L-DOPA enhances iRPE differentiation via Wnt signaling and improves cytotherapy for retinal degradation

Abstract

Background

Transplantation of stem cell-derived Retinal Pigment Epithelium (RPE) cells offers significant therapeutic potential for treating retinal degenerative diseases (RDDs). To enhance the efficacy and safety of such cell replacement therapies, it is essential to efficiently generate high-quality RPE donor cells. The crosstalk between dopamine signalling and the Wnt pathway provides an important mechanism underlying RPE cell fate determination during eye development.

Methods

We present a protocol for RPE differentiation from iPSCs with L-DOPA supplementation. The effect of L-DOPA is attributed to the activation of Wnt signalling, mediated through the dopamine D1 receptor, which triggers the downstream cAMP/PKA signalling cascade. Subsequent phosphorylation of GSK3β and β-catenin by PKA facilitates the stabilization and nuclear translocation of β-catenin.

Results

L-DOPA supplementation significantly enhances the efficiency of RPE induction, as well as the maturity and functionality of iRPE. Moreover, L-DOPA-treated iRPE cells demonstrated robust resistance to oxidative stress and exhibited improved therapeutic effects in RCS rats after transplantation, alleviating retinal degeneration and preserving retinal function.

Conclusion

These findings highlight the potential of L-DOPA as a promising adjunct for iRPE differentiation and stem cell-based therapies for RDDs.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13287-026-05074-6.

Background

The Retinal Pigment Epithelium (RPE) cells is a pigmented cell monolayer between the neural retina and choroid that supports vision and maintains retinal health. The loss of RPE is a significant aspect of retinal degenerative diseases (RDDs) such as retinitis pigmentosa (RP), age-related macular degeneration (AMD), and Stargardt disease (STGD) [1]. Since human retina lacks regenerative capacity, researchers have focused on cell replacement therapy, particularly RPE cell transplantation, to restore retinal function in RDDs.

The emergence of induced pluripotent stem cell (iPSC) technology has provided a promising avenue for advancing RPE cell replacement therapy [2]. The transplantation of iPSC-derived RPE cells (iRPE) has shown encouraging results in improving retinal function across various preclinical models of retinal degeneration and clinical studies [3, 4]. The use of retinal-inducing factors such as IGF1, Noggin, Dkk1, and bFGF, along with agents like NIC, Activin A, SU5402, and VIP, has been shown to enhance the differentiation of iPSCs into RPE cells [5]. However, the differentiation of RPE cells is typically inefficient, resulting in mixed cell populations that require further purification. Moreover, the process is time-consuming, usually taking several months, and costly due to the use of specialized growth factors and small molecules. Achieving functional maturation of iRPE cells to match native RPE functionality remains difficult, and variability between different iPSC lines and batches complicates standardization efforts. These challenges hinder large-scale RPE cells production for clinical use, highlighting the need to optimize differentiation protocols for better efficiency, consistency, and cell maturity [6, 7].

Dopamine (DA), the main retinal catecholamine, is produced by dopaminergic amacrine and RPE cells and plays key roles in retinal development, visual signaling, light adaptation, circadian rhythms, and retinal circuits [8, 9]. Most components essential for dopaminergic communication, such as the DA receptor, DOPA decarboxylase (DDC), and the dopamine transporter (DAT), are present in the embryonic retina during early development [8]. G-protein-coupled dopamine receptors are distributed throughout the retina, including the RPE, rod, and cone photoreceptor cells [10]. DA deficiency has been linked to impaired retinal cell differentiation and survival, leading to defects in the retinal structure and function [11].

DA and Wnt/β-catenin signaling exhibit significant crosstalk: dopamine activates D1 receptors and the cAMP/PKA pathway, which phosphorylates β-catenin, enhancing its stability and transcriptional activity [12]. The evolutionarily conserved Wnt/β-catenin pathway regulates development and cell proliferation by stabilizing β-catenin, which translocates to the nucleus to activate target genes. It is essential for retina and RPE development. In the retina, Frizzled receptors (Fz3, Fz4, Fz5) and co-receptors LRP5/6 guide retinal progenitor cell differentiation. In the RPE, Wnt/β-catenin cooperates with Mitf, Otx2, and Pax6 to control development and maintain epithelial characteristics. Disruption of this pathway is linked to developmental defects and retinal diseases. The Wnt agonist CHIR99021 enhances stem cell differentiation into RPE cells and upregulates Wnt components [13].

L-DOPA, the DA precursor, is generated from tyrosine by tyrosine hydroxylase (TH) in amacrine neurons and tyrosinase (TYR) in RPE cells, then converted to DA by aromatic L-amino acid decarboxylase (AADC) or DOPA decarboxylase (DDC) [14]. Mutations in the TYR gene cause oculocutaneous albinism type 1 (OCA1), a condition characterized by pigment deficiency, as well as defects in retinal development, morphology and function [15]. Ectopic expression of TH in the RPE of an OCA1 mouse model restored retinal development and visual function, even in the absence of melanin synthesis [16]. Oral administration of L-DOPA during the postnatal critical period of retinal neuroplasticity improves retinal morphology and visual function by upregulating PEDF and modulating retinal synaptogenesis [17]. When L-DOPA was added to a retinal organoid induction system from iPSCs, the efficiency of photoreceptor generation was significantly improved [18]. This study explored the impact of L-DOPA on RPE differentiation from iPSCs and its interaction with retinal development pathways, aiming to optimize iRPE generation and enhance stem cell-based strategies for RDD treatment.

Methods

hiPSC culture and RPE differentiation

The human iPS cells (iXCells Biotech 30HU-002) were cultured in mTeSR Plus medium (Stemcell Technologies 100–0276) on ESC-qualified Matrigel-coated (Corning 354277) 6-well culture plates. Cells were split every 4 days at a ratio of 1:6 using Versene (Lonza 17-711E).

