A novel photosensitizer (hE26) for photodynamic therapy enhances anticancer efficacy via reactive oxygen species-induced mitochondrial apoptosis in non-small cell lung cancer

Baljinnyam Lkham-Erdene; Jargal-Erdene Batmunkh; Jin Matsumoto; Kengo Kai; Koki Shimamawari; Takumi Ishizuka; Toshiki Kubota; Ganzorig Baatar; Phyu Synn Oo; Kham Mo Aung; Haruka Yokogawa; Ryonosuke Kai; Yoshitaka Hishikawa

doi:10.3389/fonc.2026.1881286

. 2026 Jul 24;16:1881286. doi: 10.3389/fonc.2026.1881286

A novel photosensitizer (hE26) for photodynamic therapy enhances anticancer efficacy via reactive oxygen species-induced mitochondrial apoptosis in non-small cell lung cancer

Baljinnyam Lkham-Erdene ^1,^2,^†, Jargal-Erdene Batmunkh ^1,^†, Jin Matsumoto ³, Kengo Kai ^1,⁴, Koki Shimamawari ³, Takumi Ishizuka ¹, Toshiki Kubota ^1,⁵, Ganzorig Baatar ², Phyu Synn Oo ¹, Kham Mo Aung ¹, Haruka Yokogawa ¹, Ryonosuke Kai ^1,⁵, Yoshitaka Hishikawa ^1,^6,^*

¹Department of Anatomy, Histochemistry and Cell Biology, Faculty of Medicine, University of Miyazaki, Miyazaki, Japan

²Department of Thoracic Surgery, National Cancer Center of Mongolia, Ulaanbaatar, Mongolia

³Department of Applied Chemistry, Faculty of Engineering, University of Miyazaki, Miyazaki, Japan

⁴Department of Surgery, Faculty of Medicine, University of Miyazaki, Miyazaki, Japan

⁵Department of Oral and Maxillofacial Surgery, Faculty of Medicine, University of Miyazaki, Miyazaki, Japan

⁶Frontier Science Research Center, University of Miyazaki, Miyazaki, Japan

Correspondence: Yoshitaka Hishikawa, yhishi@med.miyazaki-u.ac.jp

†These authors have contributed equally to this work and share first authorship

Roles

Baljinnyam Lkham-Erdene: Formal analysis, Resources, Project administration, Writing – original draft, Data curation, Visualization, Writing – review & editing, Validation, Conceptualization, Software, Investigation, Methodology

Jargal-Erdene Batmunkh: Visualization, Formal analysis, Writing – original draft, Resources, Project administration, Methodology, Software, Validation, Investigation, Writing – review & editing, Conceptualization, Data curation

Jin Matsumoto: Resources, Writing – review & editing, Investigation

Kengo Kai: Writing – review & editing, Funding acquisition, Resources

Koki Shimamawari: Investigation, Resources, Writing – review & editing

Takumi Ishizuka: Resources, Writing – review & editing, Funding acquisition

Toshiki Kubota: Resources, Writing – review & editing

Ganzorig Baatar: Writing – review & editing, Resources

Phyu Synn Oo: Resources, Writing – review & editing

Kham Mo Aung: Writing – review & editing, Resources

Haruka Yokogawa: Resources, Writing – review & editing

Ryonosuke Kai: Resources, Writing – review & editing

Yoshitaka Hishikawa: Conceptualization, Methodology, Supervision, Funding acquisition, Writing – review & editing, Resources, Writing – original draft

PMCID: PMC13447161 PMID: 42568404

Abstract

Introduction

Non-small cell lung cancer (NSCLC) remains a leading cause of mortality and thus requires novel therapeutic interventions. Although our previously synthesized phosphorus tetraphenylporphyrin (E26) effectively induces cell death via photodynamic therapy (PDT), its 610-nm excitation wavelength limits deep-tissue penetration. To address this limitation, we developed a novel hydrogenated derivative, hE26, in which excitation is shifted to an optimized longer wavelength of 660 nm.

Methods

The anticancer potential of the novel hE26-mediated PDT and the former compound E26 was compared in human NSCLC cells via MTT, wound healing, immunohistochemistry, and qPCR analyses.

Results

In A549, EBC-1, and ACC-MESO-4 cells, hE26-mediated PDT significantly reduced cell viability in a dose-dependent manner in low-dose ranges compared with E26. At the same dose (15 nM), significant inhibition of cell proliferation and migration was observed in hE26-treated NSCLC cells. hE26 selectively targeted the mitochondria in A549 cells, triggering potent reactive oxygen species (ROS) generation post-irradiation. The Bax/Bcl-xL ratio and number of apoptotic cells were significantly elevated following treatment with 15 nM hE26-mediated PDT compared with both the untreated control and cells treated with an equivalent dose of E26. Cytochrome c release from mitochondria into the cytosol and expression of cleaved caspase-3 were observed at 24 h after hE26-mediated PDT.

Conclusion

The novel mitochondria-targeting photosensitizer hE26, with an optimized excitation wavelength of 660 nm, induces potent ROS generation even at low doses, resulting in enhanced anticancer efficacy against NSCLC cells via the mitochondrial apoptotic pathway. hE26 represents a promising candidate for the development of potent new photosensitizers that offer enhanced therapeutic efficacy with minimized systemic toxicity.

Keywords: Bax/Bcl-xL ratio, cytochrome c, intrinsic apoptotic pathway, mitochondria targeting, non-small cell lung cancer, photodynamic therapy, photosensitizer, reactive oxygen species

Introduction

Lung cancer is currently the most commonly diagnosed cancer and leading cause of cancer-related deaths worldwide, with poor prognosis in both men and women (1, 2). Among histological subtypes, non-small cell lung cancer (NSCLC) accounts for the majority of diagnosed cases and predominantly includes adenocarcinoma and squamous cell carcinoma (3). Photodynamic therapy (PDT) is a promising alternative therapeutic strategy for NSCLC and other tumors, and it has therefore been approved for clinical application (4, 5). In PDT, tumor cells that have taken up a photosensitizer (PS) die following irradiation with light at a specific wavelength (6). Clinically, PDT provides significant therapeutic benefits with minimal morbidity rates for early-stage or locally advanced NSCLC patients, serving as a well-established option for patients who are inoperable due to comorbidities (7). Moreover, the complete remission rate of PDT exceeds 80% in early-stage lung cancer with tumors less than 2 cm in size (8), whereas the 1-year survival rate among PDT-treated patients with locally advanced NSCLC and central airway obstruction is reportedly 70% (9). In addition, combining PDT with chemotherapy, radiotherapy, or surgery improves therapeutic outcomes in case of locally advanced NSCLC (10–12). However, limitations of PDT include photosensitivity due to the accumulation of PS in the skin, which may persist for several weeks, and an excessive drug–light interval, defined as the period between PS administration and light application (4, 13). Thus, further development of the PS is essential to enhance the safety and therapeutic efficiency of PDT for lung cancer in clinical practice.

The PS we previously synthesized, bis(3,6-dioxadodecyloxo)[5,10,15,20-tetraphenyporphyrinato]phosphorous(V) chloride (E26), demonstrates excellent water solubility and effectively induces cell death (14). However, the excitation wavelength of E26 is relatively short (610 nm), which limits applications in deep tissues. The effectiveness of PDT depends on the penetration depth of light into tissues; longer wavelengths exhibit greater tissue penetration, resulting in enhanced photoactivation of the PS. Light at a wavelength above 850 nm does not provide sufficient energy to activate the PS, whereas wavelengths in the range of 620–850 nm are considered optimal for PDT applications (6, 15, 16). To address this limitation, we have developed a simple hydrogenation process of bis(methoxo)[tetraphenyl–porphyrinato]phosphorous(V) chloride (E01) to the hydroporphyrins, resulting in the formation of a novel compound: hydrogenated phosphorus porphyrins such as bis(methoxo)[5,10,15,20-tetraphenylisobacteriochlorinato]phosphorous(V) chloride and bis(methoxo)[5,10,15,20-tetraphenylchlorinato]phosphorous(V) chloride (17). Applying this process to E26 provides a novel compound, hydrogenated E26 (hE26), which increases the excitation efficiency at 660 nm. However, further clinical applications require a more comprehensive understanding of the anticancer effects of hE26 against NSCLC.

Once PS accumulates in tumor tissue, irradiation with light of a specific wavelength generates highly reactive singlet oxygen, a type of reactive oxygen species (ROS), which induces photodamage in the photosensitized area (18). The outcome of PDT is highly dependent on the subcellular localization of the PS at the time of irradiation, which determines the type of cell death induced, such as apoptosis, autophagy, ferroptosis, or necrosis (11, 19, 20). Apoptosis is a particularly well-studied cell death pathway, and the localization of PS to the mitochondria has been shown to elevate mitochondrial ROS levels, thereby initiating the intrinsic apoptotic pathway and promoting cytochrome c release into the cytosol (21, 22). However, the mechanisms underlying hE26-induced cell death remain largely unknown.

In this study, we evaluated the anticancer effects of PDT using the novel PS hE26 in comparison with the previously reported PS E26 using an MTT assay, wound healing assay, qPCR, and immunohistochemical analyses with human NSCLC cell lines. Low-dose hE26-mediated PDT under a shorter drug–light interval exhibited enhanced therapeutic efficacy, as evidenced by reduced cancer cell viability. Furthermore, the subcellular localization of hE26 and its roles in inducing ROS generation, mitochondrial dysfunction, and cytochrome c release into the cytosol were demonstrated. Here, we report that hE26 induces the intrinsic apoptotic pathway in human NSCLC cells, thus enhancing anticancer efficacy and highlighting the therapeutic potential of low-dose PDT for lung cancer.

Materials and methods

Cell culture

The human lung adenocarcinoma cells (A549), human lung squamous cell carcinoma cells (EBC-1), and human epithelial-like malignant pleural mesothelioma cells (ACC-MESO-4) were purchased from the RIKEN Cell Bank (Ibaraki, Japan). A549 cells and EBC-1 cells were maintained in Dulbecco’s Modified Eagle’s Medium with l-glutamine and phenol red (Fujifilm Wako Pure Chemical Corp., Osaka, Japan), and ACC-MESO-4 cells were maintained in Roswell Park Memorial Institute 1640 medium (Sigma–Aldrich, St. Louis, MO, USA) in a humidified atmosphere containing 5% CO₂ at 37 °C. The medium was supplemented with 10% (v/v) heat-inactivated fetal bovine serum (Sigma–Aldrich) and penicillin-streptomycin-amphotericin B (Fujifilm Wako).

