Genome-wide identification and analysis of auxin response factors in peels of wax apple at different fruit development stages

Abstract

In this study, we used transcriptomic data to screen the auxin response factor gene family in the peels of wax apple at different stages of fruit development, in which fourteen auxin response factor genes (SsARFs) were identified and analyzed. The results showed that the 14 SsARFs were hydrophilic proteins located in the nucleus, with a higher ratio of serine and leucine, and a lower ratio of cysteine and tryptophan. These SsARF proteins consisted of irregularly coiled, extended strands, alpha-helices and beta-turns, most of which contained a B3 DNA-binding domain (B3-DBD), a middle region (MR) and a C-terminal dimerization domain (CTD), whereas some of them lacked a CTD, including SsARF6b, SsARF16, SsARF17, SsARF18 and SsARF22. Phylogenetic tree analysis revealed that the SsARFs were classified into five clusters. The expression of seven SsARFs were up-regulated, while the others were down-regulated. The protein interaction network of SsARFs showed strong interactions among SsARF4, SsARF5, SsARF6a, SsARF6b, SsARF17, SsARF19a, and SsARF19b, which interacted strongly with IAA12, IAA14 and IAA17. Therefore, SsARF6a, SsARF6b, SsARF17, SsARF19a, and SsARF19b, may play an important role in the auxin signal transduction pathway during wax apple fruit development.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-53117-y.

Introduction

Wax apple (Syzygium samarangense Bl. Merr. et Perry), also termed Java apple and wax jambu, is a non-climacteric tropical fruit that belongs to the genus of Syzygium in the Myrtaceae family and is native to the Malay Archipelago^1–3. It is an economically important, popular exotic fruit crop, and widely cultivated throughout the southeast Asian countries such as Malaysia, Thailand, Vietnam, China and India^4,5. Wax apple can fruit in any given season under proper cultivation measures because of the strong flowering ability⁶. Wax apple fruits, known as potent antioxidants, are usually eaten fresh, which rich in antioxidant compounds (such as ellagitannins, flavonol glycosides, anthocyanidins, triterpenoids, proanthocyanidins) beneficial to human health, and used in traditional medicine for treatment of bronchitis, asthma, and inflammation syndromes^7–11.

Numerous aspects of plant development and physiological processes are regulated by auxin, involving in apical dominance, vascular elongation, flowering, and fruit development and ripening^12,13. Auxin response factor (ARF) is transcription factor that regulates the transcription of auxin-responsive genes during plant growth and development including fruit development¹⁴. ARFs can activate or repress the expression of early/primary auxin response genes by binding to the auxin response element (AuxRE) site in their promoter regions. A typical ARF is characterized by a highly conserved N-terminal B3-type DNA binding domain (DBD) that recognizes the AuxRE motif, as well as an activation domain or repression domain, and a C-terminal dimerization domain (domain III/IV), which is involved in protein-protein interactions by dimerizing with auxin/indole-3-acetic acid (Aux/IAA) family genes¹⁵. ARFs play a pivotal role in regulating plant growth and development via the auxin signaling pathway^16–19. Due to the significance of ARFs, their genome-wide characterization has been completed in many species such as model plants Arabidopsis¹⁶ and tomato (Solanum lycopersicum)^20,21, fruit trees like citrus (Citrus sinensis)²², apple (Malus domestica)²³, litchi (Litchi chinensis Sonn.)¹⁹, melon (Cucumis melo L.)²⁴, blueberry (Vaccinium spp.)²⁵, fig (Ficus carica L.)²⁶ and so on. However, the ARF gene family and the functions of ARFs in wax apple remain unknown.