The protocol for RPE differentiation was adapted from previous reports [19]. hiPSCs were split at a 1:3 ratio and cultured for 4 days until overconfluent. Then the cells were cultured for 7 days in neural induction medium comprising 50% DMEM/F12 (Gibco 11320033) and 50% neurobasal medium (Gibco 21103049), supplemented with 1× B27 (Gibco 17504044), 1x N2 (Gibco 17502048), 10 mM Nicotinamide (Sigma N0636), 10 μm Y-27,632 (Tocris 1254), 55 µM 2-mercaptoethanol (Gibco 21985023), 1x penicillin-streptomycin (GIibco 15140122), and 1x MEM Non-Essential Amino Acids (Gibco 11140050). Medium was changed every 3 days.

From day 7 onward, the culture medium was switched to RPE medium, comprising DMEM, high glucose, GlutaMAX™ Supplement (Gibco 10566016), 20% KnockOut™ Serum Replacement (Gibco 10828028), 55 µM 2-mercaptoethanol (Gibco 21985023), 1x penicillin-streptomycin (GIibco 15140122), and 1x MEM Non-Essential Amino Acids (Gibco 11140050). From day 7 to day 14, RPE medium was supplemented with 100 ng/ml Activin A (R&D 338-AC) as Regent F. reported [20]. From day 7 to day 21, we substituted CHIR99021 with L-DOPA to enhance RPE differentiation efficiency and optimized its timing and dosage through iterative testing. 50 µM L-DOPA (StemCell Technologies, 59-92-7) was added to the culture, which was freshly prepared by dissolving L-DOPA powder in 0.1 M HCl immediately prior to use. then reduced to 10 µM until day 49.

Thereafter, pigmented colonies were isolated mechanically, digested with TrypLE Select (Gibco A12177), and filtered through a 100 μm cell strainer (Corning CLS352360). 50,000 RPE cells were seeded into 24-well plates or Transwell inserts for proliferation and maturation until day 90.

Other growth factors and small molecules include: Wnt inhibitor pyrvinium (Sigma P0027), D1R antagonist SCH23390 (MCE HY-19545 A), D2R antagonist Raclopride (Abcam ab120563), PKA inhibitor H89 (MCE HY-15979 A).

Flow cytometry

On day 49 of differentiation, the differentiated cells were dissociated with 4 mg/ml collagenase type IV (Gibco 17104019) and 0.05% Trypsin-EDTA (Gibco 25300054) into single cells. 1 × 10⁶ cells were fixed with 4% PFA for 10 min at 37 °C and permeabilized with cold 90% methanol for 30 min on ice. The cells were then blocked with 0.5% BSA for 10 min and incubated with the primary antibodies for 1 h at room temperature. After PBS washing, cells were incubated with goat anti-mouse IgG-Alexa Fluor 488 (ThermoFisher A-11001) or goat anti-rabbit IgG-Alexa Fluor 546 (ThermoFisher A-11035) secondary antibody for 30 min at room temperature, followed by flow cytometry analysis using FACS Canto flow cytometer (BD Biosciences). The primary antibodies include rabbit anti-Pax6 (Abcam ab5790), mouse anti-MITF (Abcam ab3201), rabbit anti-BEST1 (Abcam ab14927), rabbit anti-CRALBP (Abcam ab154898), and rabbit anti-RPE65 (Abcam ab235950).

RT² profiler PCR array and quantification of differential genes

At day 49 of differentiation, 1 × 10⁶ cells were harvested for total RNA extraction using the ReliaPrep™ RNA Cell Miniprep System (Promega Z6012), and cDNA was synthesized using the RT² First Strand Kit (Qiagen 330404) following the manufacturer’s protocol. The cDNA was combined with PowerUp SYBR Green Master Mix (Applied Biosystems A25742) and loaded into a 96-well RT² Profiler PCR Array plate (Qiagen PAHS-043YA). Quantitative real-time PCR was conducted using a 7900HT Fast Real-Time PCR System (Applied Biosystems). Qiagen’s online web analysis tool was used to calculate fold change using the ∆∆Ct method. All the data were normalized to an average of five housekeeping genes, ACTB, B2M, GAPDH, HPRT1, and RPLP0. The relative expression of top ten up-regulated genes was further verified by qRT-PCR using primers listed in Table 1.

Table 1.

Primers for quantitative real-time PCR

Gene	Forward (5’-3’)	Reverse (5’-3’)
WNT3A	GCCCCACTCGGATACTTCTTACT	GAGGAATACTGTGGCCCAACA
WNT5A	TGGCTTTGGCCATATTTTTC	CCGATGTACTGCATGTGGTC
WNT1	CTCTTCGGCAAGATCGTCAACC	CGATGGAACCTTCTGAGCAGGA
FZD1	GCTTTGTGTCGCTCTTCCGCAT	TACAGCACGCTGAAGACGCCAA
DVL1	GCATAACCGACTCCACCATGTC	GATGGAGCCAATGTAGATGCCG
LEF1	AGAACACCCCGATGACGGA	GGCATCATTATGTACCCGGAAT
TCF7	CTGGCTTCTACTCCCTGACCT	ACCAGAACCTAGCATCAAGGA
MYC	GGCTCCTGGCAAAAGGTCA	CTGCGTAGTTGTGCTGATGT
JUN	CCTTGAAAGCTCAGAACTCGGAG	TGCTGCGTTAGCATGAGTTGGC
CCND1	TCTACACCGACAACTCCATCCG	TCTGGCATTTTGGAGAGGAAGTG
GPR143	CTATGCAGTGGATGCTTATCTGG	TGGACACGGAAGGGTAGTAGA
GAPDH	ATTGCCCTCAACGACCACT	ATGAGGTCCACCACCCTGT

Nuclear–cytoplasmic fractionation

Nuclear–cytoplasmic fractionation was conducted utilizing the NE-PER Nuclear and Cytoplasmic Extraction Reagents kit (ThermoFisher Scientific 78833) following the manufacturer’s instructions. Briefly, 5 × 10⁶ cells were treated with Cytoplasmic Extraction Reagent I & II to isolate nuclei from the cytoplasmic fraction. Following this, the nuclei pellet was lysed using Nuclear Extraction Reagent (NER) to yield the nuclear extract.

