized factorial design. Treatments included four levels of copper sulfate (CuSO₄) (0, 0.004, 0.008, and 0.016 g L^− 1 for the germination experiment; 0, 0.004, 0.008, and 0.016 g kg^− 1 soil for the greenhouse experiment) and three levels of 6-benzylaminopurine (BAP) (0, 250, and 350 µM), resulting in 12 treatment combinations for each experiment.

Plant material and permissions

Seeds of C. tinctorius were obtained from the certified seed supplier Pakan Bazr Company (Iran). The plant material used in this study is a cultivated species, and all procedures involving plant material complied with institutional and national guidelines for experimental research on plants.

Germination experiment

Safflower seeds were surface-sterilized and initially soaked in the respective CuSO₄ and BAP solutions for 2 h according to the experimental design. Thereafter, seeds were placed in sterile Petri dishes lined with filter paper moistened with the same respective CuSO₄ and BAP solutions to maintain exposure conditions during the germination period. Germination was recorded daily for seven days under dark conditions at room temperature. At the end of the experiment, seedling length, fresh weight, and dry weight were measured, and germination indices were calculated as follows:

²³.

²⁴.

D: number of days passed. n: number of germinated seeds on the desired day.

²⁵.

²⁵.

Greenhouse study

For the greenhouse experiment, seeds were first sown in trays containing cocopeat and grown for 15 days until the development of true leaves. Seedlings were then transplanted into plastic pots (20 cm diameter × 20 cm depth) containing 4 kg of soil. Soil was collected from the research greenhouse of Kharazmi University, and its physicochemical properties were determined prior to use (Table 1).

Table 1.

Physical and chemical characterization of the experimental soil.

Parameter	Value
pH	7
EC (dS m− 1)	0.73
Total lime (%)	9.9
Organic carbon (%)	5.15
Total Nitrogen (%)	0.37
Soil texture	Loam
Cu (mg kg− 1)	2.3
P (mg kg− 1)	190
K (mg kg− 1)	2780

Air-dried soil was amended with CuSO₄ at four concentrations (0, 0.004, 0.008, and 0.016 g kg^[-1 and BAP at three concentrations (0, 250, and 350 µM). The soil was thoroughly mixed and incubated for two weeks under greenhouse conditions to ensure equilibration.

Plants were grown under controlled conditions (25/17°C day/night, 16 h light/8 h dark photoperiod, with a light intensity of approximately 50,000 lx). Pots were arranged in a completely randomized design and repositioned daily to minimize positional effects. Sampling was performed 30 days after treatment initiation.

Growth parameters

After one month of treatment, growth characteristics were evaluated at the vegetative stage. Shoot height was measured from the collar region to the shoot apex. Roots were carefully washed and separated from the soil. Shoot and root fresh weights were determined immediately after harvesting. Thereafter, plant tissues were oven-dried at 70 °C for 72 h until reaching constant weight to measure dry biomass.

Leaf area was estimated using the graph paper method. Leaf outlines were traced on millimeter graph paper and the cut portions were weighed. Leaf area (cm²) was calculated based on the ratio of the paper weight covered by the leaf to the weight of 1 cm² of graph paper²⁶.

Determination of Cu concentration

To measure Cu accumulation, dried shoot tissues were powdered and subjected to acid digestion using nitric acid and hydrogen peroxide. Copper concentration in plant samples was then determined using inductively coupled plasma spectrometry (ICP, RCOS A Spectro)²⁷. The effect of BAP (0 and 350 µM) on Cu accumulation was assessed under Cu stress with treatments of 0.004 and 0.016 g kg^− 1.

Determination of soluble carbohydrates

Soluble carbohydrate concentration was determined using the phenol–sulfuric acid method. Dried leaf samples (0.05 g) were extracted with 70% ethanol. After extraction, an aliquot of the supernatant was diluted with distilled water, followed by the addition of phenol (5%) and concentrated sulfuric acid. Absorbance was measured at 485 nm using a spectrophotometer (Unico model 2150), and carbohydrate concentration was quantified using a glucose standard curve²⁸.

Photosynthetic pigment analysis

Photosynthetic pigments including chlorophyll a (Chl a), chlorophyll b (Chl b), total chlorophylls (T Chl), and carotenoids (Car) were measured using acetone extraction (80%). Leaf samples were collected from the upper leaves at the vegetative stage. Absorbance was recorded at 663.2 nm, 646.8 nm, and 470 nm using a spectrophotometer. Pigment contents were calculated using standard equations and expressed as mg g^− 1 fresh weight²⁹.

Protein content and enzyme assays

Fresh shoot and root tissues were homogenized in phosphate buffer and centrifuged (Smart R17 refrigerated microcentrifuge) at 15,000 rpm for 12 min at 4 °C. The resulting supernatant was used for protein quantification and enzyme activity assays.Total soluble protein content was determined using the Bradford³⁰ method and expressed as mg g^− 1 fresh weight. Peroxidase (POX) activity was measured spectrophotometrically using guaiacol as a substrate in the presence of hydrogen peroxide. The increase in absorbance was recorded at 470 nm³¹. Polyphenol oxidase (PPO) activity was determined using pyrogallol as a substrate, and changes in absorbance were monitored at 430 nm³². The enzymatic activity was expressed as the ΔOD min^− 1 g^− 1 protein FW.