Research into the molecular biology of the wax apple began recently. The first high-quality wax apple genome was assembled and reported by the Fruit Research Institute of the Fujian Academy of Agricultural Sciences in 2023, which presented a haplotype-resolved autotetraploid genome assembly of wax apple, sized at 1.59 Gb. Comparative genomic analysis revealed three rounds of whole-genome duplication (WGD), including two independent WGDs following WGT-γ. Transcriptomic analysis of three different varieties during flower and fruit development identified key genes related to fruit size, sugar content and male sterility. The chromosome-scale genome and large-scale transcriptome data presented in the study provide valuable new resources for the biological research of wax apple and shed new light on the regulation of fruit size, sugar metabolism and male sterility. However, there are still no reports on the ARF gene family and their functions in wax apple⁵.

To improve any fruit traits, it is necessary to study the characteristics of ARF gene family in wax apple at different fruit development stages. Therefore, we performed a genome-wide survey of the ARF gene family in wax apple and carried out the comprehensive analysis of them, including physicochemical properties, subcellular localization, amino acid composition, secondary and tertiary structure, conserved protein motifs, phylogenetic analyses, and protein interactions. The expression profiling of ARF genes in peels of wax apple were determined by RNA-seq and real-time quantitative PCR (qRT-PCR). Our study will contribute to future research for cloning and addressing the functional roles of SsARF gene family, exploring the mechanism of ARF family regulating fruit development and ripening in wax apple.

Results

 Auxin response factor (ARF) family genes in peels of wax apple

A total of 80.96Gb clean bases was obtained by transcriptomic sequencing from twelve samples, and 48,392 Unigenes were obtained after assembly including 28,128 differential expression unigenes by compared with Nr, KEGG, KOG, and Swiss-Prot. We identified 14 common auxin response factors (ARF) from 28,128 differential expression unigenes in peels of wax apple at different fruit development stages, which were called SsARFs .

The gene name, gene ID and physico-chemical property of SsARFs were listed in Table 1. Briefy, the CDS length of SsARFs varied from 1122 bp (SsARF16 ) to 3363 bp ( SsARF19b ), and their deduced protein comprised of 374 (SsARF16) -1121 (SsARF19b) amino acids, with the estimated molecular weight from 41.11 (SsARF16) to 125.04 kDa (SsARF19b), respectively. The isoelectric point (pI) ranged from 5.51 (SsARF5) to 7.94 (SsARF22), while the average pI was 6.53, and acidic amino acids were enriched in the protein molecules. PI of 28.57% SsARFs were more than seven, the others were less than seven with most of them being weakly acidic. The instability index ranged from 46.95 (SsARF18) to 73.71 (SsARF19b), suggesting that all these proteins were stable (II > 40). The aliphatic index ranged from 66.50 (SsARF16) to 77.24 (SsARF4). The total hydrophilicity of SsARFs was negative, ranging from-  0.635 (SsARF19b) to -0.268 (SsARF22). All SsARFs were localized in the nucleus .

Table 1.

Physico-chemical property of SsARFs in wax apple.

Gene	Gene ID	CDS length (bp)	Length (aa)	Molecular weight/kDa	Isoelectric point	Instability index	Aliphaticindex	Gravy	Subcellular localization
SsARF17	Unigene0001296	1650	550	59.58	7.27	52.36	72.27	-0.299	Nuclear
SsARF18	Unigene0004152	2076	692	76.17	6.24	46.95	70.46	-0.399	Nuclear
SsARF9a	Unigene0011299	2067	689	76.40	6.71	54.93	69.72	-0.493	Nuclear
SsARF22	Unigene0013363	2682	894	99.67	7.94	50.60	71.54	-0.268	Nuclear
SsARF6a	Unigene0019582	2538	846	93.47	6.01	66.34	75.82	-0.388	Nuclear
SsARF3	Unigene0025006	2175	725	79.21	7.06	57.41	71.41	-0.381	Nuclear
SsARF6b	Unigene0030771	2607	869	96.31	6.16	68.19	76.75	-0.407	Nuclear
SsARF16	Unigene0036352	1122	374	41.11	7.60	42.19	66.50	-0.318	Nuclear
SsARF19a	Unigene0040513	3345	1115	122.74	6.11	62.39	72.19	-0.487	Nuclear
SsARF5	Unigene0040514	2808	936	102.61	5.51	54.97	76.11	-0.382	Nuclear
SsARF4	Unigene0041506	2406	802	88.98.	6.17	54.11	77.24	-0.420	Nuclear
SsARF19b	Unigene0041988	3363	1121	125.04	6.26	73.71	71.06	-0.635	Nuclear
SsARF9b	Unigene0045617	1962	654	73.13	5.99	59.99	70.31	-0.523	Nuclear
SsARF2A	Unigene0046124	2397	799	89.02	6.37	59.15	70.29	-0.537	Nuclear

