Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2025 Apr 27;33(4):1465–1480. doi: 10.1111/1744-7917.70060

Integrative role of CTPS cytoophidia in polyploid tissue growth and nutrient adaptation

Jiayi Hong 1,#, Jiamin Li 1,#, Yuanbing Zhang 2,*, Jing Wang 1, Chengui Li 1, Ji‐Long Liu 2,✉, Jingnan Liu 1,✉
PMCID: PMC13440992  PMID: 40287929

Abstract

Tissue growth and development are fundamental to organismal survival, requiring precise coordination of metabolic processes, nutrient availability, and signaling pathways. Cytidine triphosphate synthase (CTPS) is a rate‐limiting enzyme in nucleotide biosynthesis and assembles filamentous cytoophidia, conserved across species. Despite increasing interest in cytoophidia, how CTPS filaments integrate metabolic and signaling cues to drive cell size and tissue growth remains incompletely understood. Using RNA interference and clustered regularly interspaces short palindromic repeats (CRISPR) / CRISPR‐associate nuclease 9 gene editing, we generated CTPS‐knockdown and point‐mutated mutants to investigate the role of cytoophidia in cell growth. Specifically, we introduced the H355A mutation, which disrupts CTPS filament formation without affecting its enzymatic activity. Our findings revealed that CTPS depletion or filament disruption significantly impairs growth in polyploid organs, such as the fat body and salivary glands, underscoring the pivotal role of CTPS cytoophidia in cell growth regulation. Mutants lacking cytoophidia exhibited reduced DNA replication activity and smaller cell sizes compared to wild‐type controls. Mechanistically, we found that nutrient‐sensing pathways, particularly insulin‐PI3K‐Akt signaling pathway, regulate CTPS expression and cytoophidia formation in response to nutrient availability. Activation of the sterol regulatory element‐binding protein partially rescued the growth defects caused by CTPS depletion. These findings provide new insights into the molecular mechanisms of the regulation of CTPS filaments, highlighting their role as critical mediators of tissue growth by integrating environmental demands, metabolism, and signaling pathways to regulate cell size and nutrient adaptation.

Keywords: CTPS, cell size, cytoophidia, DNA replication activity, nutrient adaptation, tissue growth

Cytidine triphosphate synthase (CTPS) cytoophidia play a pivotal role in regulation of cell growth and nutrient adaptation. Tissue growth and development are fundamental to organismal survival, requiring precise coordination of metabolic processes, nutrient availability, and signaling pathways. CTPS is a rate‐limiting enzyme in nucleotide biosynthesis and assembles filamentous cytoophidia, conserved across species. Depletion of CTPS or disruption of its filaments led to significantly impaired growth in polyploid organs such as the fat body and salivary glands, suggesting that the formation of CTPS cytoophidia plays a pivotal role in regulation of cell growth. The nutrient‐sensing pathway, such as Insulin‐PI3K/AKT signaling pathway, regulates CTPS expression and cytoophidia formation in response to nutrient availability. Activation of the sterol regulatory element‐binding protein partially rescued the growth defects caused by CTPS depletion. These findings provide new insights into the molecular mechanisms of the regulation of CTPS filaments, highlighting their role as critical mediators of tissue growth by integrating environmental demands, metabolism, and signaling pathways to regulate endoreplication and cell size.

graphic file with name INS-33-1465-g001.jpg

Introduction

Proper regulation of cell size and tissue growth is essential for normal development and homeostasis in multicellular organisms (Ginzberg et al., 2015; Rhind, 2021; Jahant‐Miller et al., 2022). These processes are tightly governed by the interplay of metabolic pathways, growth factor signaling, and nutrient availability (Kellogg & Levin, 2022). Polyploidy, characterized by the replication of the genome without subsequent cell division, is a common mechanism in specific tissues that require increased cellular volume and metabolic capacity, such as the fat body and salivary glands in Drosophila melanogaster (Edgar & Orr‐Weaver, 2001). Disruptions in these processes can lead to impaired development and metabolic dysfunction, underscoring the importance of understanding the molecular mechanisms governing growth regulation.

Cytidine triphosphate synthase (CTPS) is a rate‐limiting enzyme in the de novo synthesis of CTP, catalyzing the ATP‐dependent transfer of amide nitrogen from glutamine to the C‐4 position of uridine triphosphate (UTP) (Lieberman, 1956; Levitzki & Koshland, 1969). Beyond its enzymatic role, CTPS can form filamentous structures (Ingerson‐Mahar et al., 2010; Noree et al., 2010), termed cytoophidia (Liu, 2010), which are conserved across species from bacteria to humans (Carcamo et al., 2011; Chen et al., 2011; Daumann et al., 2018; Zhou et al., 2020). Numerous studies have demonstrated that CTPS cytoophidia serve a variety of functions, including the regulation of enzymatic activity (Aughey et al., 2014; Aughey & Liu, 2015), the maintenance of cellular morphology (Ingerson‐Mahar et al., 2010; Aughey & Liu, 2015), and the stabilization of CTPS protein levels (Liu, 2016; Sun & Liu, 2019a), providing a mechanism for cells to modulate nucleotide biosynthesis in response to changing metabolic and environmental conditions. Recent studies showed that inhibition of the proto‐oncogene Cbl disrupts cytoophidium formation, and the protein level of the oncogene c‐Myc and mammalian Target of Rapamycin (mTOR) signaling is correlated with cytoophidium abundance and length in Drosophila (Wang et al., 2015; Aughey et al., 2016). The mTORC1/S6K1 signal axis mediates CTPS cytoophidium assembly in Drosophila oogenesis (Sun & Liu, 2019b). Additionally, cytoophidia have been identified in several human malignancies, such as hepatocellular carcinoma (Chang et al., 2017). It is worth noting that cytoophidia have been shown to play a structural role in adipose tissue by influencing integrin distribution and type IV collagen (Col IV) deposition (Liu et al., 2022). Fat body‐specific reduction of CTPS in Drosophila prevents high fat diet (HFD)‐induced obesity, reducing lipid accumulation by suppressing the PI3K‐Akt‐SREBP (sterol regulatory element‐binding protein) signaling axis (Liu et al., 2023). Despite these advances, the precise functional role of CTPS cytoophidia in tissue growth, cell size regulation, and nutrient sensing remains incompletely understood.

In Drosophila, the fat body serves as a key integrator of hormonal and nutritional signals to regulate larval growth and energy homeostasis (Arrese & Soulages, 2010; Li et al., 2019). Fat body cells undergo continuous endoreplication during larval stages, increasing their DNA content and cell size to meet the organism's developmental demands. The salivary glands, another model of polyploidy, also exhibit extensive endoreplication and have been widely used to study the relationship between cell growth and DNA replication. Our previous investigation revealed that CTPS cytoophidia are abundantly distributed in various tissues, including the central nervous system, fat body, and salivary gland (Zhang et al., 2020). It offers the opportunity to investigate how CTPS and its filamentous cytoophidia influence growth regulation at the cellular and organismal levels.

