Zasp52 in Drosophila melanogaster indirect flight muscles can serve as a model system to investigate the function of clinical variants causing myopathies

Abstract

The sarcomere is the basic contractile unit of muscle fibers, bordered by Z-discs. In Drosophila, Z-disc structure and maintenance rely on actinin, and the Z-band alternatively spliced PDZ-motif protein 52 (Zasp52), a member of the Alp/Enigma family. Zasp52 has been shown to bind actin, actinin, and itself, but its full range of functions remains unclear, as a null mutant has not been previously analyzed. To address this, we generated a CRISPR-based null mutant of Zasp52, deleting most of the ∼50 kb locus. Null mutants are viable but flightless and display severe defects in indirect flight muscle architecture. To test redundancy, we also analyzed a double null of Zasp52 and Zasp67, the latter one being a Zasp member restricted to flight muscles. Both single and double mutants exhibit damaged myofibrils, with the double mutant showing a more severe collapse of sarcomere organization. Given the clinical importance of LIM domain-binding 3 (LDB3) mutations, the human ortholog of Zasp52, we next modeled a pathogenic variant. In humans, the P615L mutation in LDB3 has been linked to cardiomyopathy and skeletal myopathy. We engineered the orthologous substitution, Zasp52-P607L, and expressed it in Drosophila indirect flight muscles. The variant produced enlarged sarcomeres and enhanced binding, consistent with a gain-of-function disease phenotype. Together, these findings indicate that Drosophila indirect flight muscles can be used as a system to dissect Zasp function, reveal redundancy in Z-disc assembly, and provide mechanistic insight into how conserved mutations contribute to human myopathies.

Graphical Abstract

Graphical Abstract.

This study investigates how Zasp proteins control muscle architecture and how disease-associated variants affect their function. Using Drosophila, Medina-Quintana et al. generated the first complete deletion of Zasp52, a key Z-disc protein, and showed that its loss disrupts myofibril structure and reduces sarcomere width. The authors also expressed a human disease variant, P615L, in indirect flight muscles and found it caused abnormal enlargement of sarcomeres. These results show that both normal and mutant human Zasp proteins have traceable effects in flies, indicating Drosophila is a suitable model to study conserved mechanisms of muscle assembly and human myopathies.

Introduction

Myofibril assembly is a complex and tightly regulated process in which the precise organization of contractile proteins ensures muscle fiber function. Each fiber contains hundreds of parallel myofibrils composed of repeating sarcomeres, which convert chemical energy into mechanical force for muscle contraction. Z-discs anchor actin thin filaments and serve as scaffolds for protein complexes essential for sarcomere stability. Disruption of Z-disc components frequently leads to severe structural defects, as well as muscle disorders in humans, highlighting the importance of Z-disc assembly in muscle integrity (Sparrow and Schöck 2009; Schöck and González-Morales 2022).

The Alp/Enigma family is a key player for the proper function of the sarcomere. These proteins are defined by their conserved PDZ, LIM, and ZM (Zasp motif) domains and have key roles as scaffold proteins modulating Z-disc structure and growth (Fisher and Schöck 2022). In vertebrates, the family includes 7 members, while Drosophila encodes 3: Z band alternatively spliced PDZ-motif protein 52 (Zasp52), Zasp66, and Zasp67. Zasp52 is the main protein of the family and colocalizes with α-actinin at the Z-disc (Katzemich et al. 2013). Zasp66 and Zasp67, which arose from gene duplications in early and higher insects, respectively, function redundantly with Zasp52 and contribute to sarcomere stability and Z-disc maintenance (Katzemich et al. 2013; González-Morales et al. 2019a). These proteins differ in their domain composition: Zasp52 possesses an N-terminal PDZ domain, a poorly conserved ZM domain, and 4 LIM domains—one more than its human ortholog LIM domain-binding 3 (LDB3; also called ZASP), which contains 3. In contrast, Zasp66 and Zasp67 lack LIM domains. Despite these differences, all 3 Zasp proteins have been shown to play redundant roles to maintain myofibrillar structure, with Zasp66 sharing expression and localization with Zasp52, and Zasp67 being specific to indirect flight muscles (IFM) (González-Morales et al. 2019a).

Zasp isoforms are classified as either “growing” or “blocking” depending on the presence or absence of LIM domains. Long Zasp52 isoforms promote Z-disc growth, while shorter isoforms—alongside Zasp66 and Zasp67—terminate growth (Katzemich et al. 2013; González-Morales et al. 2019b). This antagonistic balance ensures consistent Z-disc diameter, and its disruption has been linked to defects in myofibril organization and muscle function, features commonly associated with myofibrillar myopathies. However, the full range of Zasp functions is hidden by functional redundancy among the 3 Zasp proteins.

Mutations in Zasp proteins are increasingly recognized as drivers of muscle disease. Specific single amino acid substitutions in LDB3 cause autosomal dominant myopathies (Selcen and Engel 2005; Griggs et al. 2007; Sheikh et al. 2007). These myopathies are characterized by Z-disc disintegration and defects in sarcomeric organization involving LDB3 and other structural components (Claeys et al. 2008). To date, 27 missense mutations or single amino acid deletions in LDB3 have been conclusively linked to cardiomyopathy or skeletal myopathy (UniProt database). Twelve of these mutations are either identical or highly conserved in Drosophila Zasp52, offering a unique opportunity to test their in vivo impact in a genetically tractable system.

Here, we report the generation and analysis of a Zasp52 null mutant in Drosophila. We further generated a Zasp52 Zasp67 double null mutant, confirming previous RNAi knockdown experiments (Katzemich et al. 2013). We also compare overexpression of LDB3 and Zasp52 in IFM, showing partial functionality of human LDB3 in the IFM system. Finally, we investigate one of the aforementioned disease-associated variants, “P615L,” found within the long isoforms of LDB3, which affects the linker between human LIM1 and LIM2 domains and causes hypertrophic cardiomyopathy (Theis et al. 2006). As per UniProt (O75112-1), the amino acid position of this mutant is actually P608L in the LDB3 isoform 1 canonical sequence. We show that this disease-causing variant changes myofibril structure in vivo and enhances Zasp binding in vitro. This work demonstrates the suitability of Drosophila IFM for functional validation of clinical variants.