Conserved motifs and domains of SsARFs

To investigate their evolutionary relationship, phylogenetic analysis was performed using sequences of SsARFs (14) with ARFs from Arabidopsis (23), rice (25), grape (26) and apple (28) (Fig. 1). SsARFs were separately distributed to five different clusters and clustered together with ARFs from other plant species (I, II, III, IV, V) (Fig. 1). Group I contained SsARF9a and SsARF9b with 12 AtARFs, 3 OsARFs, 4 VvARFs, and 4 MdARFs. Group II only contained SsARF2A with containing 1 AtARFs, 3 OsARFs, 4 VvARFs, and 4 MdARFs. Group III contained SsARF6a, SsARF6b, SsARF19a and SsARF19b with 4 AtARFs, 8 OsARFs, 7 VvARFs, and 8 MdARFs. Group IV contained SsARF3, SsARF4 and SsARF5 with 3 AtARFs, 5 OsARFs, 6 VvARFs, and 6 MdARFs. Group V contained SsARF16, SsARF17, SsARF18 and SsARF22 with 3 AtARFs, 6 OsARFs, 5 VvARFs, and 6 MdARFs.

Fig. 1.

Phylogenetic relationship of SsARFs with the ARFs in other plant species, containing Arabidopsis (23, AtARF), rice (25, OsARF), grape (26, VvARF) and apple (28, MdARF).

20 motifs were identified from 14 SsARFs, all of them shared motifs 1, 2, 4, 5, 7, 10, while most of them shared motifs 3, 8, 9, 12, 13, nine of them shared motifs 6, 14, 15, indicating diverse motif compositions and functional in SsARF family (Fig. 2). While SsARF6b protein contained the most conserved motifs (18 conserved motifs), SsARF17 contained the least conserved motifs, only 8 conserved motifs. There were 17 conserved motifs in SsARF6a, SsARF9a, SsARF9b, SsARF19a and SsARF2A. Further observation indicated that SsARF proteins at the same clade in the phylogenetic tree basically show similar motif composition, which suggested a potential of functional redundancy.

Fig. 2.

Analysis of ARF protein conserved motif in wax apple.

Sequence similarity and amino acid composition of SsARF proteins

The results of sequence comparison of SsARF proteins showed that most SsARF proteins contained three unique conserved structural domains by Clustal software (Fig. 3). The three unique conserved structural domains were DNA-binding domain (DBD), mid-region structural domain (MR), and C-terminal dimerization structural domain (CTD), which confirmed that the fourteen protein sequences shared a very high degree of sequence similarity.

Fig. 3.

Sequence similarity of the ARF gene family in wax apple.

The amino acid composition of SsARF proteins were shown in Fig. 4. All SsARF proteins were composed of 20 different amino acids. Among them, serine (Ser), leucine (Leu), proline (Pro), and glycine (Gly) were abundant, which accounted from 7.5 (SsARF16) ~  14.6% (SsARF3), 5.6 (SsARF16)  ~  10.4% (SsARF6a), 5.9 (SsARF22) ~ 9.0% (SsARF6a), and 5.3 (SsARF19b) ~ 9.9% (SsARF16), respectively. However, amino acids such as cysteine (Cys), tryptophan (Trp) and tyrosine (Tyr) were less, accounting from 0.8 (SsARF6b) ~ 2.7% (SsARF22), 1.1 (SsARF3) ~ 2.1% (SsARF16, SsARF9b), and 1.4% (SsARF3, SsARF9b, SsARF2A) ~ 2.6% (SsARF4), respectively.