Growth factor signaling pathways such as insulin‐PI3K‐Akt are central regulators of cell growth, linking nutrient availability to anabolic processes (Lehner, 1999; Ginzberg et al., 2015; Rhind, 2021). These pathways are well‐established activators of endoreplication, protein synthesis, and lipid metabolism, making them ideal candidates for studying the interplay between metabolic signaling and CTPS filament dynamics. Previous studies have shown that nutrient deprivation can disrupt these pathways, leading to reduced growth. However, the precise role of CTPS filaments in mediating these responses in vivo remains largely unexplored.

In this study, we investigate the role of CTPS and its cytoophidia in regulating tissue growth, cell size, and nutrient adaptation in Drosophila. Using RNA interference (RNAi) and clustered regularly interspaces short palindromic repeats (CRISPR) / CRISPR‐associate nuclease 9 (Cas9)‐mediated mutant fly line, we revealed that CTPS is essential for tissue growth by regulating DNA replication. Furthermore, we examined the dynamic assembly and disassembly of CTPS filaments in response to nutrient availability and nutrient‐sensing signaling pathways, revealing their role in coordinating growth with metabolic and environmental cues. By linking CTPS filament dynamics to key growth regulatory pathways, this study provides new insights into the molecular mechanisms that govern cellular and organismal development.

Materials and methods

Generation of transgenic flies

The CRISPR/Cas9 technology was used to establish the C‐terminal mChe‐4V5 tagged CTPS knock‐in fly according to homology‐directed repair procedures as previously described (Bassett et al., 2013) at Fungene Biotech (http://www.fgbiotech.com). To generate transgenic UAS‐CTPSWT flies, the complementary DNAs (cDNAs) encoding Drosophila CTPS were produced by real‐time polymerase chain reaction (RT‐PCR) using the total RNAs extracted from the w1118 line (#3605, from the Bloomington Drosophila Stock Center), as previously described by researchers at the Core Facility of Drosophila Resource and Technology, SIBCB, CAS (Ni et al., 2008; Liu et al., 2023).

Fly strains

The GAL4/UAS system (Brand & Perrimon, 1993) was utilized for adipocyte‐specific expression or RNAi knockdown of the desired genes. The Cg‐GAL4 driver lines were obtained from the Bloomington Drosophila Stock Center (BDSC; Department of Biology, Indiana University, Bloomington, IN, USA). Cg‐GAL4 line was crossed with w1118 flies to generate the Cg‐GAL4>w1118 control lines. The fly lines were obtained from the Bloomington Drosophila Stock Center, including UAS‐CTPS‐RNAi (stock number 31924), UAS‐Akt‐RNAi (stock number 31701), UAS‐S6K‐RNAi (stock number 42572), and UAS‐SREBP Cdel (stock number 8243) or from the Vienna Drosophila RNAi Center, including UAS‐Akt‐RNAi (stock number V103703) and UAS‐Chico‐RNAi (stock number V10329).

Fly husbandry and diet preparation

Fly lines were raised on standard yeast‐cornmeal‐agar food comprising 250 g yeast, 92 g soy flour, 668 g cornmeal, 400 g sucrose, 420 g maltose, 60 g agar, 25 g methylparaben (dissolved in 95% ethanol), 10 g sodium benzoate, and 68 mL propionic acid in 10 L of de‐ionized water and cultured at 25 °C with 50% humidity under a 12 h light : 12 h dark cycle.

To prepare restricted diet (RD), we diluted the normal food with 3 times its volume of distilled water. For the yeast + restricted diet, we added 400 g of yeast to 10 L of the RD.

Starvation and re‐fed assay

To ensure that the larvae used in our study were at the appropriate developmental stage, we collect embryos for a maximum of 4 h. To achieve similar larval densities between control and experimental lines, we transferred 80 embryos to vials containing regular food. For the starvation assay, larvae aged 72–76 h after egg laying (AEL) were collected, thoroughly rinsed with water, and transferred using fine brushes onto filter paper moistened with phosphate‐buffered saline (PBS) in a Petri dish for durations of 2, 3, or 4 h. For the control on normal food, larvae were subjected to the same washing procedure and were placed on a Petri dish with a piece of normal food. For re‐fed treatment, starved‐larvae were then transferred onto a Petri dish with normal food for 2 h. Normal food consisted of a standard yeast‐cornmeal‐agar food, and the larvae were raised at 25 °C.

Measurement of larval hatch rate

The hatch rate refers to the percentage of successfully hatched larvae from the total number of eggs placed for hatching. The hatching conditions were maintained at 25 °C, 60% humidity, and a 12‐h light/12‐h dark cycle. Embryos were collected for a maximum of 4 h. To achieve similar larval densities between control and experimental lines, we transferred 80 embryos using a brush to vials containing regular food. The eggs were monitored every 12 h to track hatching progress. Successful hatching was defined as larvae that exhibited independent movement and survived for at least 12 h. The hatch rate was calculated using the following formula:

Hatchrate=NumberofsuccessfullyhatchedlarvaeTotalnumberofeggsplaced×100%

Immunohistochemistry

The fat body or salivary gland from larvae were dissected in Grace's Medium and then fixed in 4% formaldehyde in PBS for 15 min before immunofluorescence staining. For membrane staining, fixed fat bodies were washed twice for 5 min in PBS and then were incubated with 0.165 µmol/L Alexa Fluor 568 phalloidin (Invitrogen) in PBSTG (PBS + 0.1% Triton X‐100% + 0.5% normal goat serum) for 30 min at room temperature (RT). Then samples were rinsed in PBS twice for 5 min each and mounted in Vecta shield with 4ʹ,6‐diamidino‐2‐phenylindole (DAPI) (Invitrogen) (Zhang et al., 2009).

Imaging and image analysis

Fluorescent images were obtained by confocal laser‐scanning microscopy (Leica SP8). To compare the sizes of cells and nuclei, the images of the central focal/z section with the largest nucleus were collected. Approximately 250 adipocytes or 50 cells of salivary gland from each genotype were measured to quantify cell and nuclear size using FiJi‐ImageJ. We counted the length and number of CTPS cytoophidia in approximately 250 fat cells per larvae by analyzing 40× confocal images using FiJi‐ImageJ. The data were normalized by the number of cells in one image.

Measuring of DNA synthesis

Click‐iT EdU (5‐ethynyl‐2′‐deoxyuridine) Imaging Kits (Invitrogen by Thermo Fisher Scientific, Waltham, MA, USA) were used for directly measuring DNA synthesis in the fat body. The fat body tissues from 72–76 h AEL larvae were dissected in culture media (SigmaAldrich Inc., St. Louis, MO, USA) and cultivated for 2 h in M3 insect media supplemented with fetal bovine serum (12%), insulin (0.1%), antibiotic/antimycotic solution (1%), and 0.4 mmol/L EdU solution. After a 2 h incubation of the dissected tissues in solution of EdU, tissues were fixed in 3.7% formaldehyde in PBS for 30 min and then washed in PBS 3 times for 15 min each at RT. The last wash (15 min) was performed in PBS supplemented with 0.5% Triton X‐100. Blocking with bovine serum albumin (3% in PBS, 30 min at RT) was followed by incubation with the Click‐iT reaction cocktail overnight at 4 °C. The reaction cocktail containing Alexa Fluor azide and CuSO4 in reaction buffer was prepared according to the manufacturer's instructions for the Click‐iT EdU Imaging Kits. After rinsing with PBS (3 times for 15 min at RT), the tissues were stored and mounted in Vecta shield with DAPI (Invitrogen). Labeled cells were visualized under a confocal laser‐scanning microscope (Leica SP8).