Materials and methods

Experimental model

All crosses were performed at 25 °C, except when using the Act88F-Gal4/UAS expression system for overexpression and rescue assays; in those cases, crosses were maintained at 18 °C. The Act88F-Gal4 driver (RRID: BDSC_38459) was used for strong, IFM-specific overexpression in Drosophila. The proteins overexpressed included UAS-Zasp52-PR, UAS-Zasp52-PR-P607L, and UAS-LDB3-I2, and UAS-mito-mCherry (RRID: BDSC_66532) as a control. These constructs were overexpressed in a w¹¹¹⁸ background (overexpression assays) and a Zasp52/Df(2R)BSC427 null mutant background (rescue assays). For yeast 2-hybrid assays, Saccharomyces cerevisiae was used, while Escherichia coli BL21 was employed for recombinant protein expression. A complete list of all strains used and generated, along with their respective identifiers (RRIDs), is provided in the Reagent Table, part of the Supplementary material.

Generation of Zasp52 and Zasp52 Zasp67 mutants

The Zasp52 null mutant was generated in the w¹¹¹⁸ genetic background through 2 sequential rounds of CRISPR/Cas9-mediated deletions and insertions performed by Genetivision. In the first round, exons 3 and 4 were removed, leading to the deletion of the PDZ domain (gRNAs: GTTGAGTAATGGTTACTAACCGG and TCAACTCATACTGAGCATTTGGG), while the second round deleted exons 13 and 14, resulting in the deletion of the last 3 LIM domains (gRNAs: CGAAGATCAAACCACCATGTCGG and GCGCGCGTGATTCTTGCAGAAGG). At deletion sites, FRT sites were inserted by homology-directed recombination (HDR) to flank the remaining sequence. GFP and red fluorescent protein (RFP) were introduced together with the FRT sites (Zasp52FRT1-2 mutant) as the modified intermediate, while the 20 kb Zasp52 intervening sequence was maintained. Deletion was performed by crossing Zasp52FRT1-2 mutants with a stock of heat shock-Flippase (Hs-Flp; RRID: BDSC_26901); offspring were heat-shocked at 37 °C 1 h a day for 3 consecutive days. Zasp52 null mutants were characterized by a lack of fluorescence of GFP and RFP and the deletion of all but the first 36 amino acids of PDZ and the last 6 amino acids of LIM4. The Zasp52 Zasp67 double null mutant was produced via genetic crosses with the previously characterized Zasp67 null mutant (González-Morales et al. 2019a). Using the commercially available deficiency stock (RRID: BDSC_24931), the heteroallelic combination, Zasp52/Df(2R)BSC427, was generated.

Molecular biology for the confirmation of Zasp null mutants

For Western blot analysis, 2 different protein concentrations were tested: proteins from a single fly thorax and half a fly thorax; both samples were homogenized in SDS sample buffer; proteins were separated by NuPAGE with a 3 to 8% polyacrylamide gradient (#WTA03812BOX). Proteins were transferred onto a Hybond-C Extra nitrocellulose membrane (GE Healthcare) and detected with a rabbit anti-Zasp52-full-length antibody (1:400) (Jani and Schöck 2007). Visualization was carried out using a goat horseradish peroxidase (HRP)-linked anti-rabbit IgG (RRID: AB_2721111) secondary antibody (1:5,000) and an Enhanced Chemiluminescence detection kit (Bio-Rad Laboratories; #1705060).

Total protein transfer was assessed by staining nitrocellulose membranes with Ponceau S for 10 min. Membranes were subsequently rinsed with distilled water and imaged. Total protein per lane was quantified using ImageJ2, and these values were used for normalization of Western blot signal.

For molecular confirmation, genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen; #69504), and RNA was isolated using the PureLink RNA Mini Kit (ThermoFisher Scientific; #12183018A) following the manufacturer's protocol. RNA was reverse transcribed with the High-Capacity RNA-to-cDNA Kit (ThermoFisher Scientific; #4387406). PCR was performed in accordance with the instructions of the ThermoFisher Scientific Phire Plant Direct PCR Kit (#F130WH). The absence of amplification in Zasp null mutants, compared to successful amplification in wild-type controls, revealed the deletion of Zasp genes. The PCR product from oligonucleotides spanning the deletion (FRT scar site) was sent for sequencing. Oligonucleotides were designed using FlyBase reference sequences. 1% agarose gels were run in a buffer solution containing Tris base, acetic acid, and EDTA-TAE. SYBR Safe DNA Gel Stain (Thermo Fisher Scientific; #S33102) was used to produce the final concentration of 0.1 μl/mL in the agarose gel for staining the DNA.

Oligonucleotide sequences used for PCR validation

Zasp52-FWD: TTTAGGTGTCTCGCTTGGTG; Zasp52-REV: TGTGCGTTTTGGGCGTT

Zasp66-FWD: ACAAAATCGCCTACACGCA; Zasp66-REV: CGATGGAACCTTGACCAAC

Zasp67-FWD: TTCCCTCCTTGACTACTTCCC; Zasp67-REV: GGTGTTGATGGTGTTGGTG

Zasp52scar-FWD: AGCAAGCTCCCGTATCCAAG; Zasp52scar-REV: GAAACCCTCCGTGCTTGAGT

tun-exon 1-FWD: GTCGATTGTCAATGCAACTGG; tun-exon 1-REV: GTGATTAAGCGAGCGAGACG

Generation of transgenes

Human LDB3 amino acid sequence (UniProt: O75112-1) was aligned with Drosophila Zasp52 sequence (FlyBase: FBgn0265991) by BLASTp (NCBI), which allowed search for conserved regions. The analysis validated that proline 608 in human LDB3 matches proline 607 in Drosophila Zasp52 and corresponds to the clinical variant mistakenly called “P615L” in the literature (Theis et al. 2006; Sheikh et al. 2007). The alignment further revealed that the LDB3 P608L substitution lies in the linker sequence of LIM1-LIM2 domains, whereas the corresponding Drosophila mutation, P607L, localizes to the linker sequence of the LIM2-LIM3 domains of Zasp52.