Determination of total phenolic and anthocyanin content

Total phenolic content was quantified using Folin–Ciocalteu reagent and expressed as mg gallic acid equivalents (GAE) g^− 1 dry weight³³. Anthocyanin concentration was determined using methanolic extraction, followed by spectrophotometric measurement at 530 nm³⁴.

RNA extraction, cDNA synthesis, and real-time PCR

Total RNA was extracted from safflower leaves using a commercial RNA extraction kit (DENA Zist Asia Company, Iran). RNA quality and quantity were evaluated, and cDNA was synthesized from 500 ng RNA using oligo(dT) and random primers. Quantitative real-time PCR was conducted using SYBR Green chemistry (Table 2). Amplification reactions were performed under optimized cycling conditions, and gene expression levels were calculated using the 2^−ΔΔCt method. The relative expression of SOD and PAL genes was normalized against the reference gene³⁵.

Table 2.

Designed primers.

Primer name	Sequence (5 − 3)	Tm (°C)	Amplicon (bp)
PAL-F	CCATTGCTGCTATCGGGAAAC	62	97
PAL-R	CGGCTACCGGATAGATTCGAA	61
SOD-F	AGGCAGAAGGTGCTCCCAC	60	100
SOD-R	CCATTGGTTGTGTCACCAAG	59
actin-F	GAAGATCAAGGTGGTTGCACC	60	93
actin-R	CACATCTGTTGGAAGGTGCTG	60

Statistical analysis

The experiment was arranged as a factorial design based on a completely randomized design with three replications. Statistical analyses were performed using SPSS software (version 27). Mean comparisons were conducted using Duncan’s multiple range test at P ≤ 0.05. Excel (Office 2021) was also used to draw graphs. Heat map analysis was performed using the CIMMiner online tool.

Results

Germination parameters

Statistical analysis revealed that BAP had a significant effect on shoot and radicle length, seedling fresh weight, SLV, and SWV under Cu treatment (P ≤ 0.01). However, the combined effect of BAP and Cu on seedling dry weight, GP, and GR was not significant. The germination percentage of safflower was 100% across all treatments. Increasing Cu concentration resulted in a reduction in shoot and radicle length, SLV, and SWV, while seedling fresh weight increased. BAP enhanced shoot and radicle length, seedling fresh weight, SLV, and SWV in the presence of Cu. For instance, at 0.016 g L⁻¹ Cu, shoot and radicle length, seedling fresh weight, SLV, and SWV were 5.49 cm, 9.59 cm, 0.29 g, 1508, and 1.37, respectively. After applying 350 µM BAP, these values changed to 5.81 cm, 9.97 cm, 0.29 g, 1579, and 1.15, respectively (Tables 3 and 4; Fig. 1).

Table 3.

Effect of BAP (0, 250, and 350 µM) on seedling growth of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g L⁻¹).

Treatments		Root length (cm)**	Shoot length (cm)**	Dry biomass (g)ns	Fresh biomass (g)**
Cu (g L− 1)	BAP (µM)
0	0	10.76 ± 0.045c	6.45 ± 0.07c	0.013 ± 0.00cd	0.22 ± 0.02b
	250	10.98 ± 0.05b	6.87 ± 0.06b	0.016 ± 0.00b	0.24 ± 0.00b
	350	11.27 ± 0.02a	7.22 ± 0.05a	0.013 ± 0.00cd	0.30 ± 0.01a
0.004	0	10.26 ± 0.020e	5.85 ± 0.03ef	0.013 ± 0.00cd	0.30 ± 0.01a
	250	10.49 ± 0.05d	5.97 ± 0.03de	0.014 ± 0.00c	0.30 ± 0.00a
	350	10.58 ± 0.01d	6.07 ± 0.04d	0.013 ± 0.00d	0.30 ± 0.00a
0.008	0	10.03 ± 0.045f	5.61 ± 0.01gh	0.012 ± 0.00d	0.31 ± 0.00a
	250	10.58 ± 0.01d	5.82 ± 0.02f	0.015 ± 0.00b	0.32 ± 0.00a
	350	10.66 ± 0.01c	6.01 ± 0.04d	0.013 ± 0.00d	0.32 ± 0.00a
0.016	0	9.59 ± 0.023h	5.49 ± 0.04h	0.013 ± 0.00cd	0.29 ± 0.00a
	250	9.88 ± 0.01g	5.68 ± 0.01g	0.017 ± 0.00a	0.29 ± 0.00a
	350	9.97 ± 0.01fg	5.81 ± 0.02f	0.011 ± 0.00e	0.29 ± 0.00a

**Significant differences with the control group (P ≤ 0.01).

^nsNo significant differences with the control group.

Lowercase letters show significant statistical differences between treatments. Data was presented in means (n = 3 ± S.E.)

Table 4.

Effect of BAP (0, 250, and 350 µM) on germination parameters of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g L⁻¹).