Quantitative RT‐PCR

Total RNAs were prepared from the larvae from using the TRIzol reagent (TransGen Biotech, Beijing, China). cDNAs were synthesized with PrimeScript RT Master mix (Takara) followed by adding template RNA. 2× SYBR Green PCR Master Mix was purchased from Bimake. Real‐time quantitative PCR was conducted using the QuantStudionTM 7 flex System (Applied Biosytstems). For normalization, rp49 was utilized as the internal control. The oligonucleotide primers used were as follows: rp49: sense 5′‐TCCTACCAGCTTCAAGATGACC‐3′, antisense 5′‐CACGTTGTGCACCAGGAACT‐3′; CTPS: sense 5′‐GAGTGATTGCCTCCTCGTTC‐3′, antisense 5′‐TCCAAAAACCGTTCATAGTT‐3′; Brummer: sense 5′‐TCCCGAGTTTCTGTCCAAGT‐3′, antisense 5′‐GCGTCCTTTCTGTGCTTCTT‐3′; 4EBP: sense 5′‐AACCCTCTACTCCACCACTC‐3′, antisense 5′‐CAATCTTCAGCGACTTGG‐3′; Tor: sense 5′‐TGACGACTTTGAGACCGCACA‐3′, antisense 5′‐CATGGCTCCGTAGGCTCTTTC‐3′.

Statistical analysis

All data are presented as the mean ± standard errors of the mean (SEM) from at least 3 independent experiments. Statistical analysis was performed using unpaired two‐tailed Student's t‐test with GraphPad Prism 7.0. P < 0.05 was considered to be statistically significant.

Results

CTPS regulates cell size and tissue growth

The fat body plays a central role in the integration of hormonal and nutritional signals to regulate larval growth and body size. Fat body cells undergo continuous endoreplication and store numerous nutrient molecules during the larval stages (Li et al., 2019). To investigate the role of CTPS in tissue growth, we employed RNA interference (RNAi) to suppress endogenous CTPS expression using the fat body‐specific Cg‐Gal4 driver (Cg‐G4). This approach revealed a pronounced reduction in fat body in Cg‐G4>CTPS‐Ri flies compared to the control line Cg‐G4>w1118 (Fig. 1A, B). Furthermore, fat body cells in Cg‐G4>CTPS‐Ri flies were significantly smaller than those in the control line (Fig. 1C, D). Quantitative analysis indicated approximately a 20% decrease in cell size in Cg‐G4>CTPS‐Ri compared to the wild‐type control Cg‐G4>w1118 (Fig. 1E).

Fig. 1.

Fig. 1

Open in a new tab

Cytidine triphosphate synthase (CTPS) is required for both cellular and organismal growth in Drosophila. (A) The 3rd instar larvae expressing enhanced green fluorescent protein (eGFP) (green) with CgG4 driving CTPS knockdown in the fat body and the wild‐type control. (B) Quantification of eGFP intensity from (A). The values are normalized to the control line CgG4, eGFP>+ (10 images/genotype; 3 biological replicates). (C, D) Confocal images of fat bodies from 3rd instar larvae. Phalloidin (green) is used to reveal cell outline and 4ʹ,6‐diamidino‐2‐phenylindole (DAPI) (white) is used to reveal the nuclei in fat bodies. Scale bars, 50 µm. (E) Quantification of cell size from (C, D) (20 images/genotype, 3 biological replicates). (F) The 3rd instar larvae expressing eGFP (green) with pplG4 driving CTPS knockdown in the fat body and the wild‐type control. (G) Quantification of salivary gland size from (H, I) (20 images/genotype; 3 biological replicates). (H, I) Confocal images of salivary glands from 3rd instar larvae. Phalloidin (red) is used to reveal cell outline and DAPI (blue) is used to reveal the nuclei in fat bodies. Scale bars, 50 µm. (J) Quantification of cell size from (H, I) (20 images/genotype, 3 biological replicates). All data are shown as mean ± standard error of the mean. *P < 0.05, ***P < 0.001, and ****P < 0.0001 by Student's t‐test.

To further explore the role of CTPS, we inhibited its expression in the salivary glands using the ppl‐Gal4 driver (ppl‐G4). DAPI and phalloidin staining of the salivary glands revealed that RNAi‐mediated CTPS depletion resulted in small, underdeveloped glands, which contained a comparable number of cells to wild‐type salivary glands (approximately 100–120 cells per gland) (Fig. 1F, H; Fig. S1A). However, these cells exhibited smaller nuclei, indicative of a marked reduction in endoreplication in ppl‐G4,eGFP>CTPS‐Ri glands compared to wild‐type ppl‐G4,eGFP>w1118 glands (Fig. 1H, I). Quantitative measurements demonstrated an approximately 90% reduction in cell size in ppl‐G4,eGFP>CTPS‐Ri glands relative to the wild‐type control (Fig. 1J).

CTPS filaments are required for regulating cell size and tissue growth

To investigate whether CTPS regulates tissue growth through its filamentous structure, we used CRISPR/Cas9‐mediated knock‐in technology to integrate the fluorescent protein gene encoding mCherry into the C‐terminal of CTPS (CTPS‐mCherry line). To investigate the role of CTPS polymerization, we generated a H355A point mutant using CRISPR/Cas9 knock‐in, replacing His355 with alanine, a smaller, uncharged residue predicted to disrupt polymerization without affecting enzymatic activity (Lynch et al., 2017; Zhou et al., 2021). To facilitate detection in various assays, the mutant CTPS was fused with mCherry and 3 × hemagglutinin (HA) tags at its C‐terminus (CTPS H355A‐mCh line) (Liu et al., 2022). Analysis revealed that the body size of both larvae and adult flies in the CTPS H355A‐mCh line was significantly smaller compared to the CTPS‐mCh flies (Fig. 2A). Additionally, the body weight of male adults and 3rd‐instar larvae in the CTPS H355A‐mCh line was markedly reduced relative to the CTPS‐mCh flies (Fig. 2B). The absence of CTPS filaments resulted in a reduction in body size (Fig. 2C) and slowed growth rates across the 1st (L1), 2nd (L2), and 3rd‐instar larval (L3) stages (Fig. 2D). Cells in the fat body and salivary gland of CTPS H355A‐mCh mutants were significantly smaller than those in the control line (Fig. 2G, I). Quantitative analysis revealed an approximate 30% reduction in fat body cell size and a 50% reduction in salivary gland cell size. However, the total cell number in the salivary gland remained comparable to that of the control line (Fig. 2K). These findings suggest that the loss of CTPS polymerization leads to impaired larval and adult growth, reduced cell size in polyploid tissues, and slower developmental progression. Further examination revealed that the loss of CTPS filaments significantly decreased the hatching rate from eggs to 1st‐instar larvae (Fig. 2E). However, the survival rates of larvae in the CTPS H355A‐mCh line were comparable to those of the wild‐type control (Fig. 2F). To assess whether CTPS filaments sufficiently promote tissue growth, we generated UAS CTPSWT transgenic flies and overexpressed CTPS using the ubiquitous actin‐Gal4 driver. Expression of a constitutively active CTPSWT did not result in increased body size (Fig. S2A, B, D, E) or body weight (Fig. S2C, F) in female or male adults. These findings indicate that CTPS filament formation is necessary but not sufficient for promoting tissue growth.