Fig. 4.

Analysis of corresponding amino acid composition of SsARFs.

Secondary and tertiary structure of SsARF proteins

As shown in Table 2; Fig. 5, the proportion of alpha helix and random coil was relatively larger than beta turn and extended strand in SsARF proteins. The descending order of them was random coil > alpha helix> extended strand > beta turn. Random coil changed from 45.41 (SsARF6a) to 67.27% (SsARF18), alpha helix varied from 13.27 (SsARF18) to 31.12% (SsARF5), while their extended strand ranged from 13.44% (SsARF9a) to 21.70% (SsARF6a). The beta.

Table 2.

Secondary and tertiary structure of SsARF family proteins.

Gene	Secondary structure				Tertiary structure
	Alpha helix (%)	Extended Strand (%)	Beta Turn (%)	Random Coil (%)	B3-DNA binding (DBD)	middle region (MR)	AUX-IAA Domain (CTD)
SsARF17	17.65	15.27	4.13	62.95	99–201	248–331
SsARF18	13.27	16.18	3.27	67.27	132–233	290–373
SsARF9a	20.38	13.44	3.61	62.57	127–228	253–331	583–657
SsARF22	18.87	16.98	3.92	60.23	115–215	279–362
SsARF6a	23.38	21.70	9.51	45.41	76–178	208–285	712–784
SsARF3	27.54	15.72	5.56	51.18	132–234	264–341	752–845
SsARF6b	14.90	14.90	4.28	65.93	161–263	290–368
SsARF16	27.50	14.27	4.26	53.97	121–222	290–373
SsARF19a	22.46	19.25	5.35	52.94	138–239	270–347	975–1083
SsARF5	31.12	14.17	7.09	47.26	150–251	281–359	839–907
SsARF4	25.96	16.56	3.85	53.63	169–270	295–376	661–753
SsARF19b	19.08	17.08	4.99	58.85	126–227	258–334	1006–1078
SsARF9b	27.30	14.27	7.85	50.58	116–216	242–321	533–629
SsARF2A	19.72	16.82	4.59	58.87	129–230	255–337	665–765

Fig. 5.

Tertiary structure of SsARF proteins.

turn of SsARF proteins was lower, varied from 3.27% (SsARF18) to 9.51% (SsARF6a). Typical ARF protein has three conserved domains: N-terminal B3-like DNA binding domain (DBD), C-terminal dimerization domain (CTD), and a middle region (MR)²⁷. Our results showed that all SsARFs contained MR as an intermediate domain, and a complete DBD, while many of them contained CTD structure, except for SsARF6b, SsARF16, SsARF17, SsARF18 and SsARF22.

Prediction of protein interaction network of SsARFs

Functional relationships and co-expression of 14 SsARF proteins were predicted using the String protein interaction database (A. thaliana was chosen for the species model). In the interaction network diagram (Fig. 6A,B), the connected proteins may have some kind of close functional linkage, and the thicker connecting line indicated that they had stronger interaction. The results showed that they had stronger interaction among SsARF4, SsARF5, SsARF6a, SsARF6b, SsARF9a, SsARF9b, SsARF17, SsARF19a, SsARF19b, and SsARF22, while the interaction of SsARF3, SsARF16, SsARF18 and SsARF2A was weaker (Fig. 6A). The protein interaction network of SsARFs showed strong interactions among SsARF3, SsARF4, SsARF5, SsARF6a, SsARF6b, SsARF9a, SsARF9b, SsARF17, SsARF19a, and SsARF19b, which interacted strongly with IAA12, IAA14 and IAA17. SsARF3, SsARF4, SsARF5, SsARF6a, SsARF6b, SsARF9a, SsARF9b, SsARF17, SsARF19a, and SsARF19bmay play an important role in the auxin signaling during wax apple fruit development (Fig. 6B).