Hydrogenation of E26

Amphiphilic E26 was hydrogenated using sodium phosphinate (NaPH₂O₂) as a hydrogen source in the presence of Pd/C catalyst (Supplementary Material). A mixed solvent of tetrahydrofuran and ethyl acetate was used for the hydrogenation of E26. The hydrogenated E26 was identified using UV-vis spectroscopy and mass spectrometry. The absorption spectrum of hydrogenated E26 was measured in methanol.

The ability of hE26 and E26 to generate singlet oxygen (¹O₂) was evaluated under 660-nm irradiation in the presence of 9,10-dimethylanthracene (DMA), respectively (Supplementary Material). Chemical structures, absorption spectra, and mass spectra were generated using ChemDraw (ver. 25.5; PerkinElmer, Waltham, MA, USA), Sma4win (ver. 1.58; T. Suzuki, Japan), and mMass (ver. 5.5.0; Martin Strohalm, Czech Republic), respectively.

PDT experiment

PDT experiments were conducted using a light source device at a wavelength of 610 nm or 660 nm,as reported previously (14, 23). Briefly, aqueous stock solutions of E26 (100 µM) and hE26 (25 µM) were prepared by dissolving the PS in 10% dimethyl sulfoxide (DMSO) (Fujifilm Wako) in double-distilled water, and the stock was stored at 4 °C until use. Culture medium supplemented with PS was prepared from the stock solution before use. Seeded cells were treated with either E26 (25, 50, 100, 200, or 400 nM) or hE26 (5, 10, 15, 20, or 25 nM) at 37 °C for 2 h, whereas untreated cells served as a control. The cells were washed once with phosphate-buffered saline (PBS), and then the PBS was replaced with culture medium. Cells were irradiated from the bottom of the plate using a light-emitting diode (LED) light source at 37 °C for 30 min, with the irradiation distance maintained at 20 mm in both experiments (λ = 610 nm or λ = 660 nm). The LED light source was fabricated using 100 plug-in LED arrays (λ = 610 nm, half width = 15 nm, light intensity = 4.09 mW cm⁻², L610-04; or λ = 660 nm, half width = 15 nm, light intensity = 8.96 mW cm⁻², L660N-04; Ushi Opto Semiconductors, Kyoto, Japan) mounted on an LED substrate (SPL-100-LC, Revox, Kanagawa, Japan). A heat-absorbing filter filled with water (100 mm in diameter and 20 mm in thickness) was placed between the well plate and the LED light source to minimize heat emitted from the LED (Supplementary Figure 1).

Cell viability assay

Cell viability was examined using the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay. Briefly, A549, EBC-1, and ACC-MESO-4 cells were seeded in 96-well plates at a density of 1 × 10⁴ cells/well and incubated overnight at 37 °C. After PDT using E26 or hE26 at concentrations of 5, 10, 25, 50, 100, 200 or 400 nM, the cells were incubated at 37 °C for 24 h. MTT solution (5 mg/ml) (Nacalai Tesque, Kyoto, Japan) was then added, and the cells were incubated at 37 °C for 2 h. After removal of the MTT reagent, DMSO was added to dissolve the formazan crystals. The resulting intracellular purple formazan was quantified spectrophotometrically at an absorbance of 562 nm using a SpectraMax iD3 Multi-Mode Microplate Reader (Molecular Devices, San Jose, CA, USA).

Immunohistochemistry

Immunohistochemistry was performed as reported previously (24, 25). Cells were seeded on coverslips in 24-well plates at a density of 5 × 10⁴ cells/well and incubated at 37 °C overnight. After PDT using 15 nM PS for 24 h, the cells were washed with PBS, fixed with 4% paraformaldehyde (PFA) (Merck, Darmstadt, Germany) in PBS for 15 min, and permeabilized with 0.2% Triton X-100 in PBS at room temperature (RT) for 10 min. Cellular endogenous peroxidase activity was blocked by addition of 0.3% H₂O₂ (Fujifilm Wako) in methanol and incubation for 30 min, and nonspecific binding sites were blocked by incubation for 30 min with 500 μg/ml normal goat IgG (I9140, Sigma–Aldrich) in 1% bovine serum albumin (Sigma–Aldrich) in PBS. The cells were then reacted with the following primary antibodies for 2 h: anti–Ki-67 (ab16667, Abcam), anti–cleaved caspase-3 (cat: 9664S, Cell Signaling Technology), or anti–cytochrome c (sc-13156, Santa Cruz Biotechnology). After washing with 0.075% Brij L23 (Sigma–Aldrich) in PBS, the cells were reacted with horseradish peroxidase–conjugated goat anti-rabbit secondary antibody for 1 h and washed with 0.075% Brij L23 in PBS. Ki-67 was detected using 3-amino-9-ethylcarbazole, and nuclei were counterstained with Mayer’s hematoxylin (Fujifilm Wako). For immunofluorescence analysis, cells were reacted with the following secondary antibodies for 1 h: Alexa Fluor 488–conjugated anti-mouse IgG (ab150117, Abcam) or Alexa Fluor 488–conjugated anti-rabbit IgG (A11008, Thermo Fisher Scientific, Waltham, MA, USA) and then counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) (26). As a negative control, normal rabbit or mouse IgG (Dako) was used at the same concentration as the primary antibody in each experiment (27). Photomicrographs were taken using a light microscope (Olympus BX53) and a FLUOVIEW FV4000 confocal laser-scanning microscope (Evident Corp., Tokyo, Japan). For quantitative analysis of Ki-67 expression, positive cells were counted in five random fields per coverslip, and results are expressed as the percentage of positive cells among the total number of counted cells. Fluorescence intensity of cleaved caspase-3 was measured using ImageJ software (US National Institutes of Health [NIH], Bethesda, MD, USA).

Wound healing assay

For monolayer culture, A549, EBC-1, and ACC-MESO-4 cells (2 × 10⁵ cells/well) were seeded into 24-well plates and incubated at 37 °C until reaching approximately 90% confluency. To introduce a wound, the cell layer was scratched with the tip of a 20-µl micropipette tip, and then PDT was performed at a dose of 15 nM. Images of the wound in each well (n = 3 per group) were captured using 4× objective lenses at pretreatment and 24 h posttreatment. The wound closure rate was quantified by measuring the wound area using ImageJ software (NIH).

Localization of hE26

To examine intracellular uptake of hE26, A549, EBC-1, and ACC-MESO-4 cells were seeded onto coverslips in 24-well plates at a density of 1 × 10⁵ cells/well and incubated overnight at 37 °C. The cells were subsequently incubated with 15, 25, 50, or 100 nM hE26 for 2 h and then washed with PBS (pH 7.4, 0.01 M) and fixed with 4% PFA (Merck) in PBS for 15 min at RT.

To determine the subcellular localization of hE26, A549 cells (2 × 10⁵ cells) were seeded in a 3.5-cm glass-bottom dish and incubated overnight at 37 °C. After incubation with 50 nM hE26 for 2 h, the cells were washed with PBS and incubated with either 200 nM MitoTracker Green or MitoTracker Red (Thermo Fisher Scientific) for 30 min at 37 °C or 75 nM LysoTracker Green (Thermo Fisher Scientific) for 45 min at 37 °C. The cells were then washed with PBS, and nuclei were counterstained with DAPI. Images were acquired using a FLUOVIEW FV4000 confocal laser-scanning microscope (Evident Corp.).

Mitochondrial membrane potential assay

Mitochondrial membrane potential (ΔΨm) was monitored using a JC-1 MitoMP Detection kit (Dojindo, Kumamoto, Japan), according to the manufacturer’s instructions. A549 cells were seeded in a 3.5-cm glass-bottom dish at a density of 2 × 10⁵ cells and incubated overnight at 37 °C, followed by PDT with 15 nM PS. After 3 h of PDT, 5,5’,6,6’-tetrachloro-1,1’,3,3’-tetramethylbenzimidazolylcarbocyanine iodide (JC-1) was added to the culture medium to achieve a final concentration of 4 μM, and the cells were incubated at 37 °C for 30 min. The cells were washed twice with Hank’s Balanced Salt Solution (HBSS) without calcium and magnesium (Thermo Fisher Scientific) and subsequently live-imaged using a FLUOVIEW FV4000 confocal laser-scanning microscope (Evident Corp.) with excitation at 490 nm (green channel) and 560 nm (red channel). Fluorescence intensity was measured using ImageJ software (NIH), and the aggregate/monomer ratio was calculated to determine the mitochondrial membrane potential.

Measurement of ROS

Intracellular ROS were measured using a highly sensitive DCFH-DA ROS assay kit (Dojindo), following the manufacturer’s instructions. Briefly, A549 cells were seeded at 2 × 10⁴ cells per well in a 9.5-mm glass-bottom dish and incubated overnight at 37 °C, followed by PDT using 15 nM PS. At 30 min post-PDT, the cells were washed twice with HBSS and then treated with highly sensitive DCFH-DA dye working solution for 30 min. Fluorescence signals (excitation at 488 nm) were observed using a FLUOVIEW FV4000 confocal laser-scanning microscope (Evident Corp.). Quantification was performed using ImageJ software (NIH).

Malondialdehyde assay

The concentration of MDA was determined using an MDA assay kit (Dojindo) according to the manufacturer’s instructions. Briefly, 2 × 10⁶ cells were seeded in a 10-cm dish and incubated overnight at 37 °C, followed by PDT using 15 nM PS. At 24 h after irradiation, 1 × 10⁶ cells were harvested in PBS. Finally, 100 µl of supernatant containing the working solution was transferred to each well of a 96-well plate, and the fluorometric assay was performed using a SpectraMax iD3 Multi-Mode Microplate Reader (Molecular Devices) at excitation/emission wavelengths of 540/590 nm.