Western blot

5 × 10⁶ cells were harvested and washed with cold PBS, re-suspended in cold RIPA lysis buffer (ThermoFisher Scientific 89900) supplemented with protease inhibitor cocktail (Roche 11697498001). The cells were lysed on ice for 30 min to obtain whole cell lysate. The protein concentration was determined using BCA Protein Assay Kit (ThermoFisher Scientific 23225). 20 µg of whole lysate was applied to SDS-PAGE and transferred to Hybond PVDF membrane (GE Health 15259894), followed by standard western blot procedure. The bound primary antibodies were detected using horseradish peroxidase (HRP)-conjugated secondary antibody and chemiluminescence using ECL detection system (GE Health GERPN2232). Imaging was performed with the UVP Biospectrum Imaging System.

The primary antibodies include mouse anti-β-catenin (Cell Signaling Technology 37447), rabbit anti-Phospho-β-Catenin (Ser33/37/Thr41) (Cell Signaling Technology 9561), rabbit anti-GAPDH (Cell Signaling Technology 8884), mouse anti-Histone H3 (Cell Signaling Technology 3638), rabbit anti-CREB (Cell Signaling Technology 9197), rabbit anti-Phospho-CREB (Ser133) (Cell Signaling Technology 9198), rabbit anti-GSK-3β (Cell Signaling Technology 9315), rabbit anti-Phospho-GSK3β (Ser9) (ThermoFisher Scientific MA5-14873), rabbit anti-Phospho-β-Catenin (Ser675) (Cell Signaling Technology 9567), Goat anti-mouse IgG-HRP (ThermoFisher Scientific 31430), and goat anti-rabbit IgG-HRP (ThermoFisher Scientific 31460).

Luciferase reporter assay

The TCF/LEF Reporter Kit (BPS Bioscience 60500) was employed to monitor the activity of Wnt signaling. Specifically, 1 × 10⁶ cells were subjected to nucleofection (Lonza 4D-Nucleofector) with 1 µg of the TCF/LEF luciferase reporter vector and 20 ng of the Renilla luciferase internal control vector plasmids, using the SF Cell Line 4D-Nucleofector™ X Kit L and program DN-100. Subsequently, the cells were seeded at a density of 100,000 cells per well in a 24-well plate.

After 72 h post-transfection, the cells were lysed and subjected to luciferase activity analysis using the Dual-Luciferase Reporter Assay System (Promega E1910), following the manufacturer’s protocols. Luminescent signals were measured using microplate reader (BMG Labtech, FLUOstar Omega). Firefly luciferase activity was normalized to Renilla luciferase activity for each transfected well.

cAMP assays

Cyclic AMP (cAMP) levels in differentiated cells were quantified using a HitHunter™ cAMP Assay kit (DiscoverX, 90-0075SM10). From day 7 to 21 of RPE differentiation, cells were treated with 50 µM L-DOPA, alone or with 10 µM D1R antagonist SCH-23,390 or 10 µM D2R antagonist Raclopride. Before detection, cells were washed with PBS, then incubated with cAMP antibody and working solution for 60 min, followed by a 3-hour incubation with enzyme acceptor in the dark. Luminescence was read using microplate reader (BMG Labtech, FLUOstar Omega).

iRPE polarity

The apical and basal secretion of PEDF and VEGF was analyzed to assess iRPE polarity. iRPE cells were cultured on 24-well Transwell inserts for three weeks. Media from the apical (top) and basal (bottom) chambers were collected for PEDF analysis using a Human PEDF ELISA Kit (Thermo Fisher EH415RB) and VEGF analysis with a Human VEGF ELISA Kit (Thermo Fisher KHG0111). The PEDF and VEGF concentrations were normalized to the media volume (mL) and the growth area (mm²) of the original culture plate.

Phagocytosis assay

Photoreceptor outer segments (POS) were isolated from bovine retina and labelled with 0.4 mg/ml FITC (Sigma-Aldrich F7250) for 1 h at room temperature in the dark. iRPE cells cultured on coverslips in multi-well plates were exposed to 1 × 10⁶ POS-FITC per cm² and incubated for 4 h at 37 °C, after which they were washed four times with PBSCM (PBS supplemented with CaCl2 and MgCl2). For immunostaining of ZO-1, cells were fixed with 4% paraformaldehyde for 10 min, permeabilized with 0.1% Triton X-100 for 15 min, and then incubated with the ZO-1 monoclonal antibody (Thermo Fisher ZO1-1A12) in a humidified chamber overnight at 4 °C. This was followed by a 30-minute incubation at room temperature with a goat anti-mouse secondary antibody conjugated to Alexa Fluor™ 568 (Thermo Fisher A-11004) in a humidified chamber. Imaging was performed on a Nikon A1R confocal microscope using the NIS Elements software, and ImageJ was used for image analysis and quantification of signals from internalized POS.

Trans-epithelial resistance (TER) measurement

TER measurements were performed using a Millicell ERS-2 Voltohmmeter (Millipore, MERS00002). Each sample was measured twice for accuracy. The resistance of a blank insert (without cells) was subtracted from the resistance of the cell-containing insert. The resulting value was then multiplied by the effective membrane area to calculate the unit area resistance using the formula: TER (Ω·cm²) = (measured resistance − blank resistance) × membrane area (cm²).

Oxidative stress and apoptosis assay

The iRPE cells were treated with 0.1-1 mM H₂O₂ for 1 h and cultured at 37 °C for 24 h. Apoptosis assay was performed using PE Annexin V Apoptosis Detection Kit (BD Pharmingen 559763). After PBS wash, the cells were resuspended in 1x Binding Buffer at a concentration of 1 × 10⁶ cells/ml. Subsequently, 100 µl of the cell suspension was incubated with 5 µl of PE Annexin V and 5 µl of 7-AAD for 15 min at room temperature in the dark. Following incubation, 400 µl of 1X Binding Buffer was added before flow cytometry analysis using the Attune™ NxT Flow Cytometer (Thermo Fisher Scientific).

Blue light illumination and cell viability assay

20,000 iRPE cells were cultured in each well of 96-well plate and exposed to 445 nm blue light irradiance with an intensity of 4 mW/cm² for 24 h. At time points during the treatment, cell viability was measured using Resazurin Cell Viability Kit (Cell Signaling Technology 11884). 10 uL resazurin solution was added into each well and incubate for 4 h at 37 °C. Fluorescence was measured at 544/590 nm (excitation/emission) using a microplate reader (BMG Labtech, FLUOstar Omega).