Fig. 6.

Prediction of protein interaction network of SsARFs (A,B).

Expression profiling and qRT-qPCR validation of SsARFs in peels of wax apple

The expression of SsARF4, SsARF6a, SsARF6b, SsARF9b, SsARF19b decreased first, then increased and then decreased. The expression of SsARF9a, SsARF16 increased, then decreased, and increased. The expression of SsARF18 increased then decreased, while the expression of SsARF2A decreased, then increased (Fig. 7A). The differences of SsARF4 and SsARF6a FPKM between SI and S3 were not significant, which had significance with S2 and S4. The differences of SsARF6b FPKM between S1 and S4 were not significant, which had significance with S2 and S3. The difference of SsARF9a FPKM between S1 and S2 was not significant, which was the same trend between S3 and S4. The differences of SsARF9b FPKM among S2, S3 and S4 were not significant, which had significant with S1. The different of SsARF16 FPKM in S4 was significant with S1, S2 and S3, which in S3 was not significant with S1 and S2. The differences of SsARF19a FPKM between S2 and S3 were not significant, which had significant with S1 and S4. The differences of SsARF18 FPKM among S1, S3 and S4 were not significant, which had significant with S2. The differences of SsARF19b FPKM among S1, S2 and S4 were not significant, which had significant with S3. The differences of SsARF2A FPKM between S3 and S4 were not significant, which had significant with S1 and S2 (Fig. 7A).

Fig. 7.

Expression of SsARFs at different fruit developmental stages (A,B).

The expression of SsARF3, SsARF5, SsARF17 and SsARF22 in the peels increased gradually as the fruit development and ripening, while the expression of SsARF19a decreased gradually (Fig. 7A, 7B). The differences of SsARF3, SsARF5 and SsARF22 FPKM between S1 and S2 were not significant, which had significant with S3 and S4. The difference of SsARF17 FPKM between S1 and S2 was not significant, which was the same trend between S3 and S4. However, the differences between S1, S2 and S3, S4 were significant (Fig. 7B).

To further validate the ARF genes in peels of wax apple at its different fruit development and ripening stages such as S1, S2, S3 and S4. The expression of six genes, namely SsARF5, SsARF6a, SsARF6b, SsARF18, SsARF19a and SsARF2A was analyzed by qRT-PCR (Fig. 8).

Fig. 8.

Expression pattern of 6 SsARF genes in peels of wax apple during at different fruit development stages (S1, S2, S3, and S4). Relative transcript levels were calculated by qRT-PCR. Different letters above the bars indicated statistically significant differences (P = 0.05).

The results showed that the expression of SsARF5 in the peels decreased first, then increased gradually, which was lowest at S2. The expression of SsARF6a, SsARF6b, SsARF18 and SsARF19a increased gradually from S1 to S3, which decreased at S4. The expression of SsARF2A decreased, then increased, and decreased, which was highest at S3. SsARFs had the same expression tread at fruit different developmental stages, but the relative expression levels of SsARFs were different, which suggested that each gene maybe play a different role at different fruit development and ripening stages.

Discussion

With the continuous development of biological information technology and the improvement of sequencing technology, it is possible to identify and characterize a certain gene family and its mediating regulatory network at the genome level. Plant ARF genes acted as key components of auxin signaling pathway to mediate the expression of auxin-responsive, which were also a classic and important genes related to plant growth and development^12,13. In the present study, 14 SsARF genes were identified in wax apple, and the number of SsARF family members is closed to the ones in papaya (11)²⁷, Passiflora edulia Sims (13)²⁸ and mulberry(16)²⁹. The number of SsARF family members is littler than the ones in A. thaliana (23)^16,30,31, litchi (39)¹⁹, tomota (25)²⁰, blueberry (60)²⁵, apple (28)³², sweet orange (19)³³, grapes (25)³⁴, rice (25)^35,36, and maize (31)³⁷.