Assessment of apoptotic cell death

Apoptotic cells were detected using an Annexin V–FITC apoptosis detection kit (Nacalai Tesque), according to the manufacturer’s instructions. A549 cells were seeded in a 9.5-mm glass-bottom dish at a density of 2 × 10⁴ cells and incubated overnight at 37 °C, followed by PDT with 15 nM PS. At 24 h post-PDT, the cells were labeled with 5 µl of Annexin V–FITC and 5 µl of propidium iodide (PI) at RT for 15 min in the dark. Nuclei were counterstained with Hoechst 33342 (Dojindo). Stained cells were then imaged using an FV4000 confocal laser-scanning microscope (Evident Corp.) to detect apoptotic and necrotic cell populations. For quantitative analysis of apoptosis, cells were counted in five random fields per dish using ImageJ software (NIH). Results are expressed as the percentage of Annexin V–FITC–positive cells (early apoptosis) and Annexin V–FITC/PI–double-positive cells (late apoptosis) relative to the total number of cells counted.

qPCR analysis

Total RNA was extracted from PDT-treated cells after 24 h using Isogen II (Nippon Gene, Tokyo, Japan), as reported previously (28). RNA was reverse transcribed to cDNA using Moloney murine leukemia virus reverse transcriptase (Invitrogen). Transcript expression levels were determined using an ABI StepOne plus Real-Time PCR system (Applied Biosystems, Waltham, MA, USA) with Fast SYBR Green (Applied Biosystems). β-Actin was used for normalization, and relative gene expression in PDT-treated cells was calculated using the 2^−ΔΔct method. The sequences of primers used were as follows: β-Actin forward (5′–TCCTCCCTGGAGAAGAGCTAC–3′) and reverse (3′–TCCTGCTTGCTGATCCACAT–5′); Bax forward (5′–GGACGAACTGGACAGTAACATGGAGCTC–3′) and reverse (3′–CCCAACCACCCTGGTCTTGGATCCAG–5′); BCL2L1 forward (5′–CTTGCAAGTTCCCCTGTCTCTTCA–3′) and reverse (3′– CTGACTCCAGCTGTATCCTTTCTG –5′).

Statistical analysis

All data are expressed as the mean ± standard deviation (SD) of at least 3 independent experiments. Statistical significance was assessed by comparing the means of two groups using Student’s t-test. One-way analysis of variance (ANOVA) with Tukey’s post-hoc test was used to compare means between more than two groups. P < 0.05 was considered indicative of statistical significance. All analyses were performed using the Statistical Package for Social Sciences (version 20; IBM Corp., Armonk, NY, USA).

Results

Preparation and singlet oxygen generation ability of hE26

E26 was hydrogenated using a slightly modified procedure previously developed for E01 (17). Two greenish-colored products were obtained: a pure P-isobacteriochlorin complex (E26-iBc) and a crude P-chlorin complex (E26-Ch) containing a small amount of E26. The Q band of E26-iBc and crude E26-Ch was shifted to a longer wavelength compared with E26 (560 nm), appearing at 644 and 656 nm, respectively (Supplementary Figures 2, 3 in Supplementary Material). We used E26-iBc to prepare a stock solution (water to DMSO ratio = 9:1) for subsequent PDT experiments. Spectroscopic analysis of the stock solution revealed that E26-iBc was dehydrogenated into E26-Ch and E26 during solubilization of E26-iBc in the first DMSO (Supplementary Figure 4 in Supplementary Material). Impurities in the DMSO may have abstracted hydrogen atoms to generate E26-Ch and E26. Curve fitting analysis of the Q-band region (500–750 nm) determined the molar ratio of the P-complexes as E26-iBc to E26-Ch to E26 = 0.42:0.43:0.15, defining the stock solution as hydrogenated E26 (hE26) with the absorption maximum at 647 nm (Supplementary Figure 4 in Supplementary Material).

The relative quantum yield (Φ_Δ) of ¹O₂ production of hE26 and E26 was estimated based on the decrease in DMA fluorescence: 0.68 for hE26 and 0.58 for E26. Therefore, hE26 generates ¹O₂ efficiently under the red-light irradiation (660 nm).

Potent reduction in the viability of NSCLC cells following low-dose hE26-mediated PDT

The molecular structures of the novel PS hE26 and the known PS E26 used to assess the cytotoxic effects of PDT against human cancer cells are shown in Figures 1A–C. Dose-response effects on cell viability were evaluated using the MTT assay. The viability of A549 and EBC-1 cells decreased in a dose-dependent manner at higher PS doses (25–400 nM), whereas ACC-MESO-4 cells were less sensitive after 24 h of E26-mediated PDT (Figure 1D). The half-maximal inhibitory concentration (IC₅₀) values were 842.2, 363.4, and 895.5 nM, respectively. Interestingly, after 24 h of PDT using hE26 at low doses (5–25 nM), the viability of A549, EBC-1, and ACC-MESO-4 cells was significantly reduced in a dose-dependent manner compared with untreated cells as a control. Moreover, a significant difference in cell type–dependent sensitivity was observed at 10–25 nM, with NSCLC cells being the most sensitive, followed by ACC-MESO-4 cells (Figure 1E). The IC₅₀ values of hE26 were 14.1, 17.6, and 52.7 nM against EBC-1, A549, and ACC-MESO-4 cells, respectively, representing a 26-, 48-, and 17-fold reduction in IC₅₀ compared with E26-mediated PDT. Additionally, we assessed the cytotoxicity of E26 and hE26 in the dark, with neither PS having an effect on cell viability compared with the controls (Supplementary Figure 5). Based on these results, a PS dose of 15 nM was selected for subsequent experiments examining the effects of hE26-mediated PDT.

Chemical structures labeled A, B, and C each show a porphyrin core with various substituents and highlighted bonds, representing different chemical variants. Below, bar graphs D and E display cell viability percentages for three cell lines (EBC-1 in blue, A549 in red, ACC-MESO-4 in yellow) exposed to increasing concentrations of compounds E26 and hE26. Data show a dose-dependent decrease in cell viability for all cell lines, with statistical significance indicated by asterisks and symbols above the bars. — Comparative analysis of the viability of human cancer cells treated using E26- or hE26-mediated PDT. **(A)** Molecular structure of E26. **(B, C)** Molecular structures of the hE26 stock solution components: **(B)** E26-iBc and **(C)** E26-Ch. Red lines indicates sites of hydrogenation. **(D)** Viability of cancer cells treated with E26-mediated PDT at high doses (25–400 nM) or **(E)** with hE26-mediated PDT at low doses (5–25 nM), as analyzed using the MTT assay at 24 h post-treatment. Data represent the mean ± SD of at least 3 independent experiments. Asterisks indicate statistically significant differences compared with untreated controls, as determined using Student’s t-test (*p < 0.05, **p < 0.01, and ***p < 0.001). Daggers indicate statistically significant differences between cell types as assessed using one-way ANOVA (^†p < 0.05, ^††p < 0.01, and ^†††p < 0.001).

Low-dose hE26-mediated PDT exhibits enhanced anticancer efficacy against NSCLC cells

Assessing cancer cell proliferation and migration is essential for evaluating the overall efficacy of novel anticancer therapies. We therefore investigated the antiproliferative effects of hE26-mediated PDT using immunohistochemistry analysis of the well-known proliferation marker Ki-67 in all three cell lines. Notably, morphological changes were observed in cells treated with 15 nM hE26, including a reduction in total cell number and transition to a rounded morphology, particularly in EBC-1 cells after 24 h. Moreover, the Ki-67 staining intensity was reduced, and number of positive cancer cells decreased following hE26 treatment, indicating that the rate of proliferation was suppressed (Figure 2A). Quantitative analyses revealed that Ki-67 expression was significantly lower at 24 h in NSCLC cells treated with hE26-mediated PDT compared with both the control and an equivalent dose of E26. This inhibitory effect was most pronounced in A549 cells, followed by EBC-1 and ACC-MESO-4 cells (Figure 2C). Wound healing assays were performed to evaluate the migration of human cancer cells. As shown in Figure 2B, a market delay in migratory capacity was observed in A549, ACC-MESO-4, and EBC-1 cells treated with hE26-mediated PDT. The percentage of the wound closed was significantly lower among hE26-treated cells of all three types compared with controls and E26-treated cells at 24 h post-treatment (Figure 2D). These findings suggest that low-dose hE26 is highly effective against NSCLC cells and demonstrates an enhanced anti-cancer effect compared with E26.

Panel A contains microscopic images showing Ki-67 staining in EBC-1, A549, and ACC-MESO-4 cell lines under control, E26, and hE26 treatments, highlighting decreased nuclear staining with treatments. Panel B shows scratch wound assays for the same cell lines across pre-treatment, control, E26, and hE26 conditions, with yellow dashed lines marking wound borders, indicating reduced cell migration after treatments. Panel C is a bar graph quantifying Ki-67 labeling index percentage, showing significant reductions in treated groups versus control. Panel D is a bar graph of wound closure percentage after 24 hours, demonstrating reduced closure with E26 and hE26 treatments. — Effects of E26- and hE26-mediated PDT on cell proliferation and migration. **(A)** Immunohistochemistry analysis of Ki-67 (red) following PDT with 15 nM E26 or hE26 in EBC-1, A549, and ACC-MESO-4 cells after 24 h. Scale bar = 20 µm; 40× objective lenses were used. **(B)** Representative images of wound healing assay of EBC-1, A549, and ACC-MESO-4 cells treated with 15 nM E26- or hE26-mediated PDT after 24 h. Scale bar = 200 µm. Quantitative assessment of **(C)** Ki-67–positive cells and **(D)** wound closure rates across the different treatment groups. Data represent the mean ± SD of at least 3 independent experiments. Daggers indicate statistically significant differences between groups as determined using one-way ANOVA (^†p < 0.05, ^††p < 0.01, and ^†††p < 0.001).

Subcellular localization of hE26 to the mitochondria

To further investigate the mechanism underlying hE26-mediated PDT-induced cell death, we examined the subcellular distribution of the PS. Uptake of hE26 by EBC-1, A549, and ACC-MESO-4 cells was analyzed across a range of concentrations (15–100 nM) following a 2-h incubation period. hE26 accumulated intracellularly in a dose-dependent manner in all three cell lines (Figure 3A). Based on these findings, subcellular localization was analyzed using 50 nM hE26 and A549 cells because the 15 nM dose exhibited insufficient fluorescence intensity. In A549 cells, hE26 fluorescence strongly colocalized with MitoTracker, whereas no significant overlap was observed with LysoTracker. These results indicate that hE26 selectively accumulates in mitochondria rather than lysosomes (Figure 3B).

Panel A displays immunofluorescence images showing blue DAPI-stained nuclei and red hE26 signal in EBC-1, A549, and ACC-MESO-4 cells treated with increasing concentrations of a compound from 15 to 100 nanomolar. Panel B contains two sets of four images each showing cultured cells labeled with green MitoTracker or LysoTracker dyes, red hE26, blue DAPI, and their merged overlays to illustrate subcellular localization and colocalization patterns. — Analysis of hE26 intracellular uptake and subcellular localization in NSCLC cells. **(A)** Intracellular uptake of hE26 was evaluated across the dose range 15–100 nM using confocal laser-scanning microscopy. Representative images illustrate the dose-dependent accumulation of hE26 (red) in EBC-1, A549, and ACC-MESO-4 cells following a 2-h incubation. Nuclei were counterstained with DAPI (blue). Scale bar = 20 µm; 40× objective lenses were used. **(B)** Subcellular localization of hE26 (50 nM, red) in A549 cells. Mitochondria, lysosomes, and nuclei were stained with MitoTracker (green staining in upper panel), LysoTracker (green staining in lower panel), and DAPI (blue), respectively. Scale bar = 10 µm; 60× objective lenses were used. Images are representative of 3 independent experiments.