Transplantation of iRPE cells in royal college of surgeons (RCS) rats and electroretinography (ERG) test

This study is reported in accordance with the ARRIVE Guidelines 2.0. All animal procedures were approved by the Animal Care and Use Committee of Tianjin Medical University Eye Hospital (protocol no. TJYY2022120241) and conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Male RCS rats (n = 40, 3 weeks old) were housed under controlled conditions (20–26 °C, 50 ± 10% relative humidity, 10–20 air changes h⁻¹, 12 h light/12 h dark cycle at 150–300 lx). Animals were acclimatized for ≥ 7 days in polysulfone cages (W 395 × L 346 × H 213 mm) at three rats per cage, then randomly allocated to four groups (n = 10 each): (1) control group, (2) L-DOPA group, (3) PBS group, (4) age-matched non-surgery control (AMC) group. For all surgical procedures, anaesthesia of rat was induced with Zoletil (40 mg/kg) and xylazine (10 mg /kg), administered intraperitoneally, and 1 × 10⁵ iRPE cells in 2 µl PBS (or PBS alone) were injected into the subretinal space using a micro-injector under a dissecting microscope (Zeiss).

Sixty days post-transplantation, ERG was conducted to evaluate retinal function. Rats were dark-adapted for 16 h and re-anesthetized. Pupils were dilated with 0.1% atropine and 0.1% phenylephrine. Scotopic ERGs were recorded from both eyes using a chlorided silver wire on the cornea, with topical tetracaine and methylcellulose for hydration. A reference electrode was placed on the temporal sclera, and a ground electrode clipped to the left ear. Signals were amplified (gain: 10,000; bandpass: 0.1–1000 Hz), filtered, and digitized at 10 kHz. Twenty to forty responses were averaged with 3–60 s flash intervals using a Ganzfeld bowl and 50-ms flashes up to 4 log cd/m². The b-wave threshold was set at 20 µV.

Histological analysis and immunofluorescence staining

After ERG recording, rats were euthanized with sodium pentobarbital overdose. Eyes were collected and fixed overnight at 4 °C in 2% paraformaldehyde and 2.5% glutaraldehyde. Epon-embedded tissue was sectioned (1 μm) along the vertical meridian through the optic nerve and stained with toluidine blue for light microscopy [21].

ONL thickness was assessed by counting nuclei and measuring the layer width. In RCS rats, the combined thickness of the rod outer segments (ROS) and accumulated debris (Debris + ROS) was also measured. The pyknosis rate was calculated as the number of pyknotic nuclei normalized to the total ONL nuclei in the same region. Measurements were taken every 400 μm, starting 200 μm from the optic nerve head, across both the superior and inferior retinal halves.

For immunofluorescence, sections were fixed with 2% formaldehyde, permeabilized with 0.5% Triton X-100, and incubated with anti-CRX antibody (Abcam, ab140603) overnight at 4 °C. This was followed by incubation with Alexa Fluor^® 594-conjugated secondary antibody (Abcam, ab150080) for 2 h at room temperature in the dark, and imaging with confocal microscopy.

Statistical analysis

Data were analyzed using GraphPad Prism 6.0 (GraphPad Software Inc., San Diego, CA, USA) and are presented as mean ± Standard Error of the Mean (SEM). Comparisons between two groups were performed using an unpaired t-test. For comparisons among multiple groups, one-way or two-way analysis of variance (ANOVA) followed by post hoc tests was applied. A p-value < 0.05 was considered statistically significant.

Results

L-DOPA promoted iPSCs differentiation into RPE cells

RPE cells were derived from iPSCs using a three-stage differentiation strategy (Fig. 1A). Between day 14 and day 21, clustering of pigmented RPE cells began to emerge in the culture wells. On days 21, 35, and 49, the proportion of pigmented areas in the culture wells was measured and analyzed using ImageJ. Compared to the control, the L-DOPA group exhibited a significantly larger pigmented area at all time points (Fig. 1B). Flow cytometry was performed on samples of day 49 to analyze the expression of early RPE markers (PAX6 and MITF) and mature RPE markers (BEST1, CRALBP, and RPE65). Compared to the control, the L-DOPA group showed a significantly higher percentage of cells expressing the tested RPE markers, corroborating the observed pigmentation proportion results, indicating that L-DOPA substantially enhanced iPSC-RPE differentiation efficiency (Fig. 1C).

Fig. 1.

Differentiation of hiPSC-derived RPE cells. A Schematic of differentiation protocol. B Measurement and comparison of pigmented areas in cultures at various time points during RPE differentiation. C Flow cytometry analysis of the expression of RPE markers. Data are represented as mean ± SEM, n = 3; statistical analysis was performed using unpaired two-tailed t-tests; **p < 0.01, ***p < 0.001

L-DOPA stimulated iRPE induction through activation of the Wnt signaling pathway

RT² Profiler PCR array was applied to day 21 differentiating cell samples to examine the expression profile of genes associated with the Wnt signaling pathway. Among the 84 candidates examined, we identified 20 genes that displayed differential expression in the L-DOPA treatment group compared to the control: 16 genes were upregulated, and 4 genes were downregulated (Fig. 2A). The upregulated genes included Wnt ligands (WNT1, WNT2, WNT3, WNT3A, WNT5A), Wnt receptors (FZD1, FZD4, LRP5, LRP6), Wnt signal transducers (DVL1, DVL2), transcription factors (TCF7, LEF1), and Wnt target genes MYC, JUN, and CCND1. The downregulated genes were DKK1, NKD, APC, and NLK. The upregulation of the top 10 genes was validated by qRT-PCR, and the increased levels of their corresponding proteins were confirmed by Western blot. (Fig. 2B, C).

Fig. 2.