Bioinformatics analysis revealed significant differences in the protein characteristics and amino acid lengths of the ARF proteins in wax apple, indicating that the ARF family proteins had diverse characteristics and may possess various biological functions⁴¹. The physico-chemical property of SsARF proteins had obvious difference in CDS length, amino acids composition, estimated molecular weight, pI, instability index and total hydrophilicity in wax apple, which was similar to A. thaliana, papaya²⁷, Passiflora edulia Sims²⁸, rice^35,36, and sugar apple³⁸. The subcellular localization prediction results show that the ARF protein of wax apple were located in the cell nucleus, which was consistent with that in Passiflora edulia Sims²⁸ and tea tree^39,40, while some ARFs located inytoplasmic²⁰ and chloroplasts⁴¹. All SsARF proteins were composed of 20 different amino acids, and the length of SsARF proteins and the ratio of differential amino acid had significant difference, which was similar to that in papaya²⁷ and sugar apple³⁸.

The secondary structure of SsARF proteins were constructed by alpha helix, random coil, beta turn and extended strand, and the tertiary structure of ARF proteins included three conserved domains such as N-terminal B3-like DNA binding domain (DBD), C-terminal dimerization domain (CTD), and a middle region (MR), which was similar to that in A. thaliana [16] ,litchi¹⁹, tomota²⁰, blueberry²⁵, fig²⁶, papaya²⁷, apple (28)³², grapes³⁴, rice^35,36, and maize³⁷. All SsARF proteins contained a complete DBD and MR structure, which determined their functions based on amino acid compositions liking that in fig²⁶ and papaya²⁷. Most SsARFs contained CTD structure except SsARF6b, SsARF16, SsARF17, SsARF18 and SsARF22. Without a complete CTD domain, some SsARFs may not participate in the auxin signaling pathway or perform its independent functions. However, the ARF function of SsARF6b, SsARF16, SsARF17, SsARF18 and SsARF22 without CTD domains in wax apple required to be further studied.

The phylogenetic analysis of SsARFs indicated SsARFs can be classified into five clusters together with ARFs from other plant species (Fig. 2), suggesting they might have undergone similar evolutionary and function diversification in the same cluster. For instance, SsARF9a and SsARF9b of wax apple belonged to class I with eleven AtARFs, which may be involved in regulation of the similar formation, development and patterns. ARFs in wax apple were highly homologous to those in Arabidopsis, apple, rice and grape. Many AtARFs have been already reported in previous reports, therefore, comparative studies may reveal useful information on the respective biological functions in wax apple. SsARF2A belonged to class II with AtARF2¹⁶, MdARF5, MdARF10, MdARF18, MdARF23³², VvARF10, VvARF13, VvARF25³⁴, OsARF4, OsARF23, and OsARF24^35,36, which may be involved in the similar evolutionary and function diversification. Twenty motifs were identified from 14 SsARFs, the results showed that diverse motif compositions existed in SsARFs implying their functional diversity (Fig. 4). There were the most conserved motifs in SsARF6b protein, while SsARF17 protein contained the least conserved motifs.

There was strongly correlation between SsARF9 and SsARF19, while they were weakly correlated with other SsARFs. SsARF3, SsARF5, SsARF9a, SsARF9b and SsARF19b were annotated to phytohormone signaling in signal transduction metabolism pathway. There were strong interactions among SsARF3, SsARF4, SsARF5, SsARF6a, SsARF6b, SsARF9a, SsARF9b, SsARF17,  SsARF19a, and SsARF19b, which had strong interactions with the IAA12, IAA14, and IAA17. The interactions of SsARFs with IAA are similar to that in figs²⁶ and grape³⁴. Here, we focused on auxin response factors in peels of wax apple during different fruit growth and development stages, but did not focus on ARF in other organs such as roots, leaves and flowers, which will be the focus on the next research. The specific functional analysis of the genes in the ARF family that promote or inhibit the expression of auxin response genes still needs further exploration in wax apple.