Induction of ROS-dependent mitochondrial dysfunction in A549 cells following low-dose hE26-mediated PDT

Given that hE26 selectively localizes to mitochondria, we subsequently investigated the relationship between ROS generation and mitochondrial function in A549 cells. Mitochondrial membrane potential (ΔΨm) was determined via JC-1 staining in A549 cells at 3 h after treatment with each PS at 15 nM. In the control group, red (aggregate) fluorescence was predominantly observed, indicating that ΔΨm was maintained. By contrast, a marked shift from red to green (monomeric) fluorescence was exhibited after hE26-mediated PDT, which signified a loss of ΔΨm and subsequent mitochondrial depolarization (Figure 4A). Moreover, the results of quantitative analyses demonstrated a significant decrease in the aggregate/monomer ratio in hE26-treated cells compared with both control and E26-treated cells (Figure 4B). Furthermore, due to the unstable nature of ROS, intracellular total levels were measured 30 min post-PDT using the DCFH-DA assay. Strong ROS-associated green fluorescence was observed in A549 cells treated with hE26-mediated PDT, whereas baseline signals were observed in both control cells and cells treated with an equivalent dose of E26 (Figure 4C). Quantitative analyses revealed that hE26-mediated induction of ROS generation was 28-fold higher than untreated control cells, a significant difference (Figure 4D). To confirm the induction of oxidative damage, we analyzed the levels of MDA, a stable end-product of lipid peroxidation, in all three cell lines at 24 h after PDT. As expected, MDA levels were significantly elevated following hE26-mediated PDT in all three cell lines, confirming extensive lipid peroxidation (Figure 4E).

Fluorescence microscopy panels (A, C) show cellular aggregates, monomers, merged channels, and DCFH-DA staining under Control, E26, and hE26 treatments. Corresponding bar graphs (B, D) quantify aggregate-to-monomer ratios and mean fluorescence intensity, both significantly altered between treatments. Panel E presents comparative bar graphs of MDA levels in three cell lines (EBC-1, A549, ACC-MESO-4) post-treatment, indicating statistical differences among groups. — hE26-mediated PDT triggers ROS-dependent mitochondrial dysfunction in A549 cells. **(A)** Mitochondrial membrane potential (ΔΨm) was analyzed using JC-1 staining of A549 cells at 3 h post-treatment with 15 nM of E26 or hE26. Aggregate (red staining in upper panel) and monomer (green staining in middle panel) indicate polarized and depolarized mitochondria, respectively. The lower panels (merged) illustrate the overall state of mitochondrial function. Scale bar = 20 µm; 40× objective lenses were used. **(B)** Quantitative analysis of aggregate/monomer ratio in A549 cells following the indicated treatments. **(C)** Intracellular total ROS levels were measured using the DCFH-DA assay in A549 cells 30 min post-treatment with 15 nM E26 or hE26. Scale bar = 50 µm; 20× objective lenses were used. **(D)** Quantification of intracellular total ROS levels in A549 cells, expressed as mean fluorescence intensity, following the indicated treatments. **(E)** Analysis of MDA levels in EBC-1, A549, and ACC-MESO-4 cells 24 h post-treatment with 15 nM E26 or hE26. Data represent the mean ± SD of at least 3 independent experiments. Daggers indicate statistically significant differences between groups as determined using one-way ANOVA (^†p < 0.05, ^††p < 0.01, and ^†††p < 0.001).

Low-dose hE26-mediated PDT triggers the mitochondrial apoptotic pathway in A549 cells

We then examined the types of cell death including apoptosis and necrosis in A549 cells treated with 15 nM of each PS after 24 h using Annexin V and PI staining. Notably, a higher number of apoptotic cells was observed in the hE26-treated group compared with both the untreated control and E26-treated group. Specifically, the majority of apoptotic cells exhibited double staining for Annexin V and PI, indicating late apoptosis, whereas necrotic cells were not observed in any of the groups (Figure 5A). The percentage of apoptotic cells at 24 h was significantly higher among A549 cells treated with hE26 compared with control and E26 treatment (Figure 5B). To confirm this finding, we performed immunofluorescence analysis of A549 cells treated with 15 nM hE26-mediated PDT over a 6–24 h period, targeting cleaved caspase-3, a well-established marker for identifying the executioner phase of apoptosis. As expected, a time-dependent increase in the expression of cleaved caspase-3 was observed following hE26-mediated PDT, initiating at 12 h and gradually increasing until 24 h, whereas no expression was observed in untreated control cells (Figure 5C). Moreover, quantitative analyses demonstrated a significant increase in cleaved caspase-3 fluorescence intensity in A549 cells at 12 h post-PDT with 15 nM hE26 compared with untreated control cells, with apoptosis peaking at 24 h (Figure 5D).

Panel A shows three fluorescence microscopy images comparing control, E26, and hE26 groups stained for Annexin V (green), PI (red), and Hoechst (blue) to assess apoptosis. Panel B is a bar graph displaying the percentage of apoptotic cells, with higher values in E26 and hE26 groups. Panel C shows four fluorescence images at control, 6, 12, and 24 hours post-irradiation, stained for cleaved caspase-3 (green) and DAPI (blue) to highlight apoptosis progression. Panel D presents a bar graph of mean fluorescence intensity, indicating increased intensity over time post-irradiation. Panels E, F, and G show bar graphs for mRNA levels and ratios of Bax and BCL2L1 genes, with increased Bax/BCL2L1 ratio in hE26. Panel H contains twelve fluorescence images, grouped in four columns (Cytochrome C, MitoTracker, DAPI, and Merged) and three rows (Control, E26, hE26), showing mitochondrial structure and localization changes with treatments. — hE26-mediated PDT induces the mitochondrial apoptotic pathway in A549 cells. **(A)** Assessment of cell death in A549 cells 24 h post-treatment with 15 nM E26 or hE26. Apoptosis and necrosis were evaluated using Annexin V (green) and PI (red), whereas nuclei were counterstained with Hoechst 33342 (blue). Scale bar = 20 µm; 40× objective lenses were used. **(B)** Total apoptosis was determined by the sum of Annexin V–FITC–positive (early apoptotic) and Annexin V-FITC/PI–double-positive (late apoptotic) cells. **(C)** Immunofluorescence analysis of cleaved caspase-3 (green) and DAPI (blue) in A549 cells treated with 15 nM hE26-mediated PDT over 6–24 (h) Scale bar = 10 µm; 60× objective lenses were used. **(D)** Quantification of cleaved caspase-3 in A549 cells, expressed as mean fluorescence intensity, following the indicated treatments. **(E)** *Bax* and **(F)** *BCL2L1* (Bcl-xL) mRNA expression levels were determined using qPCR and normalized to *β-Actin* in A549 cells 24 h post-treatment with 15 nM E26 or hE26. **(G)** Ratio of *Bax/BCL2L1* mRNA expression following the indicated treatments, representing the pro-apoptotic shift in A549 cells. **(H)** Double immunofluorescence analysis of cytochrome c (green) and MitoTracker (red) in A549 cells 24 h following the indicated treatments. Nuclei were counterstained with DAPI (blue). Yellow signals in the merged images indicate co-localization, whereas diffuse green signals signify cytochrome c translocation to the cytosol. Scale bar = 10 µm; 60× objective lenses were used. Data represent the mean ± SD of at least 3 independent experiments. Asterisks indicate statistically significant differences compared with untreated controls, as determined using Student’s t-test (*p < 0.05, **p < 0.01, and ***p < 0.001). Daggers indicate statistically significant differences between groups as determined using one-way ANOVA (^†p < 0.05, ^††p < 0.01, and ^†††p < 0.001).

Based on these results, the underlying mechanism of mitochondria-regulated programmed cell death was examined at 24 h post-PDT, as the maximal apoptotic response was observed at this time point. qPCR was used to analyze the expression of several mitochondrial apoptosis-related markers, including pro-apoptotic Bax and anti-apoptotic Bcl-xL (encoded by BCL2L1 gene) in A549 cells treated with each PS at 15 nM. Bax expression was significantly upregulated following hE26 treatment compared with both the untreated control and E26 treatment (Figure 5E). By contrast, BCL2L1 expression was downregulated in hE26-treated cells, differing significantly compared with E26-treated cells (Figure 5F). Interestingly, hE26-mediated PDT resulted in a significantly elevated Bax/BCL2L1 ratio, further confirming activation of the mitochondrial apoptotic pathway (Figure 5G). Furthermore, release of cytochrome c from mitochondria to the cytosol of A549 cells was observed at 24 h after low-dose PDT via double immunofluorescence staining together with MitoTracker analysis. In control cells, cytochrome c showed strong co-localization with MitoTracker, but partial co-localization was observed in E26-treated A549 cells. Conversely, the majority of hE26-mediated PDT–treated A549 cells exhibited diffuse cytosolic staining with an absence of co-localization, indicating translocation of cytochrome c from mitochondria to the cytosol (Figure 5H). Taken together, these results demonstrate that low-dose PDT with the novel PS hE26 triggers an imbalance in the expression of mitochondrial apoptosis regulators via potent ROS generation, leading to cytochrome c release, thereby significantly enhancing the anticancer efficacy of the treatment in NSCLC cells.

Discussion

The primary finding of this study is that the novel compound hE26, chemically modified to shift the excitation wavelength to 660 nm, significantly enhances the anticancer efficacy of PDT against A549 and EBC-1 NSCLC cells. Our study provides the following key findings (1): hE26 exhibited high efficacy against NSCLC cells at a low concentration (15 nM) with a short drug-light interval, suggesting it may reduce patient wait times and decrease systemic photosensitivity; (2) hE26 localized to the mitochondria and induced mitochondrial dysfunction; and (3) ROS-induced increase in the Bax/Bcl-xL ratio triggered mitochondria-dependent apoptosis.