Fig. 2.

Fig. 2

Open in a new tab

H355A mutation in cytidine triphosphate synthase (CTPS) leads to growth defects in Drosophila. (A) Representative images of flies expressing wild‐type or H355A mutant CTPS, showing the morphology of 3rd instar larvae (left), adult females (middle), and adult males (right). (B) Body weight of flies with wild‐type or H355A mutation CTPS from 3rd instar larvae (left panel), adult females (middle panel), and adult males (right panel). (C) Representative images illustrating the morphology of 1st, 2nd, and 3rd instar larvae expressing wild‐type or H355A mutant CTPS. (D) Body weight analysis demonstrating the growth rate of larvae expressing wild‐type or H355A mutant CTPS. (E) Hatch rate of the laying eggs by flies expressing wild‐type or H355A mutant CTPS. (F) Survival rate analysis of larvae expressing wild‐type or H355A mutant CTPS. (G) Confocal images of fat bodies from 3rd instar larvae. Phalloidin (green) is used to reveal cell outline of the cells and 4ʹ,6‐diamidino‐2‐phenylindole (DAPI) (white) is used to reveal the nuclei in fat bodies. Scale bars, 50 µm. (H) Quantification of cell size from (G) (20 images/genotype, 3 biological replicates). (I) Confocal images of salivary gland from 3rd instar larvae. Phalloidin (green) is used to reveal cell outline of the cells and DAPI (white) is used to reveal the nuclei in fat bodies. Scale bars, 50 µm. (J) Quantification of cell size from (I) (20 images/genotype,3 biological replicates). (K) Quantification of cell number of salivary gland in wild‐type or H355A mutant CTPS larvae (20 images/genotype, 3 biological replicates). All data are shown as mean ± standard error of the mean. ns, not significant, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 by Student's t‐test.

CTPS cytoophidia regulate DNA replication activity

Drosophila larval fat body is composed of large polyploidy adipocytes. Endoreplication is a key driver of polyploidy and metabolic capacity in the larval fat body. Around 8 h post‐hatching, the previously quiescent fat body cells resume endoreplication, typically undergoing 256 cycles throughout the larval developmental stages (Edgar & Orr‐Weaver, 2001). To investigate whether CTPS regulates cell size via endoreplication, DNA replication activity was detected by visualization of incorporated EdU. Analysis revealed that absence of CTPS filaments due to either inhibition of CTPS expression or a point mutation that specifically abrogates its polymerization ability, caused decreased DNA replication activity up to 85% or 64%, respectively (Fig. 3A–C‧, D). These results implicate CTPS filaments in the promotion of DNA replication, and suggest their essential role in the growth of polyploid tissues.

Fig. 3.

Fig. 3

Open in a new tab

Loss of cytidine triphosphate synthase (CTPS) filaments suppressed DNA synthesis in adipocytes in Drosophila. (A−C’) Immunofluorescence for 5‐ethynyl‐2’‐deoxyuridine (EdU) (green) of fat bodies from 3rd instar larvae for DNA replication activity using Click‐iT EdU (green). 4ʹ,6‐diamidino‐2‐phenylindole (DAPI) (white) is used to reveal the nuclei in fat bodies (20 images/genotype, 3 biological replicates). Scale bars, 20 µm. (D) Quantification of DNA replication activity from (A−C’). All data are shown as mean ± standard error of the mean. ns, not significant, *P < 0.05, and ***P < 0.001 by one‐way analysis of variance with a Tukey post hoc test.

The dynamical formation of CTPS cytoophidia responds to nutrient availability

Cells and tissues are highly dynamic systems that adjust their metabolism and structural organization in response to fluctuating nutrient availability. Starvation, a physiological state that disrupts nutrient‐sensing pathways and imposes metabolic stress, provides an ideal context to investigate the adaptive role of cytoophidia. To examine the behavior of cytoophidia under conditions of food deprivation, larvae reared on normal food (72−76 h AEL) were washed and subjected to nutrient starvation. Following 2 or 4 h of starvation, larval fat bodies were dissected and imaged.

Strikingly, starvation stress led to a rapid and significant decrease in CTPS messenger RNA (mRNA) levels, with reductions of 77.4% and 83.8% observed after 2 or 4 h of starvation, respectively (Fig. 4F). We also measured transcript levels of the starvation responsive genes including 4EBP, Brummer, and Tor by qRT‐PCR. Here, 4E‐BP is strongly up‐regulated during starvation, as well as Brummer, a homology of adipocyte triglyceride lipase (ATGL) in mammals (Fig. 4F). Starvation resulted in a marked reduction in mCherry‐tagged CTPS cytoophidia compared to well‐fed conditions (Fig. 4A–C). Quantitative analysis revealed a significant reduction in cytoophidia formation, with decreases of 38.0% and 76.2% observed after 2 or 4 h of starvation, respectively, relative to the fed condition (Fig. 4A–D). The average length of CTPS cytoophidia was also reduced, decreasing from 6.00 µm (standard deviation [SD] ± 1.58 µm) under fed conditions to 4.68 µm (SD ± 2.11 µm) and 3.66 µm (SD ± 1.43 µm) following 2 or 4 h of starvation, representing reductions of 22% and 39%, respectively (Fig. 4E). The results indicated that CTPS cytoophidia disassemble rapidly in response to food deprivation.

Fig. 4.

Fig. 4

Open in a new tab

Cytidine triphosphate synthase (CTPS) cytoophidia disassembled upon food deprivation. (A–C) Confocal images of fat bodies from the larvae at 76–80 h after egg laying (AEL) under fed, 2 h‐starved, or 4 h‐starved conditions. 4ʹ,6‐diamidino‐2‐phenylindole (DAPI) (blue) is used to reveal the nuclei in fat bodies. Scale bars, 100 µm. (D) Quantification of the number of the cytoophidia shown in (A–C). The relative value is normalized with the larvae under fed conditions (20 images/genotype; 3 biological replicates). (E) Quantification of the length of the cytoophidia shown in (A‐C) (20 images/genotype; 3 biological replicates). (F) Quantitative real‐time polymerase chain reaction analysis of messenger RNA (mRNA) abundances of representative genes in the fat body lysates of 76–80 h AEL larvae under fed, 2‐h starvation or 4‐h starvation conditions (30 larvae/group; 4 groups/genotype; 2 biological replicates). All data are shown as mean ± standard error of the mean. *P < 0.05 and ****P < 0.0001 by one‐way analysis of variance with a Tukey post hoc test.