RT² Profiler PCR array analysis of Wnt signaling pathway genes in differentiating iPS cells, with verification of differential gene and protein expression. A Identification and mapping of differential genes to the Wnt signaling pathway. B Verification of top differential genes by real-time qRT-PCR. Data are represented as mean ± SEM, n = 3; statistical analysis was performed using unpaired two-tailed t-tests; *p < 0.05, **p < 0.01, ***p < 0.001. C Verification of top differential proteins by western blot

To verify the stimulation of Wnt signaling by L-DOPA, we treated differentiating cells with various concentrations of L-DOPA from day 7 to day 21 and examined the levels of phosphorylated (Ser33/37/Thr41) β-catenin in whole cell lysates, as well as β-catenin levels in the nuclear extracts. The phosphorylation of β-catenin decreased with increasing concentrations of L-DOPA (Fig. 3A). Conversely, nuclear β-catenin levels increased in a dose-dependent manner following L-DOPA treatment (Fig. 3B). In addition, Wnt signaling activity was assessed using a TCF/LEF luciferase reporter assay. Consistent with the increased nuclear localization of β-catenin, TCF/LEF reporter-transfected cells exhibited increasing luciferase activity with rising L-DOPA concentrations (Fig. 3C). These findings indicate the correlation between L-DOPA treatment and the activation of the Wnt signaling pathway during RPE differentiation process.

Fig. 3.

L-DOPA stimulated iRPE induction by activating the Wnt signaling pathway. A, B L-DOPA reduced β-catenin phosphorylation and enhanced its nuclear localization in response to increasing concentrations. C Luciferase assay confirmed that Wnt signaling was stimulated by L-DOPA in a dose-dependent manner. Bars represent mean ± SEM of three independent experiments. Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test, F(5, 12) = 26.59. *p < 0.05, **p < 0.01, ***p < 0.001. D, E Pigmented area quantification and flow cytometry analysis showing that the Wnt inhibitor abolished the promotive effect of L-DOPA on iRPE differentiation. Data are represented as mean ± SEM, n = 3; statistical analysis was performed using unpaired two-tailed t-tests; *p < 0.05, **p < 0.01, ns: not significant. PYR: pyrvinium

To determine if L-DOPA enhanced RPE induction via Wnt pathway activation, the Wnt inhibitor pyrvinium was co-administered with L-DOPA, and RPE differentiation efficiency was evaluated. The L-DOPA sole treatment significantly increased the percentage of pigmented area and the proportion of RPE65-expressing cells, while pyrvinium co-application reduced both parameters to control levels (Fig. 3D, E). The reversal of L-DOPA’s effects by Wnt inhibition confirmed that Wnt signaling is essential for mediating L-DOPA’s pro-differentiation activity.

L-DOPA activated Wnt signaling via the cAMP-PKA pathway

DA binds to G protein-coupled D1R and D2R, which are highly expressed in the retina. To identify which receptor mediates L-DOPA-induced activation of Wnt signaling, we treated differentiating cells from day 7 to day 21 with either the D1R antagonist SCH23390 or the D2R antagonist Raclopride, in combination with L-DOPA, and Wnt signaling activity was then assessed by luciferase assay. The activation of Wnt signaling by L-DOPA was inhibited by SCH23390 but was not affected by Raclopride, suggesting that L-DOPA stimulates Wnt signaling through D1R rather than D2R (Fig. 4A).

Fig. 4.

L-DOPA activated the Wnt signaling via the cAMP-PKA pathway. A, B D1R antagonist SCH2390 suppressed Wnt signaling stimulation and cAMP accumulation by L-DOPA. C D1R inhibition abolished PKA activation by L-DOPA. D L-DOPA promoted Ser9-phosphorylation of GSK3β, which was diminished by the PKA inhibitor H89. E L-DOPA enhanced Ser675-phosphorylation of β-catenin and its nuclear localization, an effect reversed by H89. F Luciferase assay confirmation of Wnt signaling stimulation by L-DOPA, which was diminished by H89. Data are represented as mean ± SEM, n = 3; statistical analysis was performed using unpaired two-tailed t-tests; *p < 0.05, **p < 0.01, ns: not significant

D1R typically couple to Gs protein to stimulate adenylyl cyclase (AC) activity, thereby increasing intracellular cyclic AMP (cAMP) levels, which activate cAMP-dependent protein kinase (PKA). We examined cAMP levels and PKA activity in differentiating cells treated with L-DOPA and dopamine receptor antagonists. L-DOPA treatment significantly increased intracellular cAMP levels, an effect that was reversed by the D1R antagonist SCH23390 but not affected by the D2R antagonist Raclopride (Fig. 4B). cAMP response element-binding protein (CREB) is a major target of PKA. The level of phosphorylated CREB (p-CREB) reflects the activation state of PKA and the cAMP signaling pathway. Consistent with the changes in cAMP levels in response to dopamine receptor antagonists, the L-DOPA-induced p-CREB increase was abolished by SCH23390 but not Raclopride (Fig. 4C). This indicates that L-DOPA activates cAMP-PKA signaling through D1R stimulation in differentiating cells.

To assess the role of PKA in the crosstalk between dopamine signaling and the Wnt pathway, differentiating cells were treated from day 7 to day 21 with PKA inhibitor H89 and L-DOPA, and the phosphorylation of GSK3β and β-catenin was evaluated. The level of Ser9-phosphorylated GSK3β was increased by L-DOPA treatment, an effect that was diminished by the PKA inhibitor H89, indicating that L-DOPA promotes GSK3β Ser9 phosphorylation through PKA. Similarly, L-DOPA treatment enhanced β-catenin phosphorylation at Ser675, a response also inhibited by H89 (Fig. 4D and E). Moreover, the luciferase assay revealed that H89 counteracted the L-DOPA-induced promotion of TCF/LEF transcription activity (Fig. 4F), corroborating the mediation role of PKA between L-DOPA and Wnt signaling activity.

These findings establish the signaling cascade through which L-DOPA activates the Wnt pathway: L-DOPA/DA → D1R → Gs protein → AC → cAMP → PKA → GSK3β/β-catenin → TCF/LEF (Fig. 5). This model partly explains how L-DOPA promotes RPE differentiation from iPSCs and proposes a potential regulatory mechanism during RPE development.

Fig. 5.