Recent research has highlighted PDT as a promising anticancer modality, demonstrating significant efficacy across a variety of human cancers in both in vitro and in vivo models (29–32). Similarly, we previously reported that PDT using 50 nM E26 with a 24-h incubation (drug–light interval) induces apoptosis via the mitochondrial pathway in NOZ cells (14). However, the results of the present study revealed that PDT using the novel compound hE26 (15 nM, 2 h incubation) with a red-light spectrum demonstrating significantly enhanced therapeutic efficiency and improved outcomes against NSCLC cells compared with E26-mediated PDT under the same experimental conditions. Furthermore, the therapeutic success of PDT is highly dependent on sufficient ¹O₂ production to drive potent ROS generation; thus, a higher concentration of ¹O₂ directly enhances PS efficacy (33). Consistent with this principle, our results revealed that hE26 generated significantly higher levels of ¹O₂ and ROS compared to parent compound E26, alongside a concurrent increase in MDA levels, a stable end-product of lipid peroxidation. In addition, Pu and Xue et al. demonstrated that both low- and high-dose intrathoracic red-light PDT effectively inhibited tumor growth in a murine model (34). The differences between their results and ours may be attributed to several factors such as the specific light wavelength, the drug-light interval, and molecular structure–dependent ¹O₂ generation. Indeed, the excitation wavelength of hE26 falls within the optimal range for PDT applications (typically 620–850 nm), which provides sufficient energy for PS activation.

The subcellular localization of the PS is a critical determinant of cell fate, as the limited diffusion distance of ¹O₂ (approximately 50 nm) restricts oxidative damage to only the most proximal organelles (33). Specially, the accumulation of PS within organelles such as mitochondria, lysosomes, endoplasmic reticulum, nucleus, cell membrane, and cytosol has been associated with the induction of distinct cell death pathways (35, 36). Oliveira et al. reported that subcellular localization is more critical than photochemical reactivity in determining overall photocytotoxicity, with mitochondrial targeting representing a highly desirable property for the development of potent and targeted PSs for PDT (37). However, PDT utilizing supralethal doses of the drug or light exposure typically leads to the induction of necrosis (19). In addition, targeting mitochondria in PDT is a potent approach for cancer treatment, as it leads to ROS-induced mitochondrial dysfunction. Given their role as essential organelles for energy metabolism and the regulation of apoptosis, mitochondria are critical targets for inducing cell death (38–40). Consistent with the above observations, our results demonstrated that in low-dose PDT, novel hE26 selectively localizes to mitochondria rather than lysosomes, resulting in mitochondrial dysfunction induced by ROS.

Apoptosis is widely recognized as a predominant mechanism of cell death in response to PDT (41, 42), with the central role of the mitochondria in this process being well established (43). Similarly, our results revealed that hE26-mediated PDT induces apoptosis in A549 cells, as evidenced by a significant increase in the apoptotic cell population without necrosis, and a dose-dependent decrease in cell viability after PDT. Moreover, Bcl-2 family proteins are critical regulators of mitochondrial apoptosis, and an imbalance in the expression of anti-apoptotic Bcl-xL or Bcl-2 and pro-apoptotic Bax leads to apoptosis (44–46). Perlman et al. revealed that the mRNA levels of Bcl-2 family members correspond to protein levels and that the Bax/Bcl-2 ratio determines the apoptotic potential of a cell (47). Numerous studies have reported that elevation of the Bax/Bcl-xL or Bax/Bcl-2 ratio is a critical indicator of apoptosis resulting in the activation of programmed cell death in a variety of cancers (48–50). By contrast, an increase in the Bcl-xL/Bax or Bcl-2/Bax ratio attenuates the apoptotic response (51, 52) with the reported ranges of the Bcl-xL/Bax and Bcl-2/Bax ratios in stage III lung squamous cell carcinoma being 1.3–4.0 and 1.5–4.5, respectively (53). Therefore, pro-apoptotic Bax activation facilitates cytochrome c release from mitochondria into the cytoplasm, subsequently triggering caspase-3 cleavage, which serves as the primary executioner of apoptosis (54). Consistent with this mechanism, the results of the present study demonstrated that hE26-mediated PDT significantly increases the Bax/Bcl-xL ratio and promotes cytochrome c release into the cytosol. These events correspond with increased expression of cleaved caspase-3, confirming activation of the mitochondrial apoptotic pathway.

In regard to clinical application of PDT, McCaughan et al. established that 630-nm excitation wavelength PDT was suitable for successful treatment of NSCLC patients over a 14-year follow-up period, with no difference observed between adenocarcinoma and squamous cell carcinoma (55). Furthermore, Schlesinger et al. demonstrated that red-light PDT achieved highly effective clearance with no adverse effects and positive aesthetic outcomes in a clinical trial of 187 patients with basal cell carcinoma (56). Despite these findings, clinical evidence confirms that PDT using talaporfin sodium (664 nm) provides a superior local complete response and significantly longer overall survival in esophageal cancer compared with conventional porfimer sodium–mediated PDT (630 nm) (57). In Japan, talaporfin-mediated PDT has been approved for the treatment of early-stage lung cancer (58, 59), and its application in central-type early-stage lung cancer via a 1-day treatment protocol was shown to be safe within 2 weeks of administration (60). Indeed, tumor depth and stage are essential predictors of local response and survival duration in PDT (13). Therefore, our findings may contribute to the development of highly efficient PSs for PDT that offer enhanced therapeutic efficacy with minimal side effects.

In conclusion, the results of the present study demonstrate that the mitochondria-targeting hE26, a novel PS with an optimized excitation wavelength of 660 nm, induces potent ROS generation even at low doses, resulting in enhanced anticancer efficacy against NSCLC cells via the mitochondrial apoptotic pathway. By specifically targeting mitochondria, hE26 triggers an increase in the Bax/Bcl-xL ratio, which subsequently activates the cytochrome c/cleaved caspase-3 signaling cascade.

Acknowledgments

We gratefully acknowledge the Frontier Science Research Center at the University of Miyazaki for allowing us to use their facilities.

Funding Statement

The author(s) declared that financial support was received for this work and/or its publication. This study was supported in part by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (25K10146 to Y.H., 24K11937 to K.K., 24K08641 to T.I.).

Footnotes

Edited by: Greta Varchi, Consiglio Nazionale delle Ricerche (Bologna), Italy

Reviewed by: Gustavo Braga, Federal University of Maranhão, Brazil

Opeyemi De Campos, Covenant University, Nigeria

Data availability statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics statement

Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.

Author contributions

BL-E: Formal analysis, Resources, Project administration, Writing – original draft, Data curation, Visualization, Writing – review & editing, Validation, Conceptualization, Software, Investigation, Methodology. J-EB: Visualization, Formal analysis, Writing – original draft, Resources, Project administration, Methodology, Software, Validation, Investigation, Writing – review & editing, Conceptualization, Data curation. JM: Resources, Writing – review & editing, Investigation. KK: Writing – review & editing, Funding acquisition, Resources. KS: Investigation, Resources, Writing – review & editing. TI: Resources, Writing – review & editing, Funding acquisition. TK: Resources, Writing – review & editing. GB: Writing – review & editing, Resources. PO: Resources, Writing – review & editing. KA: Writing – review & editing, Resources. HY: Resources, Writing – review & editing. RK: Resources, Writing – review & editing. YH: Conceptualization, Methodology, Supervision, Funding acquisition, Writing – review & editing, Resources, Writing – original draft.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fonc.2026.1881286/full#supplementary-material

Supplementary Figure 1

Application of a light-emitting diode (LED) light source in PDT. (A) A 610-nm or (B) 660-nm LED light source was fabricated using 100 plug-in LED arrays on an LED substrate. To prevent hyperthermic effects, a water-filled heat-absorbing filter was positioned between the well plate and the LED source.

Image1.tif^{(3MB, tif)}

Supplementary Figure 5

Evaluation of the viability of human cancer cells treated with E26 or hE26 in the dark. Assessment of dark cytotoxicity in NSCLC cells treated with (A) high doses of E26 (25–400 nM) or (B) low doses of hE26 (5–25 nM) using the MTT assay. Data represent the mean ± SD of at least 3 independent experiments.