Materials and methods

Plant materials and treatments

The wax apple plants (variety“Taiguo Zihong”, approximately 8 years old) are cultivated in greenhouse under root-limited culture at Fujian Institute of Subtropical Botany, Xiamen, Fujian, China. Flower buds began to sprout from the branch tips and the main stem in mid-February 2023. The fruits were selected at 15 (S1), 30 (S2), 45 (S3) and 60 (S4) days after flower (DAF) from May to June in 2023. The samples were taken from twenty healthy fruits, whose size and color was consistent. The peels (0.2–0.5 mm) cut by a surgical blade, which were frozen in liquid nitrogen and stored at -80 ℃ until processed further for transcriptome analyses. All samples were performed with three biological replications. The transcriptome data of samples were obtained by sequencing performed by Gene Denovo Biotechnology Co., Ltd Guangzhou, China.

Identification and physico-chemical property of SsARF family genes

14 SsARF genes were preliminarily annotated from four databases, namely NR, NT, Swiss-Prot, and PFAM, which was based on the transcriptome sequencing data of peels of wax apple. SsARFssequences were analyzed using bioinformatics methods, and the physico-chemical parameters such as CDS length, amino acid composition, molecular weight, and subcellular localization were analyzed and predicted by using prot param online (http://web.expasy.org/protparam/). Subcellular localization of SsARF family genes were analyzed by using SoftBerry (http://linux1.softberry.com/berry. phtml? topic=protcomppl&group=prgrams&subgroup=proloc)²⁷.

Protein structure of SsARFs

Secondary structures of protein sequences were predicted by online software Prabi(NPS@:SOPMA secondary structure prediction, https://npsa-prabi.ibcp.fr /cgi-bin /npsa_automat.pl? page=npsa_sopma.html). Tertiary structures of protein sequences were performed by online software SWISS-MODEL (https://swissmodel.expasy.org/). The conserved structural domains of SsARFs family of proteins were analysis by using CDD of NCBI (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi)²⁷.

Identification and phylogenetic analyses of SsARFs

23 AtARF protein sequences were downloaded from TAIR (www.arabidopsis.org). 25 OsARFs, 26 VvARFs, and 28 MdARFs protein sequences were downloaded from https://www.uniprot.org/uniprotkb. The ARFs of them were used as bait to identify potential ARFs in wax apple genome and obtained by BLAST analysis in TBtools^42,43 with the cutoff E-value set at 1e^− 10. The sequences of 23 AtARFs, 25 OsARFs, 26 VvARFs, and 28 MdARFs were applied to generate phylogenetic tree with 14 SsARFs. Briefy, multiple sequences alignment of all the ARF genes were performed by Clustal X, and phylogenetic tree was constructed by the MEGA 7.0 software with maximum likelihood statistical method⁴⁴. Bootstrap values were calculated using 1000 replicates. The phylogenetic tree was beautified by iTOL(http://itol.embl.de).

Gene structures, conserved motifs and domains of SsARFs

The gene structures of 14 SsARF genes were drawn using GSDS 2.0 (http://gsds.gao-lab.org/) through comparing their genomic sequences and coding sequences⁴⁵. The conserved motifs of SsARF proteins were analyzed using the online program Multiple Expectation Maximization for Motif Elucidation (http://meme-suite.org/tools/meme) by setting twenty conserved motifs⁴⁶. The conserved domains were analyzed using the online program Pfam (http://pfam.xfam.org/).

Expression profling of SsARFs during fruit growth and development

The transcript ID of each ARF gene was obtained using sequence search. Expression profling of SsARFs during fruit development was performed using a real-time online platform for data analysis (http://www.omicsmart.com).