Schematic of signaling cascade illustrating crosstalk between L-DOPA and Wnt pathway. L-DOPA activates D1R, which activates AC via Gαs. The activated AC promotes cAMP accumulation, leading to PKA activation. Activated PKA phosphorylates GSK3β at Ser9 and β-catenin at Ser675, increasing β-catenin stability. Consequently, more β-catenin translocates into the nucleus, binds to TCF/LEF transcription elements, and promotes the expression of Wnt signaling target genes. L-DOPA: Levodopa, DA: Dopamine, D1R: D1-like receptor, Gαs: G protein alpha subunit, AC: Adenylyl cyclase, PKA: Protein kinase A, TCF/LEF: T-cell factor / Lymphoid enhancer-binding factor

On days 21, 35, and 49 of RPE differentiation, dopamine concentrations in the culture medium were measured. At days 35 and 49, the L-DOPA-treated group exhibited higher dopamine levels compared to the control group (Fig. S1). This elevated dopamine secretion suggests the presence of an active release mechanism, which may contribute to a positive feedback loop that further promotes RPE cell proliferation.

GPR143, a G protein–coupled receptor (GPCR) has been identified as the receptor for L-DOPA [22]. GPR143 is highly expressed in the retinal pigment epithelium (RPE) and is essential for normal pigmentation and melanosome biogenesis in the RPE. Mutations in the GPR143 gene are the primary cause of X-linked Ocular Albinism Type 1 (OA1) [23].

To investigate the role of GPR143 in the effects of L-DOPA on iRPE induction, shRNA-mediated knockdown of GPR143 was performed in iPS cells undergoing RPE differentiation. Compared with the control, GPR143 knockdown significantly impaired RPE differentiation, supporting its critical role in RPE development. Notably, L-DOPA supplementation markedly enhanced differentiation efficiency in both control and GPR143-knockdown groups, with no significant difference between them. Although a trend toward reduced RPE differentiation was observed with GPR143 knockdown, its impact on L-DOPA-mediated promotion of differentiation appeared minimal (Fig. S2C). In a TCF/LEF luciferase reporter assay, comparable luciferase activity was detected in the control and GPR143-knockdown groups, with or without L-DOPA treatment, indicating that GPR143 is not involved in regulating Wnt signaling under these conditions (Fig. S2D).

L-DOPA enhanced maturation and functionality of iRPE cells

On day 90, when a densely packed monolayer of hexagonal, pigmented cells had formed (Fig. 6A), we assessed the expression of RPE maturation markers CRALBP, BEST1, and RPE65. The levels of all three markers were significantly higher in the L-DOPA group, indicating a greater degree of RPE cell maturation (Fig. 6B).

Fig. 6.

L-DOPA enhanced maturation and functionality of iRPE cells. A densely packed monolayer of hexagonal, pigmented iRPE cells. Scale bar = 50 μm. B Western blot analysis of RPE maturation markers CRALBP, BEST1, and RPE65. C Examination of iRPE polarity through apical and basal secretion of PEDF and VEGF. D Comparison of TER between control and L-DOPA iRPE. E Comparison of POS phagocytosis between control and L-DOPA iRPE. Scale bar = 20 μm. Data are represented as mean ± SEM, n = 3; statistical analysis was performed using unpaired two-tailed t-tests; *p < 0.05, **p < 0.01, ***p < 0.001, ns: not significant

To assess iRPE polarity, cells were cultured on Transwell inserts for three weeks, and apical PEDF and basal VEGF secretion were analyzed by ELISA (Fig. 6C). In the L-DOPA group, PEDF secretion was significantly higher in the apical media, and VEGF secretion was higher in the basal media, indicating established polarity. In contrast, the control group showed only a modest trend toward polarized secretion, with no significant apical-basal differences.

Further, trans-epithelial resistance (TER) was measured to assess tight junction integrity in iRPE cells. Compared to control, the L-DOPA group exhibited a significantly higher TER, reflecting a well-established epithelial barrier (Fig. 6D).

Phagocytosis of photoreceptor outer segment (POS) fragments is a hallmark of mature RPE functionality. By POS uptake assay, the L-DOPA group demonstrated a significantly higher percentage of cells with internalized POS and greater fluorescence intensity, indicating a more robust phagocytic capacity and advanced maturation (Fig. 6E).

Increased viability of L-DOPA induced iRPE cells under oxidative stress

To assess iRPE cell viability under oxidative stress, cells were exposed to H₂O₂, and apoptotic cells were quantified using Annexin V and 7-AAD staining. Flow cytometry data revealed a significantly lower percentage of early (Annexin V⁺/7-AAD⁻) and late (Annexin V⁺/7-AAD⁺) apoptotic cells in the L-DOPA group, indicating enhanced stress resistance (Fig. 7A). Western blotting also revealed reduced poly (ADP-ribose) polymerase (PARP) cleavage in the L-DOPA group (Fig. 7B).

Fig. 7.

L-DOPA enhanced iRPE viability under oxidative stresses. A Annexin V/7-AAD analysis of iRPE apoptosis under H₂O₂-induced oxidative stress. B Western blot analysis of PARP cleavage in iRPE under various H₂O₂ concentrations. Data are represented as mean ± SEM, n = 3; statistical analysis was performed using unpaired two-tailed t-tests in panel A, B; *p < 0.05, **p < 0.01. C Viability assay of iRPE cells exposed to blue light-induced photooxidative stress. Two-way ANOVA revealed a significant effect of exposure time [F(8, 16) = 282.8, p < 0.0001], L-DOPA treatment [F(1, 2) = 145.6, p = 0.0068], and a significant L-DOPA treatment × exposure time interaction [F(8, 16) = 11.65, p < 0.0001]. Data are presented as mean ± SEM, n = 3. Bonferroni post hoc comparisons were performed for each time point. Significant differences between Ctrl and L-DOPA were observed from 12 h onward, with higher cell viability in the L-DOPA group (*p < 0.05, **p < 0.01, ***p < 0.001). NTC: non-treated control

Moreover, iRPE cells were exposed to 445 nm blue light (4 mW/cm²) for 24 h, and viability was measured at intervals using the Resazurin assay. A time-dependent response to blue light exposure was observed in both groups, but the L-DOPA group exhibited a higher survival rate (Fig. 7C). L-DOPA-induced iRPE cells show greater resilience to photooxidative stress, suggesting a protective role of L-DOPA in preserving cell viability under blue light-induced oxidative damage.