Image2.tif^{(1.6MB, tif)}

DataSheet1.docx^{(349.9KB, docx)}

References

1. Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. (2024) 74:229–63. doi: 10.3322/caac.21834 [DOI] [PubMed] [Google Scholar]
2. Zhou J, Xu Y, Liu J, Feng L, Yu J, Chen D. Global burden of lung cancer in 2022 and projections to 2050: Incidence and mortality estimates from GLOBOCAN. Cancer Epidemiol. (2024) 93:102693. doi: 10.1016/j.canep.2024.102693 [DOI] [PubMed] [Google Scholar]
3. Smolarz B, Lukasiewicz H, Samulak D, Piekarska E, Kolacinski R, Romanowicz H. Lung cancer-epidemiology, pathogenesis, treatment and molecular aspect (review of literature). Int J Mol Sci. (2025) 26(5):2049. doi: 10.3390/ijms26052049 [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Gunaydin G, Gedik ME, Ayan S. Photodynamic therapy for the treatment and diagnosis of cancer-a review of the current clinical status. Front Chem. (2021) 9:686303. doi: 10.3389/fchem.2021.686303 [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Shafirstein G, Battoo A, Harris K, Baumann H, Gollnick SO, Lindenmann J, et al. Photodynamic therapy of non-small cell lung cancer. Narrative review and future directions. Ann Am Thorac Soc. (2016) 13:265–75. doi: 10.1513/annalsats.201509-650fr [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Kwiatkowski S, Knap B, Przystupski D, Saczko J, Kedzierska E, Knap-Czop K, et al. Photodynamic therapy - mechanisms, photosensitizers and combinations. BioMed Pharmacother. (2018) 106:1098–107. doi: 10.1016/j.biopha.2018.07.049 [DOI] [PubMed] [Google Scholar]
7. Simone CB, Cengel KA. Photodynamic therapy for lung cancer and Malignant pleural mesothelioma. Semin Oncol. (2014) 41:820–30. doi: 10.1053/j.seminoncol.2014.09.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Ikeda N, Usuda J, Maehara S. Photodynamic therapy for central-type early-stage lung cancer. Gen Thorac Cardiovasc Surg. (2020) 68:679–83. doi: 10.1007/s11748-019-01240-1 [DOI] [PubMed] [Google Scholar]
9. Ji W, Yoo JW, Bae EK, Lee JH, Choi CM. The effect of Radachlorin(R) PDT in advanced NSCLC: a pilot study. Photodiagnosis Photodyn Ther. (2013) 10:120–6. doi: 10.1016/j.pdpdt.2013.01.004 [DOI] [PubMed] [Google Scholar]
10. Kimura M, Miyajima K, Kojika M, Kono T, Kato H. Photodynamic therapy (PDT) with chemotherapy for advanced lung cancer with airway stenosis. Int J Mol Sci. (2015) 16:25466–75. doi: 10.3390/ijms161025466 [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Wang K, Yu B, Pathak JL. An update in clinical utilization of photodynamic therapy for lung cancer. J Cancer. (2021) 12:1154–60. doi: 10.7150/jca.51537 [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Jung HS, Kim HJ. Definitive surgery and intraoperative photodynamic therapy for locally advanced non-small cell lung cancer: a case report. World J Surg Oncol. (2022) 20:265. doi: 10.1186/s12957-022-02729-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Sun W, Zhang Q, Wang X, Jin Z, Cheng Y, Wang G. Clinical practice of photodynamic therapy for non-small cell lung cancer in different scenarios: Who is the better candidate? Respiration. (2024) 103:193–204. doi: 10.1159/000535270 [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Mai NNH, Yamaguchi Y, Choijookhuu N, Matsumoto J, Nanashima A, Takagi H, et al. Photodynamic therapy using a novel phosphorus tetraphenylporphyrin induces an anticancer effect via Bax/Bcl-xL-related mitochondrial apoptosis in biliary cancer cells. Acta Histochem Cytochem. (2020) 53:61–72. doi: 10.1267/ahc.20-00002 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Gunaydin G, Gedik ME, Ayan S. Photodynamic therapy-current limitations and novel approaches. Front Chem. (2021) 9:691697. doi: 10.3389/fchem.2021.691697 [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Donohoe C, Senge MO, Arnaut LG, Gomes-da-Silva LC. Cell death in photodynamic therapy: From oxidative stress to anti-tumor immunity. Biochim Biophys Acta Rev Cancer. (2019) 1872:188308. doi: 10.1016/j.bbcan.2019.07.003 [DOI] [PubMed] [Google Scholar]
17. Matsumoto J, Sugita Y, Sato K, Tanimura K, Fujino A, Shiragami T. Hydrogenation of di(methoxo)tetraphenylporphyrin phosphorus(V) to isobacteriochlorin, chlorin, and phlorin complex with long-wavelength absorption band. Tetrahedron Lett. (2024) 142:155100. doi: 10.2139/ssrn.4782507 [DOI] [Google Scholar]
18. Takajo T, Kurihara Y, Iwase K, Miyake D, Tsuchida K, Anzai K. Basic investigations of singlet oxygen detection systems with ESR for the measurement of singlet oxygen quenching activities. Chem Pharm Bull (Tokyo). (2020) 68:150–4. doi: 10.1248/cpb.c19-00770 [DOI] [PubMed] [Google Scholar]
19. Kessel D, Oleinick NL. Cell death pathways associated with photodynamic therapy: An update. Photochem Photobiol. (2018) 94:213–8. doi: 10.1111/php.12857 [DOI] [PubMed] [Google Scholar]
20. Kojima Y, Tanaka M, Sasaki M, Ozeki K, Shimura T, Kubota E, et al. Induction of ferroptosis by photodynamic therapy and enhancement of antitumor effect with ferroptosis inducers. J Gastroenterol. (2024) 59:81–94. doi: 10.1007/s00535-023-02054-y [DOI] [PubMed] [Google Scholar]
21. Chen D, Guo Z, Yao L, Sun Y, Dian Y, Zhao D, et al. Targeting oxidative stress-mediated regulated cell death as a vulnerability in cancer. Redox Biol. (2025) 84:103686. doi: 10.1016/j.redox.2025.103686 [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Bock FJ, Tait SWG. Mitochondria as multifaceted regulators of cell death. Nat Rev Mol Cell Biol. (2020) 21:85–100. doi: 10.1038/s41580-019-0173-8 [DOI] [PubMed] [Google Scholar]
23. Kai K, Ishizuka T, Matsumoto J, Shimamawari K, Mori R, Fidya, et al. Non-cytotoxic photodynamic therapy with talaporfin sodium reduces the expression of CXCR4 and enhances chemotherapeutic efficacy in undifferentiated gastric cancer cell line HGC27. Acta Histochem Cytochem. (2025) 58:69–79. doi: 10.1267/ahc.25-00002 [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Choijookhuu N, Yano K, Lkham-Erdene B, Shirouzu S, Kubota T, Fidya, et al. HMGB2 promotes de novo lipogenesis to accelerate hepatocyte proliferation during liver regeneration. J Histochem Cytochem. (2024) 72:245–64. doi: 10.1369/00221554241241569 [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Choijookhuu N, Shibata Y, Ishizuka T, Xu Y, Koji T, Hishikawa Y. An advanced detection system for in situ hybridization using a fluorescence resonance energy transfer-based molecular beacon probe. Acta Histochem Cytochem. (2022) 55:119–28. doi: 10.1267/ahc.22-00075 [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Higuchi K, Ikenoue M, Ishizuka T, Kai K, Takahashi N, Kubota T, et al. SETDB1-mediated chromatin regulation in intestinal epithelial cells during intestinal ischemia-reperfusion injury. Acta Histochem Cytochem. (2025) 58:9–18. doi: 10.1267/ahc.24-00061 [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Batmunkh B, Choijookhuu N, Srisowanna N, Byambatsogt U, Synn Oo P, Noor Ali M, et al. Estrogen accelerates cell proliferation through estrogen receptor alpha during rat liver regeneration after partial hepatectomy. Acta Histochem Cytochem. (2017) 50:39–48. doi: 10.1267/ahc.17003 [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Lkham-Erdene B, Choijookhuu N, Kubota T, Uto T, Mitoma S, Shirouzu S, et al. Effect of hepatic lipid overload on accelerated hepatocyte proliferation promoted by HGF expression via the SphK1/S1PR2 pathway in MCD-diet mouse partial hepatectomy. Acta Histochem Cytochem. (2024) 57:175–88. doi: 10.1267/ahc.24-00046 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Kim H, Kim SW, Seok KH, Hwang CW, Ahn JC, Jin JO, et al. Hypericin-assisted photodynamic therapy against anaplastic thyroid cancer. Photodiagnosis Photodyn Ther. (2018) 24:15–21. doi: 10.1016/j.pdpdt.2018.08.008 [DOI] [PubMed] [Google Scholar]
30. Liu C, Wu T, Wang S, Zhou W, Li Y, Chen X, et al. Anticancer effect of LS-HB-mediated photodynamic therapy on hepatocellular carcinoma in vitro and in vivo. Photodiagnosis Photodyn Ther. (2020) 30:101718. doi: 10.1016/j.pdpdt.2020.101718 [DOI] [PubMed] [Google Scholar]
31. Ghaddar S, Pinon A, Gallardo-Villagran M, Massoud J, Ouk C, Carrion C, et al. Photodynamic therapy against colorectal cancer using porphin-loaded arene ruthenium cages. Int J Mol Sci. (2024) 25(19):10847. doi: 10.3390/ijms251910847 [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Yeo S, Lee TH, Kim MJ, Shim YK, Yoon I, Song YK, et al. Improved anticancer efficacy of methyl pyropheophorbide-a-incorporated solid lipid nanoparticles in photodynamic therapy. Sci Rep. (2023) 13:7391. doi: 10.1038/s41598-023-34265-x [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Przygoda M, Bartusik-Aebisher D, Dynarowicz K, Cieslar G, Kawczyk-Krupka A, Aebisher D. Cellular mechanisms of singlet oxygen in photodynamic therapy. Int J Mol Sci. (2023) 24(23):16890. doi: 10.3390/ijms242316890 [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Pu W, Xue L, Han Z, Yang L, Wang Y, Wan N, et al. The efficacy and mechanism of thoracic photodynamic therapy mediated by hematoporphyrin injection on disseminated pleural Malignancies of Lewis lung carcinoma in mice. Am J Cancer Res. (2022) 12:1502–10. doi: 10.62347/xlca8048 [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Mroz P, Yaroslavsky A, Kharkwal GB, Hamblin MR. Cell death pathways in photodynamic therapy of cancer. Cancers (Basel). (2011) 3:2516–39. doi: 10.3390/cancers3022516 [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Kessel D. Apoptosis, paraptosis and autophagy: Death and survival pathways associated with photodynamic therapy. Photochem Photobiol. (2019) 95:119–25. doi: 10.1111/php.12952 [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Oliveira CS, Turchiello R, Kowaltowski AJ, Indig GL, Baptista MS. Major determinants of photoinduced cell death: Subcellular localization versus photosensitization efficiency. Free Radic Biol Med. (2011) 51:824–33. doi: 10.1016/j.freeradbiomed.2011.05.023 [DOI] [PubMed] [Google Scholar]
38. Yaqoob MD, Xu L, Li C, Leong MML, Xu DD. Targeting mitochondria for cancer photodynamic therapy. Photodiagnosis Photodyn Ther. (2022) 38:102830. doi: 10.1016/j.pdpdt.2022.102830 [DOI] [PubMed] [Google Scholar]
39. Kadkhoda J, Tarighatnia A, Nader ND, Aghanejad A. Targeting mitochondria in cancer therapy: Insight into photodynamic and photothermal therapies. Life Sci. (2022) 307:120898. doi: 10.1016/j.lfs.2022.120898 [DOI] [PubMed] [Google Scholar]
40. Desai VM, Choudhary M, Chowdhury R, Singhvi G. Photodynamic therapy induced mitochondrial targeting strategies for cancer treatment: Emerging trends and insights. Mol Pharm. (2024) 21:1591–608. doi: 10.1021/acs.molpharmaceut.3c01185 [DOI] [PubMed] [Google Scholar]
41. Agostinis P, Berg K, Cengel KA, Foster TH, Girotti AW, Gollnick SO, et al. Photodynamic therapy of cancer: an update. CA Cancer J Clin. (2011) 61:250–81. doi: 10.3322/caac.20114 [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Oleinick NL, Morris RL, Belichenko I. The role of apoptosis in response to photodynamic therapy: what, where, why, and how. Photochem Photobiol Sci. (2002) 1:1–21. doi: 10.1039/b108586g [DOI] [PubMed] [Google Scholar]
43. Glover HL, Schreiner A, Dewson G, Tait SWG. Mitochondria and cell death. Nat Cell Biol. (2024) 26:1434–46. doi: 10.1038/s41556-024-01429-4 [DOI] [PubMed] [Google Scholar]
44. Czabotar PE, Garcia-Saez AJ. Mechanisms of BCL-2 family proteins in mitochondrial apoptosis. Nat Rev Mol Cell Biol. (2023) 24:732–48. doi: 10.1038/s41580-023-00629-4 [DOI] [PubMed] [Google Scholar]
45. Martinou JC, Youle RJ. Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics. Dev Cell. (2011) 21:92–101. doi: 10.1016/j.devcel.2011.06.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Newton K, Strasser A, Kayagaki N, Dixit VM. Cell death. Cell. (2024) 187:235–56. doi: 10.1016/s0065-2776(01)76020-8 [DOI] [PubMed] [Google Scholar]
47. Perlman H, Zhang X, Chen MW, Walsh K, Buttyan R. An elevated bax/bcl-2 ratio corresponds with the onset of prostate epithelial cell apoptosis. Cell Death Diff. (1999) 6:48–54. doi: 10.1038/sj.cdd.4400453 [DOI] [PubMed] [Google Scholar]
48. Chang J, Hsu Y, Kuo P, Kuo Y, Chiang L, Lin C. Increase of Bax/ Bcl-XL ratio and arrest of cell cycle by luteolin in immortalized human hepatoma cell line. Life Sci. (2005) 76:1883–93. doi: 10.1016/j.lfs.2004.11.003 [DOI] [PubMed] [Google Scholar]
49. Nazeri M, Mirzaie-Asl A, Saidijam M, Moradi M. Methanolic extract of Artemisia absinthium prompts apoptosis, enhancing expression of Bax/Bcl-2 ratio, cell cycle arrest, caspase-3 activation and mitochondrial membrane potential destruction in human colorectal cancer HCT-116 cells. Mol Biol Rep. (2020) 47:8831–40. doi: 10.1007/s11033-020-05933-2 [DOI] [PubMed] [Google Scholar]
50. Martinez VR, Aguirre MV, Todaro JS, Ferrer EG, Williams PAM. Improvement of the anticancer activities of telmisartan by Zn(II) complexation and mechanisms of action. Biol Trace Elem Res. (2020) 197:454–63. doi: 10.1007/s12011-019-02013-w [DOI] [PubMed] [Google Scholar]
51. Baillat G, Garrouste F, Remacle-Bonnet M, Marvaldi J, Pommier G. Bcl-xL/Bax ratio is altered by IFNgamma in TNFalpha- but not in TRAIL-induced apoptosis in colon cancer cell line. Biochim Biophys Acta. (2005) 1745:101–10. doi: 10.1016/j.bbamcr.2004.12.005 [DOI] [PubMed] [Google Scholar]
52. Zhang Y, Yang X, Ge X, Zhang F. Puerarin attenuates neurological deficits via Bcl-2/Bax/cleaved caspase-3 and Sirt3/SOD2 apoptotic pathways in subarachnoid hemorrhage mice. BioMed Pharmacother. (2019) 109:726–33. doi: 10.1016/j.biopha.2018.10.161 [DOI] [PubMed] [Google Scholar]
53. Shabnam MS, Srinivasan R, Wali A, Majumdar S, Joshi K, Behera D. Expression of p53 protein and the apoptotic regulatory molecules Bcl-2, Bcl-XL, and Bax in locally advanced squamous cell carcinoma of the lung. Lung Cancer. (2004) 45:181–8. doi: 10.1016/j.lungcan.2004.01.021 [DOI] [PubMed] [Google Scholar]
54. Dalseno D, Gajic N, Flanagan L, Tait SWG. Cell death and cancer: Metabolic interconnections. Cell Rep. (2025) 44:115804. doi: 10.1016/j.celrep.2025.115804 [DOI] [PMC free article] [PubMed] [Google Scholar]
55. McCaughan JS, Jr., Williams TE. Photodynamic therapy for endobronchial Malignant disease: a prospective fourteen-year study. J Thorac Cardiovasc Surg. (1997) 114:940–6. doi: 10.1016/s0022-5223(97)70008-4 [DOI] [PubMed] [Google Scholar]
56. Schlesinger T, Chapman MS, Tu JH, Cohen JL, Strasswimmer J, Zeitouni NC, et al. Red light photodynamic therapy with 10% aminolevulinic acid gel showed efficacy for treatment of superficial basal cell carcinoma in a randomized, vehicle controlled, double-blind, multicenter phase III study. J Am Acad Dermatol. (2025) 93:1489–98. doi: 10.1016/j.jaad.2025.08.031 [DOI] [PubMed] [Google Scholar]
57. Minamide T, Yoda Y, Hori K, Shinmura K, Oono Y, Ikematsu H, et al. Advantages of salvage photodynamic therapy using talaporfin sodium for local failure after chemoradiotherapy or radiotherapy for esophageal cancer. Surg Endosc. (2020) 34:899–906. doi: 10.1007/s00464-019-06846-3 [DOI] [PubMed] [Google Scholar]
58. Kato H, Furukawa K, Sato M, Okunaka T, Kusunoki Y, Kawahara M, et al. Phase II clinical study of photodynamic therapy using mono-L-aspartyl chlorin e6 and diode laser for early superficial squamous cell carcinoma of the lung. Lung Cancer. (2003) 42:103–11. doi: 10.1016/s0169-5002(03)00242-3 [DOI] [PubMed] [Google Scholar]
59. Usuda J, Ichinose S, Ishizumi T, Hayashi H, Ohtani K, Maehara S, et al. Outcome of photodynamic therapy using NPe6 for bronchogenic carcinomas in central airways >1.0 cm in diameter. Clin Cancer Res. (2010) 16:2198–204. doi: 10.1158/1078-0432.ccr-09-2520 [DOI] [PubMed] [Google Scholar]
60. Tsuchida T, Matsumoto Y, Imabayashi T, Uchimura K, Sasada S. Photodynamic therapy can be safely performed with Talaporfin sodium as a day treatment for central-type early-stage lung cancer. Photodiagnosis Photodyn Ther. (2022) 38:102836. doi: 10.1016/j.pdpdt.2022.102836 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure 1