To further investigate whether CTPS can assemble into cytoophidia upon nutrients availability, larvae (72−76 h AEL) were starved for 3 h and then transferred to appropriate nutrient conditions for 2 h to be re‐fed. We found that re‐feeding increased CTPS cytoophidia formation in comparison with food deprivation, even back to normal fed conditions (Fig. 5A–D). Quantification showed that reduction of cytoophidia formation was 62.7% in 3 h starvation, as compared to fed conditions (Fig. 5A, B, E). Interestingly, larvae upon re‐feeding exhibited 39.1% increased cytoophidia formation as compared with starved conditions (Fig. 5D, E). Thus, it appears that the average length of CTPS cytoophidia was reduced 62.6% from 6.87 µm (SD ± 2.66 µm) in fed conditions to 2.58 µm (SD ± 0.98 µm) after food deprivation for 3 h. After 2 h re‐feeding, the average length of CTPS cytoophidia was increased to 5.59 µm (SD ± 1.83 µm), with 101% augment compared to starved conditions (Fig. 5B–D, F). Furthermore, a RD dramatically reduced CTPS cytoophidia formation in the fat body, an effect that was reversed by the addition of yeast to the diet (Fig. 5G–K). These findings collectively demonstrated that CTPS cytoophidia dynamically assemble and disassemble in response to nutrient availability, highlighting their role in nutrient adaptation.

Fig. 5.

Fig. 5

Open in a new tab

Cytidine triphosphate synthase (CTPS) cytoophidia dynamically assembled/disassembled upon nutrient availability. (A) Quantitative real‐time polymerase chain reaction analysis of CTPS messenger RNA (mRNA) abundances in the fat body lysates of 75−80 h after egg laying (AEL) larvae under fed, starved or re‐fed conditions (30 larvae/group; 4 groups/genotype; 2 biological replicates). (B−D) Confocal images of fat bodies from the larvae at 75−80 h AEL under fed, starved or re‐fed conditions. 4ʹ,6‐diamidino‐2‐phenylindole (DAPI) (blue) is used to reveal the nuclei in fat bodies. Scale bars, 150 µm. (E) Quantification of the number of the cytoophidia shown in (B−D). The relative value is normalized with control larvae (20 images/genotype; 3 biological replicates). (F) Quantification of the length of the cytoophidia shown in (B−D) (20 images/genotype; 3 biological replicates). (G−I) Confocal images of fat bodies from the larvae at 72−80 h AEL under normal diet (ND), restricted diet (RD), or RD+Yeast conditions. DAPI (white) is used to reveal the nuclei in fat bodies. Scale bars, 100 µm. (J) Quantification of the length of the cytoophidia shown in (G−I). The relative value is normalized with the larvae under ND conditions (20 images/genotype; 3 biological replicates). (K) Quantification of the number of the cytoophidia shown in (G−I). The relative value is normalized with the larvae under ND conditions (20 images/genotype; 3 biological replicates). All data are shown as mean ± standard error of the mean. ns, not significant, *P < 0.05, **P < 0.01, and ****P < 0.0001 by one‐way analysis of variance with a Tukey post hoc test.

Insulin‐PI3K‐Akt signaling regulates CTPS expression and cytoophidia formation

The insulin‐PI3K‐Akt pathway is a well‐established regulator of cell growth. Under conditions of nutrient deprivation, the metabolic pathway is downregulated, triggering cellular adaptations to conserve resources and maintain homeostasis (Kozma & Thomas, 2002). Consistent with this, knockdown of Pi3k or Akt, key components of the PI3K‐Akt pathway, resulted in reduced adipocyte size (Fig. S3A−D, E), decreased salivary gland organ size (Fig. S3F−I, J), and smaller salivary gland cell size (Fig. S3F’−I’, K). Given the dynamic response of CTPS cytoophidia to nutrient availability, we hypothesized that their formation might be regulated by the metabolic pathway. To investigate this potential regulatory role, we employed RNAi to target key elements of the insulin‐PI3K‐Akt signaling cascades, including Chico, Pi3k, Akt, and S6K, within the fat body. Analyses revealed that CTPS cytoophidia formation were significantly decreased (Fig. 6C, D, and E) after knockdown of these genes compared to the wild‐type control (Fig. 6A). The reduction of cytoophidia formation was 88.2%, 86.6%, 71.5%, 58.5%, and 84.6% in Cg G4>CTPS‐Ri, Cg G4>Pi3k‐Ri, Cg G4>Chico‐Ri, Cg G4>Akt‐Ri and Cg G4>S6K‐Ri, respectively, as compared to wild‐type control (Fig. 6G). The Cg‐Gal4 driver specifically induces gene expression in the fat body, not in the salivary gland. Therefore, in Cg G4>CTPS Ri, Cg G4>Pi3k‐Ri, Cg G4>Chico‐Ri, Cg G4>Akt‐Ri and Cg G4>S6K‐Ri flies, the CTPS‐mCherry red signal is significantly reduced in the fat body due to RNAi‐mediated knockdown, while the salivary gland remains unaffected (marked by the yellow dashed box in Fig. 6B, C, E) and still exhibits a strong CTPS‐mCherry red signal.

Fig. 6.

Fig. 6

Open in a new tab

Cytidine triphosphate synthase (CTPS) cytoophidia formation was diminished upon inhibition of the insulin‐PI3K‐Akt signaling pathway. (A−F) Confocal images of fat bodies from 3rd instar larvae. 4ʹ,6‐diamidino‐2‐phenylindole (DAPI) (white) is used to reveal the nuclei in fat bodies. The yellow dash box presents the salivary gland. Scale bars, 100 µm. (G) Quantification of the number of the cytoophidia shown in (A−F). The relative value is normalized with control larvae (20 images/genotype; 3 biological replicates). (H) Quantitative real‐time polymerase chain reaction analysis of CTPS messenger RNA (mRNA) abundances in the fat body lysates of 76−80 h after egg laying (AEL) larvae from the indicative genotypes (30 larvae/group; 4 groups/genotype; 2 biological replicates). All data are shown as mean ± standard error of the mean. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 by Student's t‐test or one‐way analysis of variance with a Tukey post hoc test.

To further elucidate the underlying molecular mechanisms, we assessed the expression levels of CTPS mRNA via qRT‐PCR. Inhibition of growth factors caused dramatic down‐regulation of CTPS (Fig. 6H), consistent with the observed reduction in cytoophidia formation. Thus, the results suggested the down‐regulation of CTPS by the insulin‐PI3K‐Akt pathway contributes to the impaired assembly of cytoophidia under nutrient deprivation.