Transplantation of L-DOPA induced iRPE cells effectively alleviated retinal degradation and preserved retinal function

iRPE cells were transplanted into the subretinal space of RCS rats to assess effects on retinal structure and function. Electroretinography (ERG) test showed that the L-DOPA-iRPE group animals exhibited significantly higher Max-b wave amplitudes than the control iRPE group at light intensities of 1.5 and 4 log candela (cd)/m². In contrast, faint responses dominated the ERG across the entire intensity range in both the PBS and age-matched non-surgery control (AMC) groups. Regarding the latency of the Max-b wave, the L-DOPA-iRPE group showed shorter b-wave times at all light intensities compared to the control iRPE group (Fig. 8A).

Fig. 8.

iRPE transplantation in RCS rat eyes. A ERG analysis of retinal response to light stimulation. Data are represented as mean ± SEM, n = 3; statistical analysis was performed using unpaired two-tailed t-tests; *p < 0.05, **p < 0.01. B Examination of retinal histology structure using H&E staining. Arrow heads indicate pyknotic cells. Scale bar = 100 μm. n = 5; statistical analysis was performed using unpaired two-tailed t-tests; *p < 0.05, **p < 0.01, ***p < 0.001. C Observation of CRX expression using immunofluorescence microscopy. Scale bar=100 μm. AMC: age-matched non-surgery control

By H&E staining, the retinal histology in all groups was examined (Fig. 8B). In the AMC and PBS group rat eyes, the inferior retina exhibited a severely degraded ONL, with fewer than one complete layer of nuclei remaining. In contrast, the control iRPE-transplanted eyes displayed partial preservation, with one to two rows of ONL cells observed in the upper hemisphere. Notably, in the L-DOPA-iRPE-transplanted eyes, the inferior retina of RCS rats retained three to four rows of ONL cells. In the AMC and PBS group rat eyes, high pyknotic cell rate was observed, while the iRPE cells transplanted animals showed a significant decrease. The L-DOPA-iRPE group demonstrated the lowest pyknotic cell rate among all groups. Additionally, the debris + ROS zone was significantly thinner in the iRPE-transplanted eyes compared to the AMC and PBS groups. Of note, the L-DOPA group exhibited a reduced debris + ROS thickness compared to the control iRPE-transplanted animals.

By immunofluorescence microscopy, we observed the expression of cone-rod homeobox (CRX), a key photoreceptor marker, in retinal tissues across different experimental groups (Fig. 8C). Consistent with histological findings, the AMC and PBS groups exhibited low levels of CRX expression, which correlated with severe photoreceptor degradation. In contrast, groups treated with iRPE cell transplantation demonstrated significantly higher levels of CRX expression. The L-DOPA-iRPE group showed greater CRX expression compared to the control iRPE recipient group. These findings underscore the potential of L-DOPA-treated iRPE transplantation in preserving photoreceptors and mitigating retinal degeneration.

Discussion

This study shows that L-DOPA supplementation significantly enhances the generation, maturation, and function of iPSC-derived RPE cells, highlighting its potential to improve RPE quality for transplantation. In the retina, L-DOPA is taken up and enzymatically decarboxylated by aromatic L-amino acid decarboxylase (AADC) to form dopamine (DA), a major neuromodulator in retinal tissue that acts via D1-like and D2-like receptors to regulate cellular signaling, circadian rhythms, synaptic transmission, and light adaptation across multiple retinal cell types (including photoreceptors and amacrine cells) [9]. DA has well-established roles in retinal development and function, influencing aspects of neural differentiation, gap junction coupling, and visual signal processing. It also modulates the retina-RPE-choroid-sclera cascade, influencing eye growth signaling pathways [24]. DA affects basal membrane chloride conductance in chick RPE and alters intracellular calcium in human RPE cultures [25, 26]. However, the role of DA in RPE development remains unclear, Wnt signaling from the surface ectoderm is crucial for RPE development. Deletion of Wntless, a protein essential for Wnt secretion, impairs Wnt signaling and significantly reduces the number of RPE cells [27]. Inhibition of Wnt secretion in optic cups reduces RPE cell counts, while Wnt3a supplementation promotes RPE differentiation and suppresses neural retina formation, highlighting Wnt’s dual role in cell fate [28].

RPE differentiation from iPSCs often uses the Wnt activator CHIR99021 after anterior neural ectoderm (ANE) and eye field (EF) differentiation, effectively guiding EF cells into RPE cells [29–31]. In our protocol, L-DOPA application from early stage significantly enhanced RPE differentiation. Although direct evidence in the RPE context is lacking, the DA-Wnt crosstalk has been documented in other tissues. In a rat model of Parkinson’s disease, activation of the dopamine D1 receptor is involved in the stimulation of Wnt signaling [1]. In human renal cells, D2 receptor signaling via β-arrestin-2 reduces β-catenin phosphorylation, promoting its nuclear translocation and enhancing Wnt3a expression and TCF/LEF transcription [32]. In this study, L-DOPA-treated cells showed upregulation of key Wnt signaling components, suppressed β-catenin phosphorylation, promoted nuclear translocation, and enhanced TCF/LEF luciferase activity. The Wnt inhibitor blocked L-DOPA’s effect on RPE induction, confirming L-DOPA acts via Wnt pathway activation in RPE induction.

The dopamine D1 receptor DRD1 is the predominant receptor subtype expressed during early embryonic development [33, 34]. In iPS-derived retinal organoids, L-DOPA stimulates the expression of DRD1 and TH while suppressing DRD2 prior to the development of DACs [35]. In the current study, D1 receptor inhibition blocked L-DOPA-induced Wnt activation, while D2 antagonism had no effect. D1 activation by L-DOPA elevated cAMP, activating PKA, which phosphorylated GSK3β (Ser9) and β-catenin (Ser675), stabilizing β-catenin and promoting its nuclear translocation [36]. This DR1–PKA–Wnt axis links dopamine signaling to Wnt pathway activity during retinal development and RPE cell fate.