To introduce the Zasp52-P607L mutation, the Zasp52-RR sequence was reverse-translated using ExPASy. The codon encoding proline at position 607 (CCC) was changed to CTC, to generate a leucine substitution (Zasp52-P607L). The modified sequence as well as LDB3-I2 and wild-type Zasp52-RR was generated by Genscript and cloned into the pUASTattB vector together with a FLAG-Strep-His tag to facilitate protein purification and detection. Transgenic Drosophila carrying UAS constructs were generated by Genome Prolab. Site-directed integration using the PhiC31 system was used, with w + as the genetic marker and attP2 (3L) as the landing site. Transformants were screened and balanced accordingly. Western blots were run to support Gal4-driven expression, detected with mouse anti-Flag M2-peroxidase antibody (Sigma; RRID: AB_439702) and goat antimouse IgG secondary, HRP (Thermo Fisher Scientific; #31430).

IFM dissections and stainings

Dorsal longitudinal muscles (DLMs) of the IFM were dissected as described. Half-thoraces were glycerinated overnight at −20 °C in YMG buffer (20 mM Na-phosphate, 2 mM MgCl₂, 2 mM EGTA (ethylene glycol tetraacetic acid), 5 mM dithiothreitol (DTT), 0.5% Triton X-100, 50% glycerol). IFM-DLM were then dissected, washed, and fixed in 4% paraformaldehyde in relaxing solution (20 mM Na-phosphate, pH 7.2, 2 mM MgCl₂, 2 mM EGTA, 5 mM DTT, 5 mM ATP) containing protease inhibitors (Millipore Sigma, #11697498001).

For immunostaining, samples were incubated overnight with primary antibodies diluted 1:400 in a relaxing solution: rat anti-Kettin MAC155 (Developmental Studies Hybridoma Bank; RRID: AB_2889806) and rabbit anti-Obscurin Ig 14 to 16 (Burkart et al. 2007). For 2 h, secondary antibodies goat anti-rat Alexa Fluor 647 (RRID: AB_2896334) and goat antirabbit Alexa Fluor 488 (RRID: AB_2576217) were applied at a 1:500 dilution. Filamentous actin was stained with Alexa Fluor 594-Phalloidin (Thermo Fisher Scientific; #A12381) at 1:200 for 2 h. Samples were kept in ProLong Gold antifade solution (Thermo Fisher Scientific; #P36930) and mounted in Mowiol 4-88 mounting media (Sigma; #9002-89-5) before imaging. For consistency, all flies dissected for our experiments were one-day-old females.

Imaging

Confocal imaging was performed using a Leica TCS SP8 Confocal Microscope with an HC PL APO 63× oil objective (NA = 1.4). Fluorescence detection was achieved using laser lines at 488 nm for obscurin Ig 14 to 16, 552 nm for Alexa 594-phalloidin, and 638 nm for Kettin. Well-stained muscles were selected and aligned using the 63× objective with an additional 3× digital zoom. A large area at the muscle center was selected, and within this region, random areas were imaged at 3× digital zoom, with a pixel resolution of 1,024 × 1,024 and a frame average of 4×. At least 15 muscles were analyzed per condition. Representative phenotypes were highlighted by cropping selected regions of the scanned images.

Imaging of molecular assays, including Western blots, PCR products, and total protein stains, was performed using a Bio-Rad ChemiDoc Imaging System.

Quantification and statistical analysis

Image analysis was performed using Fiji (ImageJ; RRID: SCR_002285). Sarcomere width (defined as the diameter of the myofibril) was measured by analyzing at least 150 individual sarcomeres per phenotype across multiple fibers and biological replicates.

Western blot band intensities were quantified in Fiji using integrated density measurements. Total protein per lane, assessed by Ponceau S staining, was used for normalization. Background subtraction was performed using a region of identical size for each measurement prior to normalization.

GraphPad Prism v10.0 (RRID: SCR_002798) was used for statistical analysis and data visualization. Distributions were represented as violin plots, with all individual data points shown and the mean indicated. Because variance differed across genotypes, differences in mean sarcomere width were analyzed using Welch's one-way ANOVA followed by Dunnett's T3 multiple comparisons test. Mean (M), coefficient of variation (CV), and sample size (n) are reported. Statistical significance was defined as: n.s., not significant; *P ≤ 0.01; **P ≤ 0.001; ***P ≤ 0.0001.

Electron microscopy

Thoraces were dissected in buffer (100 mM sucrose, 100 mM Na-phosphate, pH 7.2, 2 mM EGTA) and fixed overnight at 4 °C in the same buffer with 3% paraformaldehyde and 2% glutaraldehyde. Samples were then washed in dissection buffer and fixed in 100 mM phosphate buffer with 1% OsO₄.

An ethanol series (25%, 50%, 70%, 90%, and 100%) was used for dehydration, and all the samples were incubated overnight in 100% ethanol. The samples were washed with epoxypropane the next day, and an Epon resin mixture (46% Epon 815, 28% DDSA, 24% NMA, and 2% DMP30) was prepared. Samples were subjected to 25%, 50%, and 100% Epon mix diluted with epoxypropane for resin infiltration. Thoraces were oriented in BEEM capsules and embedded in 100% Epon resin. Ultrathin sections were imaged with an FEI Tecnai G2 Spirit BioTwin 120 kV cryo-transmission electron microscope.