Protein interaction analysis of SsARFs

Protein interaction analysis of SsARFs were performed by using Single/Multiple Proteins by Sequence from the String Protein Interaction Database (https://cn.string-db.org/).

qRT-PCR

Total mRNA was extracted from the frozen samples collected using TRIzol Reagent (Invitrogen), and cDNA synthesis was performed using PrimeScript^® RTReagent. kit (TaKaRa, Shiga, Japan). All primers involved in the qRT-PCR process were designed using the online tool Primer 3 Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi)^27,47, and the specificity of the primers was examined by the corresponding dissociation curves and gel electrophoresis. Transcript levels were quantified using a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with the intercalating dye SYBR-green following the 2(− Delta Delta C(T)) method. Three biological replicates were performed on each sample and Ct values were averaged (Table 3).

Table 3.

Primers sequences.

Gene name	Forward primer (5’-3’)	Reverse primer (5’-3’)
SsARF5	GCAACAACCAGAGCGGAATT	GACTGAACATCTTGGCTTGAACT
SsARF6a	CGGCAGGTCACTAGACATCA	CCATCACCAAGGAGAAGAACATC
SsARF6b	TGATTCCTTGTCTGTGCCATT	CGATTCATCCACGCAACTTG
SsARF18	GCAGGCATACAGGGAGCCAG	CCGAAGTTCCCATCCCGAGC
SsARF19a	AGCAGGTGGCGGAGAGAAGA	AGCTGCAACCTGTTCGCTGT
SsARF2A	GAAGAGCTGCGAGGATGCGT	TGCTCAATATGCCCCTGCGG
EF-1α	AAGCCACTCCGCCTTCCCTTAC	TGACAACCATACCAGGCTTGAGGAT

Statistical analysis

One-way ANOVA and least significant difference (LSD) test were completed with SPSS (version 23.0) (p < 0.05).

Conclusion

In this study, a total of 14 SsARF genes were identified from transcriptome data of wax apple peels at its different development stages. Fourteen SsARFs were hydrophilic protein and located in the nucleus, which contained three domains such as B3-DNA binding (DBD), middle region (MR) and C-terminal dimerization domain (CTD) except SsARF6b, SsARF16, SsARF17, SsARF18 and SsARF22, which lost C-terminal dimerization domain. The secondary structure of SsARF proteins was consisted of irregularly coiled, extended strands, alpha-helices and beta-turns. Phylogenetic tree analysis showed that SsARF proteins can be classified into five clusters, and most of the genes in the same clusters have similar conserved motifs. The protein interaction network of SsARFs showed strong interactions among SsARF3, SsARF4, SsARF5, SsARF6a, SsARF6b, SsARF17, SsARF9a, SsARF9b, SsARF19a, and SsARF19b, which interacted strongly with IAA12, IAA14 and IAA17. SsARF3, SsARF4, SsARF5, SsARF6a, SsARF6b, SsARF9a, SsARF9b, SsARF17, SsARF19a, and SsARF19b, may play an important role in uxin signaling during wax apple fruit development.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Conception and designing of the experiment were done by Xueqin Zhang and Haibo Ouyang. Material preparation and data collection were performed by Xueqin Zhang, Haibo Ouyang and Lixia Lin. ARFs protein analysis was performed by Xueqin Zhang, Lixia Lin and Ruiyun Lai. Transcriptome data analysis and interpretation was performed by Xueqin Zhang, Jianzhong Lin and Zanhua Zhong. The first draft of the manuscript was written by Xueqin Zhang and Haibo Ouyang. Critical revision of the article was carried out by Xueqin Zhang, Haibo Ouyang*, Lixia Lin, Ruiyun Lai, Jianzhong Lin, Zanhua Zhong. All authors read and approved the manuscript.

Funding

The work was supported by the Basic Scientific Research Project (Municipal) of Fujian Institute of Subtropical Botany(3502Z2024YZS08) and the Major Science and Technology Project of Xiamen (No.3502Z20191013).

Data availability

RNA-seq data that support the findings of this study have been deposited in the National Biotechnology Center Archives database with the primary accession code PRJNA1313141.(http://www.ncbi.nlm.nih.gov/bioproject/PRJNA1313141).

Declarations

Competing interests

The authors declare no competing interests.