Treatments		GRns	SLV**	SWV**
Cu (g L− 1)	BAP(µM)
0	0	8.94 ± 0.05ab	1721.33 ± 2.60c	1.39 ± 0.01cd
	250	7.00 ± 0.57c	1786.00 ± 10.01b	1.60 ± 0.01b
	350	8.16 ± 0.6b	1850.00 ± 8.66a	1.38 ± 0.0cd
0.004	0	9.83 ± 0.16a	1611.00 ± 4.50f	1.39 ± 0.03cd
	250	9.83 ± 0.16a	1646.00 ± 8.38e	1.41 ± 0.04c
	350	9.83 ± 0.16a	165.33 ± 5.69d	1.30 ± 0.03d
0.008	0	9.66 ± 0.33a	1564.33 ± 3.75gh	1.29 ± 0.04d
	250	9.33 ± 0.44a	1640.66 ± 4.25e	1.56 ± 0.01b
	350	9.50 ± 0.00a	1670.00 ± 4.93d	1.30 ± 0.01d
0.016	0	9.66 ± 0.33a	1508.00 ± 6.92i	1.37 ± 0.0cd
	250	9.27 ± 0.43a	1557.00 ± 2.51h	1.78 ± 0.05a
	350	9.27 ± 0.22a	1579.00 ± 2.51g	1.15 ± 0.02e

**Significant differences with the control group (P ≤ 0.01).

^nsNo significant differences with the control group.

Lowercase letters show significant statistical differences between treatments. Data was presented in means (n = 3 ± S.E.)

Fig. 1.

Effect of BAP (0, 250, and 350 µM) on seedlings of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g L⁻¹).

Growth parameters

The interaction of Cu and BAP significantly influenced growth parameters, including shoot and root length, fresh weight of shoot and root, shoot dry weight, and leaf area (P ≤ 0.01) (Table 5; Fig. 2). Addition of 0.004 g kg⁻¹ Cu increased shoot length to 23.69 cm, but further increases in Cu concentration reduced shoot length, reaching a minimum of 16.60 cm at 0.016 g kg⁻¹. Incorporation of BAP at 0.016 g kg⁻¹ Cu raised shoot length to a maximum of 26.22 cm (Table 5).

Table 5.

Effect of BAP (0, 250, and 350 µM) on growth parameters of Safflower under (0, 0.004, 0.008, and 0.016 g kg⁻¹.

Treatments		Shoot length (cm)**	Root length (cm)**	Shoot fresh biomass (g)**	Root fresh biomass (g)**	Shoot dry biomass (g)**	Root dry biomass (g)ns	Leaf area (cm2)**
Cu (g Kg− 1)	BAP (µM)
0	0	21.51 ± 0.30e	12.44 ± 0.04g	0.34 ± 0.00e	1.43 ± 0.05h	0.12 ± 0.01cd	0.013 ± 0.001de	28.58 ± 1.01cde
	250	24.49 ± 0.26c	22.35 ± 0.22a	0.52 ± 0.01c	2.11 ± 0.00c	0.04 ± 0.00f	0.012 ± 0.001e	15.22 ± 1.33f
	350	25.68 ± 0.26b	21.58 ± 0.25b	0.72 ± 0.01a	2.46 ± 0.07a	0.10 ± 0.01de	0.021 ± 0.002bc	35.48 ± 1.88b
0.004	0	23.69 ± 0.15d	14.82 ± 0.07e	0.42 ± 0.01d	1.87 ± 0.00d	0.21 ± 0.01a	0.019 ± 0.004cd	35.80 ± 1.51b
	250	19.63 ± 0.17g	7.79 ± 0.01j	0.33 ± 0.01e	1.59 ± 0.03efg	0.07 ± 0.00ef	0.017 ± 0.001cde	30.80 ± 0.61bcd
	350	23.31 ± 0.17d	12.61 ± 0.05g	0.33 ± 0.00e	1.64 ± 0.02ef	0.14 ± 0.01bc	0.018 ± 0.002cde	33.97 ± 0.58b
0.008	0	19.48 ± 0.10g	11.37 ± 0.15h	0.29 ± 0.02e	1.56 ± 0.03fg	0.06 ± 0.00ef	0.018 ± 0.001cde	33.61 ± 0.62bc
	250	18.49 ± 0.03h	13.68 ± 0.21f	0.31 ± 0.00e	1.64 ± 0.00ef	0.07 ± 0.01ef	0.013 ± 0.001de	27.34 ± 1.61de
	350	17.83 ± 0.11i	18.42 ± 0.22c	0.35 ± 0.01e	1.71 ± 0.02e	0.15 ± 0.01bc	0.019 ± 0.001cde	25.00 ± 0.78e
0.016	0	16.60 ± 0.04j	10.06 ± 0.11i	0.22 ± 0.03f	1.50 ± 0.01gh	0.14 ± 0.01bc	0.020 ± 0.001cd	31.99 ± 2.16bcd
	250	20.46 ± 0.20f	11.72 ± 0.09h	0.48 ± 0.00c	2.10 ± 0.02c	0.18 ± 0.00ab	0.028 ± 0.001a	33.89 ± 2.12b
	350	26.22 ± 0.16a	16.39 ± 0.22d	0.61 ± 0.03b	2.26 ± 0.07b	0.18 ± 0.01ab	0.026 ± 0.001ab	47.44 ± 2.98a

**Significant differences with the control group (P ≤ 0.01).

^nsNo significant differences with the control group.