Plasmid generation

For the prey vectors, coding sequences corresponding to LIM2b + LIM3, LIM2b + LIM3 + LIM4, LIM2b + LIM3-P607L, and LIM2b + LIM3 + LIM4-P607L, including the linker sequences between protein domains, were synthesized by GenScript and cloned into the pGBKT7-BD (binding domain) yeast expression vector (RRID: Addgene_630489). The bait vector contained the Zasp66-PK sequence cloned into the pGADT7-AD (activation domain) plasmid (González-Morales et al. 2019b). Details of constructs and cloning strategies are listed in the Reagent table in the Supplementary material.

Plasmid constructs were amplified by transformation into Escherichia coli (RRID: CVCL_BL21). Competent bacterial cells were incubated in 50 mM β-mercaptoethanol for 10 min, adding plasmid DNA, and incubated on ice for 30 min. Cells were heat-shocked at 42 °C for 30 s and then plated on selective media that contained kanamycin or ampicillin. Single transformed colonies were inoculated into liquid culture and grown overnight under shaking at 37 °C.

Plasmid DNA was purified according to the manufacturer's instructions with an EZ-10 Spin Column Plasmid DNA miniprep Kit (BioBasic; #BS414). After bacterial lysis and neutralization, plasmid DNA was selectively adsorbed onto a silica gel-based column, washed to remove impurities, eluted, and stored at −20 °C.

Yeast 2-hybrid assays

For yeast 2-hybrid assays, we used the Matchmaker Gold yeast 2-hybrid system and the Yeastmaker yeast transformation system 2 (TakaraBio; #630439 and 630489). LIM domain plasmids in pGBKT7 were cotransformed with pGADT7, either empty or containing Zasp66-PK (FBpp0290377). Yeast cells were grown overnight in YPD liquid medium, washed 3 times with water, and once with 1× TE/lithium acetate (LiAc) solution. Cells were then resuspended in 50 μL of 1× TE/LiAc.

For transformation, 100 ng of plasmid DNA was mixed with 5 μL denatured Yeastmaker Carrier DNA (salmon sperm DNA, 10 μg/μL), 50 μL of competent yeast cells, and 500 μL Polyethylene Glycol (PEG)/LiAc solution. The mixture was incubated at 30 °C with shaking for 30 min. Then, 20 μL of dimethyl sulfoxide was added, and cells were heat-shocked at 42 °C for 15 min. After transformation, cells were pelleted, resuspended in 1 mL YPD Plus medium, incubated at 30 °C with shaking for 90 min, and subsequently washed and resuspended in 100 μL of water. Successful transformations were selected on tryptophan and leucine drop-out (−WL) plates. After 5 days, colonies were resuspended in 100 μL of water and spotted onto tryptophan, leucine, and histidine drop-out (−WLH) plates and tryptophan, leucine, histidine, and adenine drop-out (−WLHA) plates in a 1:5 serial dilution, with 5 mM 3-amino-1,2,4-triazole (3-AT; Sigma; #A8056) added.

Use of large language models

Text editing and language refinement were assisted by ChatGPT (GPT-5; OpenAI, 2025) and Grammarly (Grammarly Inc, 2025). These tools were used for correcting grammar and clarity, but not for writing, generating, or interpreting scientific results.

Results and discussion

Zasp52 null mutant generation and molecular validation

To generate a Zasp52 null allele, we employed a 2-step CRISPR strategy (Fig. 1). In the first step, deletions of the PDZ domain and the C-terminal LIM domains were flanked by RFP and GFP FRT cassettes (Fig. 1a–c), producing an intermediate allele (Zasp52FRT1-2). Subsequent FLP-mediated recombination excised the intervening ∼20 kb region, leaving only short N- and C-terminal fragments (Fig. 1d). Loss of GFP and RFP fluorescence confirmed successful excision.

Fig. 1.

CRISPR-based generation of the Zasp52 null mutant. a) Genomic locus and exon organization of Zasp52 (only one transcript shown), including the neighboring gene tun. Coding sequence is in orange and yellow. CRISPR deletions are indicated by dashed orange lines. Only one tun transcript is shown, which is nested within Zasp52, but 9 kb upstream of the start of the CRISPR deletion. The other 3 tun transcripts (not shown) are 64 kb upstream of the deletion and outside of the Zasp52 locus. Not drawn to scale. b) Conserved protein domains encoded by respective exons are indicated by blue arrows. c) Generation of the Zasp52FRT1-2 intermediate allele. Schematic showing N-terminal RFP-FRT and C-terminal GFP-FRT insertions flanking the Zasp52 locus. The PDZ domain was removed by deleting exons 3 and 4, while the final 3 LIM domains were removed by deleting exons 13 and 14. The ∼20 kb intervening sequence remains flanked by FRT sites. d) Final Zasp52 null allele generated by FLP-FRT recombination. Only 36 N-terminal amino acids of the PDZ domain encoded by exon 2 and 6 C-terminal residues of the LIM4 domain encoded by exon 15 remain, along with a residual FRT scar. e) Western blot validation of the Zasp52 null mutant using an antibody against full-length Zasp52. Two protein levels are shown: one adult fly thorax (green arrow) and ½ thorax (blue arrow). A molecular weight ladder is shown between conditions (BLUelf Prestained Protein Ladder), with selected bands (25, 75, and 245 kDa) marked prior to chemiluminescent detection (LICOR WesternSure Pen). Protein extracts were resolved on NuPAGE Tris-acetate gels. Genotypes analyzed include wild type (w¹¹¹⁸), the Zasp52FRT1-2 intermediate allele, and the Zasp52 null. In wild type, 2 Zasp52 isoforms are detected: Zasp52-PK (∼50 kDa) and Zasp52-PR (∼79.5 kDa), indicated by arrows. At higher protein loading, additional bands are observed, consistent with additional isoforms. In the Zasp52FRT1-2 mutant, no clear bands are detected at lower protein input; however, a faint band at ∼50 to 60 kDa is observed at higher loading, consistent with a truncated Zasp52 product retaining ZM and LIM1 domains. No Zasp52 signal is detected in the null mutant at either concentration. f) RT-PCR with primers targeting exon 1 of the nested gene tun using RNA isolated from w¹¹¹⁸ and Zasp52 null mutant. No differences in expression were detected. g) DNA sequence of PCR product spanning the Zasp52 null. Gray highlight: untranslated part of exon 15; yellow highlight: translated part of exon 15; cyan highlight: FRT scar; no highlight: intron 2.