Image1.tif^{(3MB, tif)}

Supplementary Figure 5

Image2.tif^{(1.6MB, tif)}

DataSheet1.docx^{(349.9KB, docx)}

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

[B1] 1. Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. (2024) 74:229–63. doi: 10.3322/caac.21834 [DOI] [PubMed] [Google Scholar]

[B2] 2. Zhou J, Xu Y, Liu J, Feng L, Yu J, Chen D. Global burden of lung cancer in 2022 and projections to 2050: Incidence and mortality estimates from GLOBOCAN. Cancer Epidemiol. (2024) 93:102693. doi: 10.1016/j.canep.2024.102693 [DOI] [PubMed] [Google Scholar]

[B3] 3. Smolarz B, Lukasiewicz H, Samulak D, Piekarska E, Kolacinski R, Romanowicz H. Lung cancer-epidemiology, pathogenesis, treatment and molecular aspect (review of literature). Int J Mol Sci. (2025) 26(5):2049. doi: 10.3390/ijms26052049 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Gunaydin G, Gedik ME, Ayan S. Photodynamic therapy for the treatment and diagnosis of cancer-a review of the current clinical status. Front Chem. (2021) 9:686303. doi: 10.3389/fchem.2021.686303 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5. Shafirstein G, Battoo A, Harris K, Baumann H, Gollnick SO, Lindenmann J, et al. Photodynamic therapy of non-small cell lung cancer. Narrative review and future directions. Ann Am Thorac Soc. (2016) 13:265–75. doi: 10.1513/annalsats.201509-650fr [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6. Kwiatkowski S, Knap B, Przystupski D, Saczko J, Kedzierska E, Knap-Czop K, et al. Photodynamic therapy - mechanisms, photosensitizers and combinations. BioMed Pharmacother. (2018) 106:1098–107. doi: 10.1016/j.biopha.2018.07.049 [DOI] [PubMed] [Google Scholar]

[B7] 7. Simone CB, Cengel KA. Photodynamic therapy for lung cancer and Malignant pleural mesothelioma. Semin Oncol. (2014) 41:820–30. doi: 10.1053/j.seminoncol.2014.09.017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. Ikeda N, Usuda J, Maehara S. Photodynamic therapy for central-type early-stage lung cancer. Gen Thorac Cardiovasc Surg. (2020) 68:679–83. doi: 10.1007/s11748-019-01240-1 [DOI] [PubMed] [Google Scholar]

[B9] 9. Ji W, Yoo JW, Bae EK, Lee JH, Choi CM. The effect of Radachlorin(R) PDT in advanced NSCLC: a pilot study. Photodiagnosis Photodyn Ther. (2013) 10:120–6. doi: 10.1016/j.pdpdt.2013.01.004 [DOI] [PubMed] [Google Scholar]

[B10] 10. Kimura M, Miyajima K, Kojika M, Kono T, Kato H. Photodynamic therapy (PDT) with chemotherapy for advanced lung cancer with airway stenosis. Int J Mol Sci. (2015) 16:25466–75. doi: 10.3390/ijms161025466 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11. Wang K, Yu B, Pathak JL. An update in clinical utilization of photodynamic therapy for lung cancer. J Cancer. (2021) 12:1154–60. doi: 10.7150/jca.51537 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12. Jung HS, Kim HJ. Definitive surgery and intraoperative photodynamic therapy for locally advanced non-small cell lung cancer: a case report. World J Surg Oncol. (2022) 20:265. doi: 10.1186/s12957-022-02729-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13. Sun W, Zhang Q, Wang X, Jin Z, Cheng Y, Wang G. Clinical practice of photodynamic therapy for non-small cell lung cancer in different scenarios: Who is the better candidate? Respiration. (2024) 103:193–204. doi: 10.1159/000535270 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. Mai NNH, Yamaguchi Y, Choijookhuu N, Matsumoto J, Nanashima A, Takagi H, et al. Photodynamic therapy using a novel phosphorus tetraphenylporphyrin induces an anticancer effect via Bax/Bcl-xL-related mitochondrial apoptosis in biliary cancer cells. Acta Histochem Cytochem. (2020) 53:61–72. doi: 10.1267/ahc.20-00002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Gunaydin G, Gedik ME, Ayan S. Photodynamic therapy-current limitations and novel approaches. Front Chem. (2021) 9:691697. doi: 10.3389/fchem.2021.691697 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16. Donohoe C, Senge MO, Arnaut LG, Gomes-da-Silva LC. Cell death in photodynamic therapy: From oxidative stress to anti-tumor immunity. Biochim Biophys Acta Rev Cancer. (2019) 1872:188308. doi: 10.1016/j.bbcan.2019.07.003 [DOI] [PubMed] [Google Scholar]

[B17] 17. Matsumoto J, Sugita Y, Sato K, Tanimura K, Fujino A, Shiragami T. Hydrogenation of di(methoxo)tetraphenylporphyrin phosphorus(V) to isobacteriochlorin, chlorin, and phlorin complex with long-wavelength absorption band. Tetrahedron Lett. (2024) 142:155100. doi: 10.2139/ssrn.4782507 [DOI] [Google Scholar]