Lowercase letters show significant statistical differences between treatments. Data was presented in means (n = 3 ± S.E.)

Fig. 2.

Effect of BAP (0, 250, and 350 µM) on growth of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g kg⁻¹).

Similarly, root length decreased at high Cu concentrations, but BAP alleviated the negative effect of Cu stress, enhancing root length. Maximum root elongation was observed in Cu-free medium with 250 and 350 µM BAP (Table 5).

The fresh weight of the shoot increased in concentrations of 0.004 and 0.016 g kg^− 1 of Cu. With the addition of BAP (250 and 350 µM), fresh weight increased, and the largest change was observed between the concentration of 0.016 g kg^− 1 Cu with 350 µM BAP and the concentration of 0.016 g kg^− 1 Cu without BAP (about 3 times) (Table 5).

Shoot fresh weight increased at 0.004 and 0.016 g kg^− 1 Cu. BAP supplementation (250 and 350 µM) further enhanced fresh weight, with the greatest increase observed at 0.016 g kg⁻¹ Cu combined with 350 µM BAP, showing approximately a threefold increase compared with Cu treatment alone (Table 5). Root fresh weight generally increased with Cu concentration, and was further improved by BAP, except at 0.004 g kg^− 1 Cu where a reduction was observed (Table 5).

Shoot dry weight increased with Cu concentration, except for a slight decrease at 0.008 g kg⁻¹ Cu. BAP application enhanced dry weight particularly at 0.008 and 0.016 g kg^− 1 Cu, while the highest dry biomass was recorded at 0.004 g kg^− 1 Cu (0.21 g) (Table 5). Leaf area increased with rising Cu concentration. However, BAP reduced leaf area at 0.004 and 0.008 g kg^− 1 Cu, while promoting leaf expansion at 0.016 g kg^− 1 Cu, where the maximum value (47.44 cm²) was observed with 350 µM BAP (Table 5).

Ion concentration

Cu accumulation in shoots increased with increasing Cu concentrations in the culture medium, though this change was not statistically significant compared to the control. Application of 350 µM BAP reduced Cu uptake to 9.55 mg kg^− 1 DW at 0.004 g kg^− 1 Cu and 9.26 mg kg^− 1 DW at 0.016 g kg^− 1 Cu (Fig. 3).

Fig. 3.

Effect of BAP (0 and 350 µM) on Cu content of Safflower under Cu stress (0, 0.004, and 0.016 g kg⁻¹). Lowercase letters show significant statistical differences between treatments. Data was presented in means (n = 3 ± S.E.)

Soluble carbohydrates

BAP significantly influenced soluble carbohydrate levels in safflower under Cu treatment (P ≤ 0.01). Increasing Cu concentrations elevated soluble carbohydrates, and BAP further enhanced these levels. The lowest carbohydrate content was 41.90 mg g⁻¹ DW in the control, while the highest was 92.44 mg g^− 1 DW at 0.016 g kg⁻¹ Cu with 350 µM BAP (Fig. 4).

Fig. 4.

Effect of BAP (0, 250, and 350 µM) on soluble carbohydrates content of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g kg⁻¹). Lowercase letters indicate a statistically significant difference between treatments. Data was presented in means (n = 3 ± S.E.)

Photosynthetic pigments

BAP application affected Chl a (P ≤ 0.05), Chl b, T Chl, and Car (P ≤ 0.01) under Cu stress. Cu supplementation reduced Chl a, Chl b, and T Chl concentrations. BAP significantly increased Chl a levels, except at 0.008 g kg^− 1 Cu. The combination of 0.016 g kg⁻¹ Cu and 350 µM BAP resulted in a 78.30% increase in Chl a compared to 0.016 g kg^− 1 Cu alone (Fig. 5a).

Fig. 5.

Effect of BAP (0, 250, and 350 µM) on photosynthetic pigments of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g kg⁻¹). a chlorophyll a; b chlorophyll b; c total chlorophyll; d carotenoid. Lowercase letters indicate a statistically significant difference between treatments. Data was presented in means (n = 3 ± S.E.)

BAP also significantly increased Chl b and T Chl, with maximum values of 0.26 and 0.72 mg g^− 1 FW, respectively, at 0.016 g kg⁻¹ Cu with 350 µM BAP (Fig. 5b, c). Carotenoid content reached a maximum of 0.12 mg g^− 1 FW at the same combination, whereas it decreased to 0.006 mg g⁻¹ FW in 0.008 g kg^− 1 Cu with 350 µM BAP (Fig. 5d).

Total protein content and enzymatic activity

BAP significantly affected root and shoot protein content (P ≤ 0.01). Copper increased root protein content except at 0.016 g kg^− 1. Treatment with 350 µM BAP reduced root protein at 0.004 (43.56%) and 0.008 g kg^− 1 (34.55%) Cu but increased it by 106% at 0.016 g kg^− 1 Cu (Fig. 6a). Copper decreased shoot protein content, while BAP had a positive effect. The lowest shoot protein was 6.28 mg g⁻¹ FW at 0.016 g kg⁻¹ Cu without BAP, and the highest was 54.49 mg g^− 1 FW at 0.004 g kg^− 1 Cu with 350 µM BAP (Fig. 6b).