Western blot analysis at 2 protein concentrations confirmed the deletion (Fig. 1e). At lower protein input (½ thorax equivalent), wild-type (w¹¹¹⁸) samples resolved into 2 distinct bands at approximately 80 and 50 kDa, consistent with the predicted sizes of Zasp52-PR (79.4 kDa) and Zasp52-PK (48.8 kDa), representing 2 major isoforms. In contrast, higher protein loading (1 thorax equivalent) resulted in signal saturation and the appearance of additional bands, consistent with additional isoforms. In the Zasp52FRT1-2 mutant, which retains only the ZM and LIM1 domains, no clear bands were detected at lower protein input. However, at higher loading, a faint band was observed at ∼60 to 70 kDa, consistent with a truncated Zasp52 product (see Supplementary Fig. 1 for a longer exposure). Finally, no signal was detected in the Zasp52 null mutant under either condition, consistent with the complete loss of Zasp52 protein. This result was further supported by normalization to total protein (Supplementary Fig. 1). Complementary PCR assays also confirmed deletion of the locus (Supplementary Fig. 2). We also performed RT-PCR against exon 1 of tun to confirm that expression of the nested gene tun is not affected in the Zasp52 null mutant compared to the wild type (Fig. 1f). Finally, we sequenced the region spanning the FRT scar site confirming the exact extent of the deletion in the Zasp52 null (Fig. 1g).

These findings support the creation of a Zasp52 null allele that deletes all annotated isoforms. While the intermediate allele preserved partial protein expression, the excised allele completely abolishes Zasp52 expression.

Prior alleles affected only subsets of Zasp52 isoforms, truncating the PDZ domain while preserving LIM-only isoforms and vice versa, and these alleles were viable (Liao et al. 2016). Remarkably, the Zasp52 null mutant is also viable but completely flightless. Our first reported allele, Zasp52^Δ, behaved as a hypomorphic lethal mutation over deficiency Df(2R)Jp1 (Jani and Schöck 2007). This indicates Zasp52^Δ carries a lethal second-site mutation that was missed at the time, because it must lie within Df(2R)Jp1.

Genetic combination of Zasp null mutants reveals additive muscle defects

To assess the role of Zasp isoforms in sarcomere size control, IFM myofibrils were analyzed in single and double mutant backgrounds (Fig. 2). Wild-type (w¹¹¹⁸) muscles displayed uniform sarcomere width and regular alignment of Z-discs and M-lines (Fig. 2a). In contrast, both the heteroallelic combination Zasp52/Df(2R)BSC427 and Zasp52 null mutants showed disrupted myofibrillar organization, including frayed myofibrils, reduced sarcomere width, and misaligned Z-discs (Fig. 2b and c). Zasp67 null mutants exhibited enlarged myofibrils and irregular sarcomere boundaries (Fig. 2d), whereas Zasp52 Zasp67 double mutants displayed severe disorganization, including fragmented and wavy myofibrils with disrupted Z-discs (Fig. 2e). All mutants were viable but completely flightless.

Fig. 2.

Cumulative disruption of myofibril organization in Zasp mutants. a-e) Confocal images of IFM-DLM from 1 day old female adult flies of the indicated genotypes. Actin filaments labeled with Alexa Fluor 594–phalloidin are shown in gray in the left column. Merged images of actin filaments in gray, Z-discs stained with anti-Kettin in purple, and M-lines stained with anti-Obscurin in green are shown in the right column. Selected Z-discs are indicated by asterisks. a) Wild-type (w¹¹¹⁸) IFM-DLM displays uniform sarcomere width (indicated by a yellow bracket) and regular alignment of Z-discs and M-lines. b, c) Zasp52/Df(2R)BSC427 and Zasp52 null mutants exhibit reduced sarcomere width, myofibril fraying, and Z-disc misalignment. d) Zasp67 null mutants show enlarged myofibrils and irregular sarcomere boundaries. e) Zasp52 Zasp67 double mutants show severe myofibrillar disruption, with fragmented sarcomeres, wavy myofibrils, and disordered Z-discs. f) Quantification of sarcomere width (myofibril diameter as indicated by the yellow bracket in a) across genotypes. Individual sarcomere measurements are shown, with mean values (M), coefficient of variation (CV), and number of sarcomeres analyzed (n) indicated for each genotype. Differences in mean sarcomere width were assessed using Welch's one-way ANOVA followed by Dunnett's T3 multiple comparisons test (GraphPad Prism v10). n.s., not significant; *P < 0.01; **P < 0.001; ***P < 0.0001. Scale bar: 5 µm.

Quantification confirmed these trends. Zasp52 loss-of-function resulted in reduced mean sarcomere width (Zasp52 null: 1.41 µm; Zasp52/Df: 1.26 µm), although it did not reach statistical significance in the Zasp52 null. There is high variability in both mutants compared to wild type, suggesting that size regulation of sarcomere width is disrupted. The difference between Zasp52 and Zasp52/Df may arise from genetic background effects or a secondary mutation introduced during CRISPR-mediated mutagenesis. Thus, we mostly used Zasp52/Df for further analysis. Zasp67 mutants showed increased width (1.89 µm) relative to wild type (1.50 µm), consistent with the proposed function as a blocking isoform. The double mutant showed the highest variability (CV = 45.7%), consistent with severely disrupted sarcomere organization.