Given the pivotal role of SREBP‐1 in transducing the insulin signal (Ferre & Foufelle, 2007), we investigated whether activation of SREBP could rescue the defects in cell growth and tissue size caused by CTPS depletion. Intriguingly, we found that overexpressing the truncated, constitutively active form of SREBP (SREBP Cdel), which localizes to the nucleus, partially rescued the reduction in cell size (Fig. 7B–D’, E) and the smaller salivary gland size (Fig. 7A, E) resulting from CTPS deficiency. These results suggest that SREBP activation can partially compensate for the growth defects caused by CTPS deficiency.

Fig. 7.

Fig. 7

Open in a new tab

Overexpression of sterol regulatory element‐binding protein (SREBP) partially rescued tissue growth induced by CTPS knockdown in Drosophila. (A) The 3rd instar larvae expressing enhanced green fluorescent protein (eGFP) (green) with ppl G4 driving CTPS‐Ri or SREBP Cdel + CTPS‐Ri in the salivary gland and the wild‐type control. (B−D’) Confocal images of salivary glands from 3rd instar larvae. 4ʹ,6‐diamidino‐2‐phenylindole (DAPI) (white) is used to reveal the nuclei in fat bodies. Scale bars, 60 µm (B–D), 30 µm (B’−D’). (E) Quantification of organ size (right) and cell number (left) of salivary gland in (B−D) (20 images/genotype; 3 biological replicates). All data are shown as mean ± standard error of the mean. **P < 0.01 and ****P < 0.0001 by one‐way analysis of variance with a Tukey post hoc test.

Discussion

It is increasingly clear that numerous cellular processes are influenced by, or even dependent on, cell size. Therefore, elucidating the mechanisms that govern cell size is essential for a comprehensive understanding of cell physiology. This study highlights the pivotal role of CTPS and its filamentous cytoophidia in regulating cell size, tissue growth, and nutrient adaptation in D. melanogaster. Through a combination of genetic and biochemical approaches, we demonstrated that CTPS filament formation is a critical mechanism linking cellular processes to metabolic cues, such as cell size control and nutrient sensing, which are essential for proper tissue development and growth.

Structural importance of CTPS filaments in tissue growth

Cell size and tissue growth can change in response to environmental factors or intrinsic signaling cues (Rhind, 2021; Rizzo et al., 2024). In this study, we demonstrated that depletion of CTPS via RNAi‐mediated knockdown in the fat body and salivary glands led to a significant reduction in both tissue and cell size. This reduction is closely associated with decreased DNA synthesis activity, suggesting that CTPS is essential for maintaining polyploidy—a process critical for the metabolic and storage functions of the fat body during development. Notably, the decrease in tissue size observed in CTPS‐deficient flies occurred independently of changes in cell number, reinforcing the role of CTPS in promoting cell growth rather than cell proliferation in the salivary gland.

The structural and functional significance of CTPS filaments was further investigated using the H355A mutant, which disrupts filament formation without compromising enzymatic activity (Lynch et al., 2017; Liu et al., 2022; Liu et al., 2023). We found that mutations preventing filament assembly resulted in reduced body size and delayed development, underscoring the critical role of cytoophidia in growth regulation. Moreover, disruption of CTPS filaments significantly impaired DNA replication activity, indicating that cytoophidia are necessary to support the high rates of DNA synthesis required for polyploid cell expansion. Interestingly, overexpression of wild‐type CTPS did not increase body size, suggesting that while filament formation is required for growth, it alone is not sufficient to drive tissue hypertrophy. These findings suggest that cytoophidia, while not strictly required for CTPS enzymatic function, may play additional regulatory roles in cellular metabolism.

The impact of CTPS polymerization on its enzymatic activity remains a subject of debate. Studies in Saccharomyces cerevisiae and Escherichia coli suggest that filamentation inhibits CTPS activity (Barry et al., 2014; Noree et al., 2014), whereas in vitro studies have reported that polymerization enhances its catalytic function (Lynch et al., 2017). The recent findings reveal a marked increase in the prevalence of CTPS cytoophidium across multiple human malignancies, including colorectal, prostate, and hepatic cancers (Chang et al., 2017). Given the high nucleotide demands of rapidly proliferating cancer cells, cytoophidia may confer a selective advantage by enabling the rapid upregulation of enzymatic activity, particularly when polymerization outpaces transcriptional activation. However, whether cytoophidia serve as structural scaffolds for additional regulatory factors remains an open question.

Emerging evidence suggests that filamentous assemblies of metabolic enzymes play a broader role in cellular organization, including stabilizing proteins, modulating enzyme activity, and orchestrating metabolic processes under specific conditions (Sun & Liu, 2019a; Liu et al., 2023). These findings support the hypothesis that filamentous CTPS structures act as localized hubs for nucleotide synthesis, facilitating endoreplication and enhancing metabolic flux. Furthermore, they highlight the intricate interplay between filament assembly and additional regulatory mechanisms. Further studies, particularly proteomic analyses of cytoophidia‐associated proteins, could provide deeper insights into their potential regulatory interactions and functional significance in metabolic adaptation.

CTPS in endoreplication and nutrient sensing

Because cell size for a given cell type is generally proportional to the amount of nuclear DNA, endoreplication constitutes an effective strategy of cell growth, and it is often found in differentiated cells that are large or highly metabolically active.

Our findings further elucidate the role of CTPS in endoreplication, a process critical for tissue growth in polyploid cells such as those in the fat body and salivary glands. Previous studies reported that the proto‐oncogene Casitas B‐lineage lymphoma (Cbl) promotes the endocycle through regulating CTPS activity in germline cells. E2F1 drives endocycles in Drosophila salivary cells by promoting cyclin E expression and S phase entry, and translational control of E2F1 was found to couple rates of endocycle progression to cellular growth rates (Zielke et al., 2011). Endoreplication cycles rely on the periodic activation of replication factors like Cyclin E, which are regulated by nutrient‐sensing pathways including insulin/PI3K‐Akt and mTOR (Follette et al., 1998; Zielke et al., 2011). Our results suggest that the insulin‐PI3K‐Akt controls CTPS filament formation and influences the nucleotide pool balance, potentially promoting the endoreplication process in the Drosophila fat body. This indicates a mechanistic link between CTPS and the replication machinery.

Moreover, starvation, a physiological state that disrupts nutrient‐sensing pathways and imposes metabolic stress, provides an ideal context to investigate the adaptive role of cytoophidia. Understanding how CTPS filaments respond to starvation could shed light on their function as mediators of metabolic adaptation and tissue integrity. In this study, the results showed that CTPS cytoophidia dynamically respond to nutrient conditions, rapidly disassembling under starvation and reassembling upon re‐feeding. The observed decreases in CTPS mRNA levels and filament length under nutrient deprivation further support the role of nutrient signaling in regulating CTPS expression and cytoophidium stability. The reversible nature of these changes highlights the adaptability of CTPS filaments to fluctuating metabolic demands, positioning them as key mediators of cellular and organismal responses to nutrient availability. This dynamic behavior reflects the ability of cytoophidia to act as cellular sensors that respond to metabolic demands, enabling cells to conserve resources under nutrient stress while resuming growth when conditions improve. However, nutrition depletion‐induced cytoophida formation in yeast, brains of Drosophila larva, and mammalian cells (Liu, 2016). Such adaptability positions CTPS filaments as a central component of cellular strategies to balance metabolic needs and environmental cues.