Fig. 6.

Effect of BAP (0, 250, and 350 µM) on a root total protein and b shoot protein content of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g kg⁻¹). Lowercase letters indicate a statistically significant difference between treatments. Data was presented in means (n = 3 ± S.E.)

POX activity in roots and shoots under Cu exposure was significantly influenced by BAP (P ≤ 0.01). In roots, POX activity decreased with increasing Cu, but BAP application enhanced activity, with a threefold increase at 250 µM BAP and 0.004 g kg^− 1 Cu compared to Cu alone (Fig. 7a). Shoot POX activity decreased with Cu, reaching 0.48 ∆OD min^− 1 mg⁻¹ protein FW at 0.016 g kg^− 1 Cu, but increased to 1.58 ∆OD min^− 1 mg^− 1 protein FW with 350 µM BAP (Fig. 7b).

Fig. 7.

Effect of BAP (0, 250, and 350 µM) on antioxidant enzyme activity of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g kg⁻¹). a root peroxidase (POX) activity, b shoot peroxidase (POX) activity, c root polyphenol oxidase (PPO) activity, and (d) shoot polyphenol oxidase (PPO) activity. Lowercase letters indicate a statistically significant difference between treatments. Data was presented in means (n = 3 ± S.E.)

PPO activity in roots and shoots was also significantly affected by BAP (P ≤ 0.01). PPO increased with Cu in roots from 0.82 to 1.36 ∆OD min^− 1 mg^− 1 protein FW, and in shoots from 0.12 to 0.26 ∆OD min^− 1 mg^− 1 protein FW. Maximum PPO activity occurred at 0.004 g kg^− 1 Cu with 350 µM BAP, reaching 5.50 and 0.65 ∆OD min^− 1 mg^− 1 protein FW in roots and shoots, respectively (Fig. 7c, d).

Total phenolic and anthocyanin content

Cu increased total phenolic and anthocyanin content, whereas BAP reduced these compounds (P ≤ 0.01). Total phenolic content at 0, 0.004, 0.008, and 0.016 g kg^− 1 Cu was 322.73, 537.91, 609.04, and 637.02 mg GAE g^− 1 DW, respectively, and with 350 µM BAP, these values were 364.40, 451.30, 392.08, and 372.73 mg GAE g^− 1 DW (Fig. 8a). Cu at 0.016 g kg^− 1 increased anthocyanin by 59%, while 350 µM BAP reduced this increase by 31.42% (Fig. 8b).

Fig. 8.

Effect of BAP (0, 250, and 350 µM) on a total phenolic and b anthocyanin content of Safflower under Cu stress (0, 0.004, 0.008, and 0.016 g kg⁻¹). Lowercase letters indicate a statistically significant difference between treatments. Data was presented in means (n = 3 ± S.E.)

Expression levels of the PAL and SOD genes

BAP significantly upregulated SOD (P ≤ 0.05) and phenylalanine ammonia-lyase (PAL) (P ≤ 0.01) gene expression. Cu at 0.016 g kg^− 1 increased SOD 2.75-fold and PAL 1.06-fold relative to the control. Application of 350 µM BAP under the same Cu conditions further increased SOD and PAL by 5.15% and 43.05%, respectively (Fig. 9a, b).

Fig. 9.

Effect of BAP (0 and 350 µM) on relative expression level of a PAL gene and b SOD gene of Safflower under Cu stress (0, 0.004, and 0.016 g kg⁻¹) by qRT-PCR. Lowercase letters indicate a statistically significant difference between treatments. Data was presented in means (n = 3 ± S.E.)

Heat map analysis and cluster analysis

Heat map analysis showed that POX activity in leaves, PPO activity in roots and leaves, and protein content in roots and leaves exhibited the highest variability among treatments, whereas shoot length displayed minimal variation. Four main clusters were identified based on Cu and BAP treatments (Fig. 10), demonstrating differential sensitivity of plant traits to the applied treatments. The first cluster included control plants and those treated with Cu (0.004 and 0.016 g kg^− 1). The second cluster comprised plants treated with 350 µM BAP. The third cluster contained plants exposed to 0.016 g kg^− 1 Cu and 350 µM BAP. The fourth cluster included plants treated with 0.004 g kg^− 1 Cu and 350 µM BAP. Collectively, these results underscore the varying sensitivities of different plant traits to the applied treatments.

Fig. 10.

Heat map of studied traits under Cu and BAP treatments in the vegetative phase. SPOX: shoot POX, SPPO: shoot PPO, RPPO: root PPO, RPr: root protein content, SPr: shoot protein content, RPOX: root POX, LS: length of shoot, RFW: root fresh weight, LA: leaf area, SFW: shoot fresh weight, LR; length of root, Car: carotenoid content, Carb: soluble carbohydrates content, T Chl: total chlorophyll, Ph: phenolic content, An: anthocyanin content, SOD: SOD gene expression, PAL: PAL gene expression. T1 = control, T2 = BAP 350, T3 = Cu 0.004, T4 = Cu 0.004 * BAP 350, T5 = Cu 0.016, T6 = Cu 0.016 * BAP 350.