These results support a model in which Zasp isoforms exert opposing effects on sarcomere size (González-Morales et al. 2019b). Loss of Zasp52, which includes growth-promoting isoforms, leads to reduced sarcomere width and shrunk phenotypes, whereas loss of Zasp67 results in enlarged sarcomeres, consistent with a growth-restricting function. The increased variability observed across all mutants indicates that these isoforms are also required to maintain sarcomere size uniformity. The severe disruption observed in Zasp52 Zasp67 double mutants further suggests that a balance between growth-promoting and growth-restricting isoforms is required to maintain both sarcomere size and structural integrity, consistent with conserved and potentially antagonistic roles of ZASP isoforms in vertebrate muscle.

More generally, similar antagonism is observed in vertebrate muscle, where LDB3/ZASP isoforms are differentially expressed across developmental stages, tissues, and pathological conditions. Exon 4-containing isoforms are prevalent in cardiac muscle, whereas exon 6 isoforms are restricted to skeletal muscle (Wadmore et al. 2021). High-molecular-weight isoforms are upregulated in failing rat hearts, while shorter isoforms remain stable (Abou Zeid et al. 2022). Moreover, deletion of long but not short isoforms in mice leads to dilated cardiomyopathy (Cheng et al. 2011). Together, these observations suggest that, as in Drosophila, ZASP isoforms play distinct and potentially antagonistic roles in sarcomere regulation, and that disruption of their balance can drive muscle disease.

Transmission electron microscopy confirms ultrastructural sarcomere defects in Zasp null mutants

Transmission electron microscopy was utilized for ultrastructural confirmation of confocal phenotypes (Fig. 3, Supplementary Fig. 3 for overview images). Sarcomeres of wild-type IFM displayed stereotyped organization with evenly spaced Z-discs and M-lines and tightly aligned filaments (Fig. 3a). Zasp52 null mutants showed prominent ultrastructural defects, including irregular Z-disc morphology, less dense Z-disc material, and often the absence of Z-discs and M-lines at the periphery of myofibrils (Fig. 3b). These abnormalities were exacerbated in Zasp52 Zasp67 double mutants, which displayed fragmented sarcomeres, collapsed or widened Z-discs, and striking variability in Z-disc density and spacing within individual myofibrils (Fig. 3c).

Fig. 3.

Transmission electron microscopy of Zasp mutants. Representative longitudinal sections of IFM-DLM. Z-discs and M-lines are annotated in each panel. a) Wild-type sarcomeres display regularly spaced Z-discs and M-lines, with consistent sarcomere width and well-aligned contractile elements. b) Zasp52 mutant exhibits important ultrastructural disorganization, including uneven Z-disc and M-line spacing (arrows), and reduction of Z-disc material (arrowheads). c) The Zasp52 Zasp67 double mutant presents a very severe phenotype, with disrupted sarcomeric alignment (arrows), Z-disc aggregates (asterisks), and less dense Z-disc material (arrowheads). Scale bar, 1 µm.

The electron microscopy data support the confocal results and indicate the requirements of both Zasp52 and Zasp67 to maintain sarcomere ultrastructure. The loss of Zasp52 already affects Z-disc alignment and sarcomere width, but the simultaneous loss of Zasp52 and Zasp67 causes the collapse of sarcomere organization. The progression in severity from single to double mutants highlights their cooperative and partially redundant roles in Z-disc structure stabilization.

This work confirms and extends previous electron microscopy analysis of siRNA knockdowns (Katzemich et al. 2013). It shows that Zasp proteins are necessary not only for sarcomere size regulation but also for architectural stability of Z-discs and integration with M-lines.

A cardiomyopathy-causing variant results in overgrowth of myofibrils

To test conservation of function, we first compared overexpression of Drosophila Zasp52-PR and its human ortholog LDB3 isoform 2 (LDB3-I2), which is shorter than isoform 1 but contains all conserved domains. We expressed them in IFM using Act88F-Gal4. As a control, we overexpressed UAS-mito-mCherry, a monomeric RFP marker used to visualize mitochondria, to assess whether the driver itself affected muscle structure. UAS-mito-mCherry expression did not significantly alter sarcomere width compared to wild type (w¹¹¹⁸ vs mCherry: n.s.), confirming that the Act88F-Gal4 driver does not perturb myofibril organization. In contrast, both UAS-Zasp52-PR and UAS-LDB3-I2 increased sarcomere width relative to control, suggesting at least partial conservation of function (Fig. 4a–c and e). Next, we aligned LDB3 and Zasp52 to generate the disease-linked Zasp52-PR-P607L variant, which mimics the human “P615L” mutant that causes hypertrophic cardiomyopathy heterozygously (Theis et al. 2006; Supplementary Fig. 4). Intriguingly, UAS-Zasp52-PR-P607L results in substantially wider sarcomeres than UAS-Zasp52-PR overexpression (means = 1.95 vs 1.69 µm, Fig. 4d and e).

Fig. 4.