Nutrient signaling pathways regulate CTPS cytoophidia formation

Here, we found that nutrient‐sensing pathway, insulin‐PI3K‐Akt signaling, mediates CTPS filament formation. Knockdown of key components such as Chico, Akt, and S6K led to a dramatic reduction in cytoophidia, accompanied by decreased CTPS mRNA levels. These findings suggest that CTPS cytoophidia appear to act as molecular hubs that integrate signals from the key pathway such as insulin‐PI3K‐Akt. The pathway modulates CTPS expression and filament formation, aligning cellular growth with nutrient availability.

Insulin‐PI3K‐Akt signaling positively regulates CTPS expression and cytoophidia formation. In turn, CTPS depletion suppresses the PI3K‐Akt‐SREBP axis, leading to reduced lipid accumulation and smaller adipocytes (Liu et al., 2023), suggesting that CTPS is not only regulated by insulin signaling but also modulates its downstream effects. The ability of SREBP activation to partially rescue CTPS depletion‐induced defects further supports the functional interplay between CTPS and the PI3K‐Akt pathway. While these findings indicate a potential feedback mechanism, further studies are required to define the precise molecular interactions governing this regulatory loop.

Our findings establish CTPS and its filamentous structures as crucial regulators of tissue growth and nutrient adaptation in Drosophila. By linking CTPS filament dynamics to DNA replication and nutrient‐sensing pathways, this study provides new insights into how cells coordinate growth with metabolic and environmental cues. Future research should explore the role of CTPS filaments in other tissues and developmental contexts will further illuminate their contributions to growth and metabolic homeostasis.

In summary, our results position CTPS as a key regulator of cell size and tissue growth, integrating nutrient and hormonal signals to drive endoreplication and metabolic adaptation. By establishing the importance of CTPS filaments in these processes, we provide a framework for understanding how cellular metabolism is dynamically tuned to developmental and environmental demands.

Author contributions

J. Liu conceived and designed the studies. J. Liu, J. Hong, and J. Li performed most of the experiments. J. Liu, J. Li, J. Wang, and C. Li analyzed the data. Y. Zhang performed qRT‐PCR. J. Liu wrote the manuscript.

Disclosure

All authors have seen and agree with the contents of the manuscript and there is no conflict of interest, including specific financial interest and relationships and affiliations relevant to the subject of manuscript.

Supporting information

Fig. S1 Inhibition of cytidine triphosphate synthase (CTPS) in salivary gland did not affect its cell number.

INS-33-1465-s001.jpg (92.3KB, jpg)

Fig. S2 Overexpression of wild‐type cytidine triphosphate synthase (CTPS) did not affect the body size and body weight in Drosophila.

INS-33-1465-s003.jpg (591.4KB, jpg)

Fig. S3 Both salivary gland size and individual cell size were reduced following inhibition of the PI3K‐Akt signaling pathway.

INS-33-1465-s002.jpg (3MB, jpg)

Acknowledgments

This work was supported by grants from National Key Research and Development Program of China (No. 2024YFA0917000) and National Natural Science Foundation of China (No. 32071144) to J. Liu. We also thank the Core Imaging Facility at the National Center for Protein Science Shanghai (NCPSS), the Core Facility of Drosophila Resource and Technology at SIBCB, CAS, and the online database flybase (http://flybase.org). We acknowledge the Bloomington Drosophila Stock Center (NIH P40OD018537) and the Vienna Drosophila Resource Center (VDRC, https://www.vdrc.at) at Vienna BioCenter Core Facilities, part of the Vienna BioCenter, Austria for providing Drosophila stocks used in this study.

Contributor Information

Ji‐Long Liu, Email: liujl3@shanghaitech.edu.cn.

Jingnan Liu, Email: jnliu@shnu.edu.cn.