Discussion

Mineral nutrition is a major determinant of plant growth and developmental regulation. Both nutrient deficiency and nutrient excess can act as abiotic stressors, negatively influencing physiological performance and metabolic balance. Under such conditions, plants activate regulatory networks to maintain nutrient homeostasis through coordinated uptake, transport, and compartmentalization mechanisms. This regulation is particularly important for transition metals such as Cu, which play essential roles in cellular metabolism but can become toxic when accumulated beyond optimal levels. Copper is required as a redox-active cofactor in several biochemical reactions; however, excessive Cu enhances ROS generation, thereby triggering oxidative stress and cellular injury².

Cytokinins are key hormonal regulators involved in plant morphogenesis and cellular differentiation, and they also participate in stress-related signaling pathways³⁶. Increasing evidence suggests that CKs contribute to plant tolerance against heavy metal stress by modulating antioxidant metabolism and influencing adaptive defense mechanisms. Moreover, CK-mediated regulation may alter metal uptake and distribution patterns, thereby reducing metal toxicity and improving overall growth performance under stress conditions³⁷.

Seed germination, the initial phase of plant development, is highly sensitive to environmental conditions^38,39. Our results indicate that Cu negatively affected germination and seedling growth, whereas BAP application improved these traits. Previous research has similarly demonstrated that even low Cu concentrations reduce germination rates, impede shoot elongation, and inhibit root formation^40,41. Godoy et al.⁴² observed a significant reduction in maize root length under 150 mM Cu stress.

Cytokinins enhance seed germination by antagonizing ABA signaling⁴³. During the germination process, elevated levels of CKs promote the expression of type-A Arabidopsis Response Regulators (ARRs), specifically ARR4, ARR5, and ARR6, which work to deactivate the ABI5 (abscisic acid insensitive 5)-mediated suppression of germination⁴⁴.

Additionally, CKs interact with glucose through a hexokinase 1 (HXK1)-dependent pathway, which plays a significant role in regulating the elongation of the radicle and hypocotyl^45,46. Our results confirm that BAP plays a role in improving germination under Cu stress.

Heavy metal stress is a major abiotic factor limiting plant growth and development⁴⁷. Copper stress impairs plants by inhibiting seed germination, growth, development, flowering, and fruiting⁴⁸. The addition of Cu at a concentration of 0.004 g kg^− 1 increased growth parameters; however, as the concentration of Cu rose, these values declined. In the treatments with Cu at 0.008 and 0.016 g kg^− 1, the inclusion of BAP enhanced the growth parameters.

Previous studies corroborate that Cu-induced nutritional imbalances hamper plant development by disrupting biochemical and physiological processes critical for growth^49–51. Copper-induced stress reduces chlorophyll concentration in plants and disrupts normal physiological functions, thereby adversely affecting plant growth⁵². Copper toxicity disrupts the integrity of the cell wall by inhibiting lignin degradation in root tissues, which ultimately impedes root development⁵³. Elevated Cu levels downregulate genes involved in auxin and CK synthesis, resulting in reduced concentrations of these phytohormones. This reduction consequently suppresses auxin and CK signaling pathways, further hindering root growth. High Cu levels downregulate auxin and CK synthesis genes, suppressing their signaling pathways, and upregulate ABA biosynthesis, enhancing stress tolerance^53–55.

Studies have shown that CKs may play a significant role in managing heavy metal stress in plants by affecting the biosorption of heavy metals and adjusting the mechanisms for adapting to heavy metal toxicity³⁷. The application of CK in algal plants enhanced cell division, promoting growth and development by counteracting heavy metal-induced oxidation in the mitotic index⁵⁶. The use of the CK antagonist (PI-55) enhanced root development and structure by increasing the efficiency of nutrient uptake in plants cultivated in lead-contaminated soils⁵⁷.

Research has demonstrated that CK enhances shoot proliferation and biomass production, and results in a two-fold increase in Cd accumulation in Sedum alfredii cultivated in hydroponic systems and contaminated soils¹³. Various studies indicated that the exogenous application of CKs has a beneficial effect on plant growth and the efficiency of phytoextraction^58–61. It is well established that metal stress disrupts cellular functions and modifies nutrient uptake and transport mechanisms, which consequently hampers plant growth, development, and biomass production. Such interference also reduces photosynthetic activity, alters hormone signaling pathways, and induces oxidative stress, leading to damage to cellular components^62,63. It has been proposed that the adverse effects of metal exposure on plants could be mitigated by exogenous application of plant growth regulators (PGRs), which may enhance metal tolerance^64,65. Sabagh et al.⁶⁶ indicated that PGRs can effectively reduce metal toxicity in plants by increasing metal tolerance. Additionally, PGRs further enhance metal tolerance by stimulating metal-binding proteins and improving overall plant productivity in contaminated environments.