Overexpression of Zasp52-PR variants differentially affects sarcomere size. a-d) Confocal images of IFM-DLM from 1 day old female adult flies of the indicated genotypes. Actin filaments labeled with Alexa Fluor 594–phalloidin are shown in gray in the left column. Merged images of actin filaments in gray, Z-discs stained with anti-Kettin in purple, and M-lines stained with anti-Obscurin in green are shown in the right column. Selected Z-discs are indicated by asterisks. All proteins were overexpressed using Act88F-Gal4. a) Overexpression of UAS-mito-mCherry in IFM-DLM does not affect sarcomere structure or width. b) Overexpression of human UAS-LDB3-I2 results in myofibrils with enlarged sarcomere widths and partially altered architecture. c) Overexpression of Drosophila UAS-Zasp52-PR increases sarcomere width while retaining overall alignment and structural regularity. d) Overexpression of the disease-associated variant UAS-Zasp52-PR-P607L further increases sarcomere width and induces irregular Z-disc spacing. e) Quantification of sarcomere width across genotypes. Zasp52-PR and LDB3-I2 overexpression both significantly increase width. Zasp52-PR-P607L overexpression increases sarcomere width significantly more than Zasp52-PR. Individual sarcomere measurements are shown, with mean values (M), coefficient of variation (CV), and number of sarcomeres analyzed (n) indicated for each genotype. Differences in mean sarcomere width were assessed using Welch's one-way ANOVA followed by Dunnett's T3 multiple comparisons test (GraphPad Prism v10). n.s., not significant; *P < 0.01; **P < 0.001; ***P < 0.0001. Scale bar: 5 µm.

These results show that human LDB3 retains in vivo activity and promotes sarcomere growth in Drosophila, while a disease-associated variant exerts conserved pathological effects. The moderate effect of Zasp52-PR suggests growth-promoting activity, whereas LDB3-I2 drives stronger enlargement, pointing to a conserved function but with quantitative differences in the Drosophila context. Together, these results indicate that the P607L variant exacerbates sarcomere overgrowth and disrupts Z-disc organization, consistent with a pathological gain-of-function phenotype.

The present results suggest that a similar mechanism controlling Z-disc organization and myofibril size likely operates in both vertebrates and Drosophila. Importantly, they provide in vivo evidence that human LDB3 retains activity in Drosophila muscle, validating this system for modeling disease variants. The distinctive phenotype of Zasp52-P607L parallels vertebrate studies, where mutations in human LDB3 correlate with specific disease defects. Pathak et al. (2021) demonstrated that a dysregulated myopathy-associated LDB3 mutation leads to Z-disc disorganization through PKCα–TSC2–mTOR misregulation, and Svaguša et al. (2024) reported “G1435A”, an uncommon LDB3 variant associated with both myofibrillar myopathy and hypertrophic cardiomyopathy. Clinical relevance is further underscored by reports of a severe human LDB3 phenotype in a fetus carrying a bi-allelic loss-of-function variant combining a deletion and an intronic mutation predicted to affect splicing (Koopmann et al. 2023), reminiscent of the early lethality observed in mouse knockouts (Zhou et al. 2001). Together with our overexpression data, these studies support a model in which LDB3 isoforms act in dose- and context-dependent roles at the Z-disc, and where perturbation by mutation or imbalance results in profound structural and pathological defects.

Yeast 2-hybrid assays revealed enhanced binding in Zasp52-PR-P607L

Given the specific sarcomeric overgrowth phenotype apparent when P607L is overexpressed, we tested whether P607L modifies Zasp protein interactions through yeast 2-hybrid assays (Fig. 5). Prior studies have demonstrated ZM domain interactions of Zasp66 and Zasp67 with Zasp52 LIM domains, implicated in sarcomere size regulation (González-Morales et al. 2019b). Thus, we expressed Zasp52 LIM domain constructs (LIM2-3 and LIM2-3-4), wild type or P607L-mutant, and tested their interactions with Zasp66, which contains only a PDZ and ZM domain. Binding was monitored by growth on –WLHA selective medium supplemented with 3-AT. Under the stringent conditions described, the interaction was supported by wild-type LIM domains, resulting in some growth. In contrast, P607L variants consistently showed more robust growth even in high-stringency and diluted conditions, with LIM2-3-4-P607L exhibiting the strongest signal.

Fig. 5.

Yeast 2-hybrid assay reveals enhanced binding between Zasp66 and Zasp52 carrying the P607L mutation. Yeast 2-hybrid assays were performed to test the interaction between Zasp66 (expressed in the activation domain vector pGADT7) and various Zasp52 LIM domain constructs (LIM2-3 and LIM2-3-4) or their corresponding P607L mutants (expressed in the binding domain vector pGBKT7). Yeast strains co-expressing these constructs were grown on −WLHA selective media to assess binding strength. Serial dilutions (undiluted, 1/5, 1/25, 1/125) are shown for both the negative controls (empty activation domain vectors) and the Zasp66 interaction assays. Growth was monitored in the presence of 5 mM 3-AT to suppress background histidine expression. Compared to wild-type LIM domains, P607L mutant constructs consistently displayed stronger growth on selective media, indicating enhanced binding to Zasp66. Both LIM2-3 and LIM2-3-4 showed increased interaction strength upon introduction of the P607L mutation.

These results indicate that the P607L mutation enhances binding between Zasp52 LIM domains and the Zasp66 ZM domain. This increased interaction likely alters the balance of Zasp dimerization at the Z-disc, potentially explaining the sarcomere enlargement and disorganization observed in overexpression assays. The data suggest that P607L is not a simple loss-of-function mutation but instead perturbs sarcomere architecture by shifting Zasp protein interaction dynamics.

Altered binding is a recognized pathogenic mechanism for LDB3 variants in vertebrates: dilated cardiomyopathy- and myofibrillar myopathy-associated mutations modulate affinity to partners such as PGM1, PKARII subunit, or α-actinin-2, and cause Z-disc defects (Zhou et al. 2001; Arimura et al. 2009; Lin et al. 2013). Beyond direct binding changes, LDB3 mutations can also trigger downstream pathway dysregulation (PKCα, TSC2–mTOR) that culminates in Z-disc disassembly (Pathak et al. 2021). An intriguing hypothesis proposed by González-Morales et al. (2019b) is that the temporal predominance of short vs long isoforms may underlie why sarcomeric sizes are highly stereotyped within a given muscle yet differ across muscle types. In this context, P607L could enhance interactions among long isoforms, shift isoform balance, and drive the overgrowth phenotype.