Although L-DOPA has been identified as an endogenous ligand of GPR143, there is currently no direct evidence demonstrating that L-DOPA regulates RPE development or maturation through activation of GPR143. Existing studies primarily link GPR143 to melanosome biogenesis, pigmentation, and basal RPE integrity, while its role in mediating L-DOPA–dependent developmental signaling remains unclear. In line with this, our data suggest that the enhancement of iRPE differentiation by L-DOPA occurs independently of GPR143 and is instead mediated predominantly through dopamine D1 receptor–dependent activation of Wnt signaling. This interpretation is further supported by the context-dependent nature of dopaminergic signaling, in which GPR143 has been shown to modulate dopamine D2 receptor function in certain settings [37], but does not appear to participate in the D1–Wnt axis operative during iPSC-derived RPE differentiation. Together, these observations support a model in which GPR143 contributes to fundamental aspects of RPE biology, while L-DOPA enhances iRPE induction through a distinct dopamine receptor–mediated pathway.

Retina is highly susceptible to oxidative stress, making the viability of transplanted RPE cells crucial for the replacement therapies. L-DOPA-induced iRPE cells demonstrated superior resistance to H₂O₂ and blue light stress compared to controls, aligning with DA and DRD1 agonists preventing retinal apoptosis through AC and PKA pathways [38]. Elevated cAMP levels are known to reduce NADPH oxidase activity in cells, thereby decreasing oxidative stress [39].

Wnt signaling pathway also serves as a key regulator of cellular responses to oxidative stress. In hepatocytes, β-catenin activation inhibits the pro-apoptotic factor FoxO3, promoting cell survival [40]. Wnt3a stabilizes Nrf2, and the Axin1/NRF2 complex upregulates antioxidant enzymes HO-1 and NQO1, mitigating oxidative stress [41]. The response to Wnt activation is context-dependent, and it’s unclear if Wnt signaling mediates the improved oxidative stress resistance in L-DOPA-treated iRPE cells.

Mature RPE cells possess a robust antioxidant system, including superoxide dismutase and glutathione, to counter retinal oxidative stress [42]. A multi-omics study revealed a metabolic shift in developing iPSC-RPE cells, with increased TCA metabolites like succinate and peak glycolysis at the RPE commitment stage [43]. Mature hPSC-derived RPE cells show greater oxidative stress resistance than immature ones, due to stronger barrier function, better phagocytosis, and enhanced calcium signaling [44].

DA is essential for melanogenesis in RPE cells. As a hallmark structure of mature RPE cells, melanosome plays a vital protective role through various mechanisms, including light absorption by melanin pigment [45], inhibition of photosensitized and iron-mediated oxidation [46], and free radical scavenging [47]. PEDF and VEGF, highly expressed in mature RPE cells, significantly protect them against oxidative stress [48]. PEDF protects RPE cells from oxidative stress by stabilizing mitochondrial networks, maintaining membrane potential (ΔΨm), and reducing ROS levels [49]. VEGF is strongly induced by oxidative stress in RPE cells. Activation of VEGF receptors, particularly VEGF-R2, triggers the PI3K/Akt signaling cascade, which promotes cell survival under oxidative stress conditions [50]. L-DOPA treatment enhances iRPE cell maturation and function, improving resistance to oxidative stress and in vivo viability. When transplanted into RCS rat retinas, L-DOPA-treated cells preserve retinal structure, reduce degeneration, and improve electrophysiological responses. This strategy supports scalable production and clinical application of iPSC-derived RPE cells for treating degenerative retinal diseases.

Conclusion

DOPA proves to be a promising adjunct in stem cell-based regenerative medicine, particularly for enhancing iPSC-derived RPE cell differentiation and function. While the Wnt signaling pathway plays a significant role, other mechanisms likely contribute to L-DOPA’s benefits. Future research could further elucidate these pathways and extend the approach to other PSC-derived lineages, expanding its potential for diverse degenerative diseases. Integrating insights from both retinal and neurological regenerative therapies, L-DOPA supplementation offers a compelling strategy to improve the safety, efficacy, and scalability of stem cell treatments.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

YF.K and XJ.R conceived the idea and designed the experiments. YF.K, YX.Z and Q.F perfromed the experiments. X.M and TL.Z analyzed the data. MX.Z handled the figure and table. YF.K, YX.Z and Q.F wrote the manuscript. XJ.R supervised the study. YF.K, YX.Z and Q.F contributed equally to this research. All the authors have read and approved the final version for publication.

Funding

This study was sponsored by National Natural Science Foundation of China (Grant No. 82160202), Tianjin Health Research Project (Grant No.TJWJ2023MS010), Key Project of Natural Science in Colleges and Universities of Anhui Province (Grant No. 2022AH052324).

Data availability

Data supporting this study are included within the article. This study did not generate new unique reagents. Requests for resources further information and reagents should be directed to and will be fulfilled by the lead contact, Xinjun Ren (Xin2023Ren@tmu.edu.cn).

Declarations

Ethics approval and consent to participate

The project “Research on Dopamine-Induced Differentiation of Pluripotent Stem Cells into Retinal Pigment Epithelium for the Treatment of Retinal Degenerative Diseases (TJYY2022120241)” was approved by the Animal Care and Use Committee of Tianjin Medical University Eye Hospital (May 21, 2023). Human iPSC line 30HU-002 used in this study were obtained commercially from iXCells Biotechnologies(https://ixcellsbiotech.com/product/human-ips-cell-line-normal/?utm_source=chatgpt.com). According to documentation provided by the supplier, the original human tissue samples used to derive the iPSC line were ethically sourced, IRB-approved human tissue or blood samples with full regulatory compliance (https://ixcellsbiotech.com/introducing-ipscore/?utm_source=chatgpt.com). The cells were used under the terms and conditions of the supplier, and all research complied with institutional ethical standards for use of commercially sourced human cell products.

Consent for publication

All necessary consent and approvals were obtained from all authors and co-authors.

Competing interests

The authors declare no competing interests.