In safflower, increasing Cu sulfate concentration did not proportionally increase Cu accumulation in aerial tissues, while CKs reduced this uptake. Zhang et al.⁶⁷ reported that elevated Cu concentrations reduce root length and modify root morphology in Arabidopsis, mainly through disruption of auxin distribution and interference with nitric oxide signaling. In addition, the reduction in root elongation has been linked to increased root diameter, suggesting that cytoskeletal organization may represent a sensitive target of heavy metal toxicity, as proposed by Berni et al.⁶⁸. In agreement with these reports, the present study showed a decline in root length under Cu exposure, whereas root fresh weight tended to increase. Such responses indicate that Cu stress may inhibit normal root elongation while simultaneously promoting abnormal thickening, which can ultimately restrict water uptake and nutrient absorption and thereby limit shoot growth and biomass accumulation⁶⁹. Roots possess multiple protective mechanisms to cope with heavy metal toxicity, including limitation of metal uptake, regulation of transport processes, activation of antioxidant defense, sequestration of metals into vacuoles, and reinforcement of cell wall barriers through callose deposition^70,71. Moreover, heavy metals absorbed by roots may also be translocated to aerial tissues where they are compartmentalized, particularly within vacuoles, reducing their reactivity and toxicity⁷².

In the current study, Cu stress increased soluble carbohydrate levels, and BAP treatment further enhanced carbohydrate accumulation. This pattern may be attributed to a reduction in sink activity caused by Cu-induced growth inhibition, which results in decreased utilization of photoassimilates and subsequent sugar accumulation in leaf tissues. Excessive sugar buildup may negatively affect chloroplast structure and contribute to the decline in photosynthetic efficiency, thereby reducing chlorophyll content^73,74. The negative relationship between carbohydrate concentration and chlorophyll content observed in this study supports this interpretation⁷⁴.

Pevious investigations have also reported that CK application enhances soluble sugar accumulation in stressed plants. For instance, CK supplementation increased total soluble sugars inVigna radiata L. Wilczek⁷⁵ and Triticum aestivum L.⁷⁶ under unfavorable conditions, consistent with the trends observed here. Soluble carbohydrates are considered important osmoprotective compounds, contributing to osmotic adjustment and stabilization of cellular structures under stress. Increased carbohydrate accumulation has also been observed following kinetin treatment, highlighting the role of cytokinins in regulating carbon metabolism during stress responses⁷⁷. Moreover, plant growth regulators can promote stress tolerance by influencing assimilate partitioning and carbohydrate metabolism, which ultimately supports growth and productivity under adverse conditions^78,79.

Copper toxicity significantly reduced photosynthetic pigments in safflower, whereas BAP application partially alleviated this negative effect. Decline in chlorophyll under Cu stress has been linked to inhibition of pigment biosynthesis^74,80,81 as well as structural damage to chloroplast membranes^74,82. Additionally, deficiencies in essential nutrients can further diminish pigment concentrations. Furthermore, Cu-induced imbalance of essential nutrients may also contribute to pigment reduction. For example, chlorosis in young leaves under Cu stress has been associated with reduced iron (Fe) availability, which may occur due to competitive interactions between Cu and Fe ions at key metabolic sites⁷⁴.

The protective role of cytokinins on photosynthetic pigments has been reported in other plant species. Sameena et al.⁸³ demonstrated that CK treatment improved chlorophyll and carotenoid levels in R. communis L. under Cu stress, suggesting enhanced pigment stability and preservation of photosynthetic capacity. In addition, Talla et al.⁸⁴ reported that cytokinin application stimulated the expression of genes involved in chlorophyll cycling, leading to higher accumulation of chlorophyll intermediates in rice seedlings. Collectively, these observations suggest that CK treatment may contribute to maintaining chloroplast integrity and pigment stability under stress conditions by regulating chlorophyll metabolism and protecting photosynthetic structures.

Copper is an essential micronutrient involved in various metabolic processes in plants; nevertheless, elevated Cu availability may shift its role from beneficial to harmful. At toxic concentrations, Cu disrupts cellular functions by damaging key macromolecules such as proteins, lipids, and nucleic acids, ultimately impairing normal growth and development^85,86. Several studies have suggested that the application of plant growth regulators can reduce metal-induced damage by enhancing detoxification mechanisms and promoting the synthesis of protective compounds capable of binding or compartmentalizing excess metals. Consequently, hormonal regulation represents a practical approach to improve plant performance in metal-contaminated environments⁶⁶.

Cytokinins are particularly important in protecting the photosynthetic machinery and delaying senescence, thereby sustaining chloroplast function and maintaining pigment stability under stress conditions^87–89.

Under Cu exposure, plants frequently experience ROS overproduction, which activates antioxidant defense systems as a protective strategy. Antioxidant enzymes play a central role in limiting oxidative injury and preserving cellular integrity during Cu toxicity⁸⁵.