References

  1. Arrese, E.L. and Soulages, J.L. (2010) Insect fat body: energy, metabolism, and regulation. Annual Review of Entomology, 55, 207–225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aughey, G.N. , Grice, S.J. and Liu, J.L. (2016) The interplay between Myc and CTP synthase in Drosophila . PLoS Genetics, 12, e1005867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aughey, G.N. , Grice, S.J. , Shen, Q.J. , Xu, Y. , Chang, C.C. , Azzam, G. et al. (2014) Nucleotide synthesis is regulated by cytoophidium formation during neurodevelopment and adaptive metabolism. Biology Open, 3, 1045–1056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aughey, G.N. and Liu, J.L. (2015) Metabolic regulation via enzyme filamentation. Critical Reviews in Biochemistry and Molecular Biology, 51, 282–293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barry, R.M. , Bitbol, A.F. , Lorestani, A. , Charles, E.J. , Habrian, C.H. , Hansen, J.M. et al. (2014) Large‐scale filament formation inhibits the activity of CTP synthetase. eLife, 3, e03638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bassett, A.R. , Tibbit, C. , Ponting, C.P. and Liu, J.L. (2013) Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Reports, 4, 220–228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brand, A.H. and Perrimon, N. (1993) Targeted gene‐expression as a means of altering cell fates and generating dominant phenotypes. Development, 118, 401–415. [DOI] [PubMed] [Google Scholar]
  8. Carcamo, W.C. , Satoh, M. , Kasahara, H. , Terada, N. , Hamazaki, T. , Chan, J.Y. et al. (2011) Induction of cytoplasmic rods and rings structures by inhibition of the CTP and GTP synthetic pathway in mammalian cells. PLoS ONE, 6, e29690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chang, C.C. , Jeng, Y.M. , Peng, M. , Keppeke, G.D. , Sung, L.Y. and Liu, J.L. (2017) CTP synthase forms the cytoophidium in human hepatocellular carcinoma. Experimental Cell Research, 361, 292–299. [DOI] [PubMed] [Google Scholar]
  10. Chen, K. , Zhang, J. , Tastan, O.Y. , Deussen, Z.A. , Siswick, M.Y. and Liu, J.L. (2011) Glutamine analogs promote cytoophidium assembly in human and Drosophila cells. Journal of Genetics and Genomics, 38, 391–402. [DOI] [PubMed] [Google Scholar]
  11. Daumann, M. , Hickl, D. , Zimmer, D. , DeTar, R.A. , Kunz, H.H. and Mohlmann, T. (2018) Characterization of filament‐forming CTP synthases from Arabidopsis thaliana . The Plant Journal, 96, 316–328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Edgar, B.A. and Orr‐Weaver, T.L. (2001) Endoreplication cell cycles: more for less. Cell, 105, 297–306. [DOI] [PubMed] [Google Scholar]
  13. Ferre, P. and Foufelle, F. (2007) SREBP‐1c transcription factor and lipid homeostasis: clinical perspective. Hormone Resarch, 68, 72–82. [DOI] [PubMed] [Google Scholar]
  14. Follette, P.J. , Duronio, R.J. and O'Farrell, P.H. (1998) Fluctuations in cyclin E levels are required for multiple rounds of endocycle S phase in Drosophila . Current Biology, 8, 235–238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ginzberg, M.B. , Kafri, R. and Kirschner, M. (2015) On being the right (cell) size. Science, 348(6236), 1245075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ingerson‐Mahar, M. , Briegel, A. , Werner, J.N. , Jensen, G.J. and Gitai, Z. (2010) The metabolic enzyme CTP synthase forms cytoskeletal filaments. Nature Cell Biology, 12, 739–746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jahant‐Miller, C. , Miller, R. and Parry, D. (2022) Size‐dependent flight capacity and propensity in a range‐expanding invasive insect. Insect Science, 29, 879–888. [DOI] [PubMed] [Google Scholar]
  18. Kellogg, D.R. and Levin, P.A. (2022) Nutrient availability as an arbiter of cell size. Trends in Cell Biology, 32, 908–919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kozma, S.C. and Thomas, G. (2002) Regulation of cell size in growth, development and human disease: PI3K, PKB and S6K. BioEssays, 24, 65–71. [DOI] [PubMed] [Google Scholar]
  20. Lehner, C.F. (1999) The beauty of small flies. Nature Cell Biology, 1, E129–E130. [DOI] [PubMed] [Google Scholar]
  21. Levitzki, A. and Koshland Jr., D.E. (1969) Negative cooperativity in regulatory enzymes. Proceedings of the National Academy of Sciences USA, 62, 1121–1128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li, S. , Yu, X. and Feng, Q. (2019) Fat body biology in the last decade. Annual Review of Entomology, 64, 315–333. [DOI] [PubMed] [Google Scholar]
  23. Lieberman, I. (1956) Enzymatic amination of uridine triphosphate to cytidine triphosphate. Journal of Biological Chemistry, 222, 765–775. [PubMed] [Google Scholar]
  24. Liu, J. , Zhang, Y. , Wang, Q.Q. , Zhou, Y. and Liu, J.L. (2023) Fat body‐specific reduction of CTPS alleviates HFD‐induced obesity. eLife, 12, 1–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Liu, J. , Zhang, Y. , Zhou, Y. , Wang, Q.Q. , Ding, K. , Zhao, S. et al. (2022) Cytoophidia coupling adipose architecture and metabolism. Cellular and Molecular Life Sciences, 79, 534–540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu, J.L. (2010) Intracellular compartmentation of CTP synthase in Drosophila . Journal of Genetics and Genomics, 37, 281–296. [DOI] [PubMed] [Google Scholar]
  27. Liu, J.L. (2016) The cytoophidium and its kind: filamentation and compartmentation of metabolic enzymes. The Annual Review of Cell and Developmental Biology, 32, 349–372. [DOI] [PubMed] [Google Scholar]
  28. Lynch, E.M. , Hicks, D.R. , Shepherd, M. , Endrizzi, J.A. , Maker, A. , Hansen, J.M. et al. (2017) Human CTP synthase filament structure reveals the active enzyme conformation. Nature Structural & Molecular Biology, 24, 507–514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ni, J.Q. , Markstein, M. , Binari, R. , Pfeiffer, B. , Liu, L.P. , Villalta, C. et al. (2008) Vector and parameters for targeted transgenic RNA interference in Drosophila melanogaster . Nature Methods, 5, 49–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Noree, C. , Monfort, E. , Shiau, A.K. and Wilhelm, J.E. (2014) Common regulatory control of CTP synthase enzyme activity and filament formation. Molecular Biology of the Cell, 25, 2282–2290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Noree, C. , Sato, B.K. , Broyer, R.M. and Wilhelm, J.E. (2010) Identification of novel filament‐forming proteins in Saccharomyces cerevisiae and Drosophila melanogaster . Journal of Cell Biology, 190, 541–551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rhind, N. (2021) Cell‐size control. Current Biology, 31, R1414–R1420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Rizzo, H.E. , Zhang, A.L. and Gardel, M.L. (2024) Mechanochemical control systems regulating animal cell size. Current Opinion in Cell Biology, 91, 102443. [DOI] [PubMed] [Google Scholar]
  34. Sun, Z. and Liu, J.L. (2019a) Forming cytoophidia prolongs the half‐life of CTP synthase. Cell Discovery, 5, 32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sun, Z. and Liu, J.L. (2019b) mTOR‐S6K1 pathway mediates cytoophidium assembly. Journal of Genetics and Genomics, 46, 65–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wang, P.Y. , Lin, W.C. , Tsai, Y.C. , Cheng, M.L. , Lin, Y.H. , Tseng, S.H. et al. (2015) Regulation of CTP synthase filament formation during DNA endoreplication in Drosophila . Genetics, 201, 1511–1523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang, H. , Liu, J. , Li, C.R. , Momen, B. , Kohanski, R.A. and Pick, L. (2009) Deletion of Drosophila insulin‐like peptides causes growth defects and metabolic abnormalities. Proceedings of the National Academy of Sciences USA, 106, 19617–19622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhang, Y. , Liu, J. and Liu, J.L. (2020) The atlas of cytoophidia in Drosophila larvae. Journal of Genetics and Genomics, 47, 321–331. [DOI] [PubMed] [Google Scholar]
  39. Zhou, S. , Xiang, H. and Liu, J.L. (2020) CTP synthase forms cytoophidia in archaea. Journal of Genetics and Genomics, 47, 213–223. [DOI] [PubMed] [Google Scholar]
  40. Zhou, X. , Guo, C.J. , Chang, C.C. , Zhong, J. , Hu, H.H. , Lu, G.‐M. et al. (2021) Structural basis for ligand binding modes of CTP synthase. Proceedings of the National Academy of Sciences USA, 118, e2026621118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zielke, N. , Kim, K.J. , Tran, V. , Shibutani, S.T. , Bravo, M.J. , Nagarajan, S. et al. (2011) Control of Drosophila endocycles by E2F and CRL4CDT2 . Nature, 480, 123–127. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1 Inhibition of cytidine triphosphate synthase (CTPS) in salivary gland did not affect its cell number.

INS-33-1465-s001.jpg (92.3KB, jpg)

Fig. S2 Overexpression of wild‐type cytidine triphosphate synthase (CTPS) did not affect the body size and body weight in Drosophila.

INS-33-1465-s003.jpg (591.4KB, jpg)

Fig. S3 Both salivary gland size and individual cell size were reduced following inhibition of the PI3K‐Akt signaling pathway.

INS-33-1465-s002.jpg (3MB, jpg)

Articles from Insect Science are provided here courtesy of Wiley

RESOURCES