Together, these findings underscore that altered binding dynamics represent a recurrent mechanism by which LDB3 mutations cause muscle pathology. Our Drosophila yeast 2-hybrid results place P607L in this mechanistic class.

Zasp52-PR expression can partially rescue Zasp52 mutants

To determine whether the phenotypes of Zasp52/Df(2R)BSC427 mutants were specifically due to loss of Zasp52 and evaluate the contribution of individual isoforms, we performed rescue assays using Zasp52-PR, the disease-associated variant Zasp52-PR-P607L, and human LDB3 isoform 2 (LDB3-I2). Null mutants exhibited narrow sarcomeres, thin Z-discs, and disorganized myofibrils (Fig. 6a and b). Re-expression of Zasp52-PR restored sarcomere width, although it did not fully correct Z-disc and M-line misalignment or myofibril fraying (Fig. 6d). Similarly, expression of Zasp52-PR-P607L and LDB3-I2 produced sarcomeres comparable in size to those rescued with Zasp52-PR (Fig. 6c and e). None of the constructs could restore flight ability.

Fig. 6.

Rescue assays reveal a partial restoration of sarcomere structure. a-e) Confocal images of IFM-DLM from 1 day old female adult flies of the indicated genotypes. Actin filaments labeled with Alexa Fluor 594–phalloidin are shown in gray in the left column. Merged images of actin filaments in gray, Z-discs stained with anti-Kettin in purple, and M-lines stained with anti-Obscurin in green are shown in the right column. Selected Z-discs are indicated by asterisks. a) Wild-type (Act88F-Gal4 UAS-mito-mCherry) IFM-DLM display uniform sarcomere width and regular alignment of Z-discs and M-lines. b) The heteroallelic combination Zasp52/Df(2R)BSC427 exhibits disorganized sarcomeres, with reduced Z-disc size and frayed myofibrils. c-e) Expression of LDB3-I2, Zasp52-PR, and Zasp52-PR-P607L in the Zasp52/Df(2R)BSC427 null background restores sarcomere width, but sarcomeres are still disorganized and frayed. f) Quantification of sarcomere width across genotypes. Sarcomere width is significantly reduced in Zasp52/Df(2R)BSC427 mutants (mean = 1.30 µm) compared to wild type (mean = 1.50 µm, *** P < 0.0001). Expression of Zasp52-PR, Zasp52-PR-P607L, and LDB3-I2 restores width toward wild-type values (means = 1.61 µm; n.s vs wild type,1.54 µm; n.s vs wild type, and 1.47 µm; n.s vs wild type). Individual sarcomere measurements are shown, with mean values (M), coefficient of variation (CV), and number of sarcomeres analyzed (n) indicated for each genotype. Differences in mean sarcomere width were assessed using Welch's one-way ANOVA followed by Dunnett's T3 multiple comparisons test (GraphPad Prism v10). n.s., not significant; *P < 0.01; **P < 0.001; ***P < 0.0001. Scale bar: 5 µm.

Quantitative analysis confirmed these observations (Fig. 6f). All 3 constructs restored mean sarcomere width toward wild-type levels (Zasp52-PR: 1.61 µm; Zasp52-PR-P607L: 1.54 µm; LDB3-I2: 1.47 µm), with no significant differences relative to wild type (P > 0.01), in contrast to the reduced width observed in Zasp52/Df(2R)BSC427 mutants. However, this rescue was incomplete, as the coefficient of variation remained elevated and comparable to the mutant condition, indicating persistent defects in sarcomere size control.

These results show that the muscle defects observed in Zasp52/Df(2R)BSC427 mutants are attributable to the loss of Zasp52, as evidenced by the partial phenotypic rescue achieved with both Zasp52-PR and the clinical variant Zasp52-PR-P607L. The ability of P607L to rescue sarcomere width is consistent with its improved binding. A neomorphic function would result, which can replace some, but not all wild-type functions at the Z-disc. Similar phenomena have been reported: for example, a myopathy-associated LDB3 allele in mice retains some structural localization while disrupting protein stability and signaling interactions (Pathak et al. 2021). The modest activity of LDB3-I2 further indicates that human isoforms retain partial functional conservation but differ in their ability to fully support Drosophila Z-disc organization. Ecovoiu et al. (2022) have highlighted the relevance of heterologous rescue of orthologous human transgenes in mutant Drosophila melanogaster backgrounds. They suggested this model as a framework for genetic analysis of human disorders. They also emphasized that even partial functional improvement is a meaningful result and the utility of such models for studying human mechanisms of disease. This principle applies to our findings as well: LDB3-I2 showed a measurable rescue of myofibril width similar to that resulting from Zasp52-PR. The incomplete rescue of all our constructs is likely due to re-expressing only one isoform in a genetic background lacking all Zasp52 isoforms.

Overall, these data contribute to the understanding of the biology of Zasp by showing differences in rescue capacity between endogenous Drosophila isoforms and the human ortholog and similarity between the wild-type and disease-associated variants of Zasp52. Similarities were seen in other models of muscle disease, in which pathogenic alleles were able to rescue null phenotypes, again showing preservation of protein function, as reflected by our overexpression findings. The BAG3-P209L variant in zebrafish rescues myofibrillar disintegration in response to BAG3 loss in a disease model, reflecting an altered, not a lost, function (Ruparelia et al. 2014). The ability of LDB3-I2 to partially restore sarcomere structure implies preservation of core Zasp functions under evolutionary conditions and the restriction of cross-species compatibility. In this context, Drosophila provides an attractive in vivo test to examine the functional status of clinically relevant variants (Ecovoiu et al. 2022).

Data availability

The authors affirm that all data necessary for confirming the conclusions of this article are present within the article and its figures. Strains and plasmids are available on request.

Supplemental material available at G3 online.

Funding

This work was supported by operating grant PJT-178114 from the Canadian Institutes of Health Research to Frieder Schöck.

Conflicts of interest

The authors declare no conflicts of interest.