In the study of Salvinia natans, activities of SOD, POX, and ascorbate peroxidase (APX) significantly increased at a Cu concentration of 5 mg L^− 1, while catalase (CAT) activity decreased under higher Cu concentrations⁹⁰. In another investigation on Boehmeria nivea, Rehman, et al.⁹¹ found that SOD and POX activities were elevated with a Cu treatment of 200 mg kg^− 1, but these activities diminished at higher Cu levels of 300 mg kg^− 1 and 400 mg kg^− 1. Similarly, Contreras et al.⁹² reported that in Colobanthus quitensis, SOD, POX, and CAT activities increased with Cu exposure, whereas APX activity decreased. Younis et al.⁹³ demonstrated that in Phaseolus vulgaris, both SOD and CAT activity rose under low Cu doses but declined at elevated Cu levels. In contrast, glutathione reductase (GR) and APX activities significantly increased under Cu stress.

Previous investigations have demonstrated that exogenous application of phytohormones, including ABA and BAP, can enhance tolerance to heavy metal stress by strengthening ROS-scavenging capacity and improving antioxidant enzyme efficiency^18,19,94.

In the present study, the increased activities of POX and PPO observed under Cu stress in BAP-treated plants suggest that cytokinin supplementation may help maintain redox balance and limit oxidative damage. This response highlights the involvement of CK signaling in regulating enzymatic antioxidant defense systems under Cu toxicity conditions. The increased activities of POX and PPO observed in safflower under Cu stress in the presence of exogenously applied CK highlight the significant involvement of CKs in modulating ROS-mediated oxidative stress responses in plants exposed to Cu toxicity.

Our results showed that Cu stress significantly increased the accumulation of phenolic compounds and anthocyanins in safflower leaves, indicating activation of secondary metabolism as a protective response against Cu-induced oxidative stress. Secondary metabolites such as flavonoids, phenolics, and anthocyanins are widely recognized as stress-related compounds that contribute to tolerance by scavenging reactive oxygen species (ROS), stabilizing cellular structures, and chelating excess metal ion^95–97. Phenolic compounds can directly participate in detoxification processes through their antioxidant capacity, thereby reducing oxidative injury under Cu exposure⁹⁸. Ali, et al.⁹⁹ also reported that CuSO₄ treatment increased the activity of enzymes involved in phenolic and flavonoid biosynthesis in Panax ginseng roots, supporting the close relationship between phenolic metabolism and heavy metal stress adaptation. Similar increases in phenolic content under heavy metal exposure have been observed in maize leaves under Cd and Pb stress¹⁰⁰.

However, in the present study, exogenous application of BAP generally reduced total phenolic and anthocyanin contents under Cu stress compared with Cu-only treatments. This reduction may indicate that BAP alleviated Cu-induced oxidative stress, thereby reducing the need for high accumulation of secondary antioxidant metabolites such as phenolics and anthocyanins. Therefore, the decline in these compounds after BAP treatment may reflect improved physiological status and redox homeostasis rather than suppression of stress tolerance mechanisms, consistent with the roles of phytohormones in modulating antioxidant responses under heavy metal stress^101,102.

Given that gene expression levels indicate gene function¹⁰³, the expression of the PAL and SOD genes was evaluated. The findings indicated that BAP significantly enhanced the relative expression of PAL and SOD genes in safflower subjected to Cu stress. Research demonstrated that the combined application of BAP and Cu markedly increased PAL and SOD activity in Pleioblastus pygmaeus Miq¹⁰⁴.

The PAL enzyme is recognized as the initial enzyme in the anthocyanin biosynthetic pathway and is pivotal in regulating phenolic compound synthesis^105,106. Changes in total phenolic and anthocyanin content in both control and treated samples can be attributed to the corresponding changes in PAL gene expression. SOD activity is regarded as a critical first-line defense in plants, facilitating the dismutation of superoxide radicals into hydrogen peroxide^5,18.

The exogenous application of CK to plants under Pb stress was found to enhance Pb tolerance and elevate SOD activity¹⁰⁷. Furthermore, RT-qPCR analysis of the SOD gene expression in Nymphaea colorata demonstrated its responsiveness to various stressors, including heat, salinity, cold, cadmium chloride, and copper sulfate. The expression levels of the SOD gene exhibited variations at different time points¹⁰⁸.

Despite the valuable findings obtained in this study, some limitations should be acknowledged. The greenhouse experiment was conducted under controlled conditions; therefore, further validation under field environments is required to confirm the applicability of the results under natural variability. In addition, although several physiological and biochemical traits were evaluated, future studies including molecular and transporter-related analyses could provide deeper mechanistic insight into the role of BAP in alleviating Cu-induced stress.

Conclusions

Heavy metal contamination represents a significant global environmental issue that adversely impacts agricultural productivity and food safety. The environmental prevalence of Cu is escalating due to anthropogenic activities. The present study demonstrated that safflower is sensitive to elevated Cu concentrations, as reflected by reduced growth and enhanced oxidative stress. Exogenous application of BAP partially alleviated Cu-induced damage by improving antioxidant defense capacity and reducing oxidative stress markers, which contributed to improved plant growth under Cu stress. Overall, BAP application may be considered a promising approach to enhance safflower tolerance to Cu toxicity; however, further field validation and mechanistic investigations are required.

Author contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Hamidreza Aliakbari Liavoli and Farzaneh Najafi. The first draft of the manuscript was written by Zohreh Shirkhani and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

All data generated or analyzed during this study are included in this published article.

Declarations

Competing interests

The authors declare no competing interests.