[B18] 18. Takajo T, Kurihara Y, Iwase K, Miyake D, Tsuchida K, Anzai K. Basic investigations of singlet oxygen detection systems with ESR for the measurement of singlet oxygen quenching activities. Chem Pharm Bull (Tokyo). (2020) 68:150–4. doi: 10.1248/cpb.c19-00770 [DOI] [PubMed] [Google Scholar]

[B19] 19. Kessel D, Oleinick NL. Cell death pathways associated with photodynamic therapy: An update. Photochem Photobiol. (2018) 94:213–8. doi: 10.1111/php.12857 [DOI] [PubMed] [Google Scholar]

[B20] 20. Kojima Y, Tanaka M, Sasaki M, Ozeki K, Shimura T, Kubota E, et al. Induction of ferroptosis by photodynamic therapy and enhancement of antitumor effect with ferroptosis inducers. J Gastroenterol. (2024) 59:81–94. doi: 10.1007/s00535-023-02054-y [DOI] [PubMed] [Google Scholar]

[B21] 21. Chen D, Guo Z, Yao L, Sun Y, Dian Y, Zhao D, et al. Targeting oxidative stress-mediated regulated cell death as a vulnerability in cancer. Redox Biol. (2025) 84:103686. doi: 10.1016/j.redox.2025.103686 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22. Bock FJ, Tait SWG. Mitochondria as multifaceted regulators of cell death. Nat Rev Mol Cell Biol. (2020) 21:85–100. doi: 10.1038/s41580-019-0173-8 [DOI] [PubMed] [Google Scholar]

[B23] 23. Kai K, Ishizuka T, Matsumoto J, Shimamawari K, Mori R, Fidya, et al. Non-cytotoxic photodynamic therapy with talaporfin sodium reduces the expression of CXCR4 and enhances chemotherapeutic efficacy in undifferentiated gastric cancer cell line HGC27. Acta Histochem Cytochem. (2025) 58:69–79. doi: 10.1267/ahc.25-00002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24. Choijookhuu N, Yano K, Lkham-Erdene B, Shirouzu S, Kubota T, Fidya, et al. HMGB2 promotes de novo lipogenesis to accelerate hepatocyte proliferation during liver regeneration. J Histochem Cytochem. (2024) 72:245–64. doi: 10.1369/00221554241241569 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25. Choijookhuu N, Shibata Y, Ishizuka T, Xu Y, Koji T, Hishikawa Y. An advanced detection system for in situ hybridization using a fluorescence resonance energy transfer-based molecular beacon probe. Acta Histochem Cytochem. (2022) 55:119–28. doi: 10.1267/ahc.22-00075 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26. Higuchi K, Ikenoue M, Ishizuka T, Kai K, Takahashi N, Kubota T, et al. SETDB1-mediated chromatin regulation in intestinal epithelial cells during intestinal ischemia-reperfusion injury. Acta Histochem Cytochem. (2025) 58:9–18. doi: 10.1267/ahc.24-00061 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Batmunkh B, Choijookhuu N, Srisowanna N, Byambatsogt U, Synn Oo P, Noor Ali M, et al. Estrogen accelerates cell proliferation through estrogen receptor alpha during rat liver regeneration after partial hepatectomy. Acta Histochem Cytochem. (2017) 50:39–48. doi: 10.1267/ahc.17003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28. Lkham-Erdene B, Choijookhuu N, Kubota T, Uto T, Mitoma S, Shirouzu S, et al. Effect of hepatic lipid overload on accelerated hepatocyte proliferation promoted by HGF expression via the SphK1/S1PR2 pathway in MCD-diet mouse partial hepatectomy. Acta Histochem Cytochem. (2024) 57:175–88. doi: 10.1267/ahc.24-00046 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29. Kim H, Kim SW, Seok KH, Hwang CW, Ahn JC, Jin JO, et al. Hypericin-assisted photodynamic therapy against anaplastic thyroid cancer. Photodiagnosis Photodyn Ther. (2018) 24:15–21. doi: 10.1016/j.pdpdt.2018.08.008 [DOI] [PubMed] [Google Scholar]

[B30] 30. Liu C, Wu T, Wang S, Zhou W, Li Y, Chen X, et al. Anticancer effect of LS-HB-mediated photodynamic therapy on hepatocellular carcinoma in vitro and in vivo. Photodiagnosis Photodyn Ther. (2020) 30:101718. doi: 10.1016/j.pdpdt.2020.101718 [DOI] [PubMed] [Google Scholar]

[B31] 31. Ghaddar S, Pinon A, Gallardo-Villagran M, Massoud J, Ouk C, Carrion C, et al. Photodynamic therapy against colorectal cancer using porphin-loaded arene ruthenium cages. Int J Mol Sci. (2024) 25(19):10847. doi: 10.3390/ijms251910847 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32. Yeo S, Lee TH, Kim MJ, Shim YK, Yoon I, Song YK, et al. Improved anticancer efficacy of methyl pyropheophorbide-a-incorporated solid lipid nanoparticles in photodynamic therapy. Sci Rep. (2023) 13:7391. doi: 10.1038/s41598-023-34265-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33. Przygoda M, Bartusik-Aebisher D, Dynarowicz K, Cieslar G, Kawczyk-Krupka A, Aebisher D. Cellular mechanisms of singlet oxygen in photodynamic therapy. Int J Mol Sci. (2023) 24(23):16890. doi: 10.3390/ijms242316890 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Pu W, Xue L, Han Z, Yang L, Wang Y, Wan N, et al. The efficacy and mechanism of thoracic photodynamic therapy mediated by hematoporphyrin injection on disseminated pleural Malignancies of Lewis lung carcinoma in mice. Am J Cancer Res. (2022) 12:1502–10. doi: 10.62347/xlca8048 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35. Mroz P, Yaroslavsky A, Kharkwal GB, Hamblin MR. Cell death pathways in photodynamic therapy of cancer. Cancers (Basel). (2011) 3:2516–39. doi: 10.3390/cancers3022516 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36. Kessel D. Apoptosis, paraptosis and autophagy: Death and survival pathways associated with photodynamic therapy. Photochem Photobiol. (2019) 95:119–25. doi: 10.1111/php.12952 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37. Oliveira CS, Turchiello R, Kowaltowski AJ, Indig GL, Baptista MS. Major determinants of photoinduced cell death: Subcellular localization versus photosensitization efficiency. Free Radic Biol Med. (2011) 51:824–33. doi: 10.1016/j.freeradbiomed.2011.05.023 [DOI] [PubMed] [Google Scholar]

[B38] 38. Yaqoob MD, Xu L, Li C, Leong MML, Xu DD. Targeting mitochondria for cancer photodynamic therapy. Photodiagnosis Photodyn Ther. (2022) 38:102830. doi: 10.1016/j.pdpdt.2022.102830 [DOI] [PubMed] [Google Scholar]

[B39] 39. Kadkhoda J, Tarighatnia A, Nader ND, Aghanejad A. Targeting mitochondria in cancer therapy: Insight into photodynamic and photothermal therapies. Life Sci. (2022) 307:120898. doi: 10.1016/j.lfs.2022.120898 [DOI] [PubMed] [Google Scholar]

[B40] 40. Desai VM, Choudhary M, Chowdhury R, Singhvi G. Photodynamic therapy induced mitochondrial targeting strategies for cancer treatment: Emerging trends and insights. Mol Pharm. (2024) 21:1591–608. doi: 10.1021/acs.molpharmaceut.3c01185 [DOI] [PubMed] [Google Scholar]

[B41] 41. Agostinis P, Berg K, Cengel KA, Foster TH, Girotti AW, Gollnick SO, et al. Photodynamic therapy of cancer: an update. CA Cancer J Clin. (2011) 61:250–81. doi: 10.3322/caac.20114 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42. Oleinick NL, Morris RL, Belichenko I. The role of apoptosis in response to photodynamic therapy: what, where, why, and how. Photochem Photobiol Sci. (2002) 1:1–21. doi: 10.1039/b108586g [DOI] [PubMed] [Google Scholar]

[B43] 43. Glover HL, Schreiner A, Dewson G, Tait SWG. Mitochondria and cell death. Nat Cell Biol. (2024) 26:1434–46. doi: 10.1038/s41556-024-01429-4 [DOI] [PubMed] [Google Scholar]

[B44] 44. Czabotar PE, Garcia-Saez AJ. Mechanisms of BCL-2 family proteins in mitochondrial apoptosis. Nat Rev Mol Cell Biol. (2023) 24:732–48. doi: 10.1038/s41580-023-00629-4 [DOI] [PubMed] [Google Scholar]

[B45] 45. Martinou JC, Youle RJ. Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics. Dev Cell. (2011) 21:92–101. doi: 10.1016/j.devcel.2011.06.017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46. Newton K, Strasser A, Kayagaki N, Dixit VM. Cell death. Cell. (2024) 187:235–56. doi: 10.1016/s0065-2776(01)76020-8 [DOI] [PubMed] [Google Scholar]

[B47] 47. Perlman H, Zhang X, Chen MW, Walsh K, Buttyan R. An elevated bax/bcl-2 ratio corresponds with the onset of prostate epithelial cell apoptosis. Cell Death Diff. (1999) 6:48–54. doi: 10.1038/sj.cdd.4400453 [DOI] [PubMed] [Google Scholar]

[B48] 48. Chang J, Hsu Y, Kuo P, Kuo Y, Chiang L, Lin C. Increase of Bax/ Bcl-XL ratio and arrest of cell cycle by luteolin in immortalized human hepatoma cell line. Life Sci. (2005) 76:1883–93. doi: 10.1016/j.lfs.2004.11.003 [DOI] [PubMed] [Google Scholar]

[B49] 49. Nazeri M, Mirzaie-Asl A, Saidijam M, Moradi M. Methanolic extract of Artemisia absinthium prompts apoptosis, enhancing expression of Bax/Bcl-2 ratio, cell cycle arrest, caspase-3 activation and mitochondrial membrane potential destruction in human colorectal cancer HCT-116 cells. Mol Biol Rep. (2020) 47:8831–40. doi: 10.1007/s11033-020-05933-2 [DOI] [PubMed] [Google Scholar]

[B50] 50. Martinez VR, Aguirre MV, Todaro JS, Ferrer EG, Williams PAM. Improvement of the anticancer activities of telmisartan by Zn(II) complexation and mechanisms of action. Biol Trace Elem Res. (2020) 197:454–63. doi: 10.1007/s12011-019-02013-w [DOI] [PubMed] [Google Scholar]

[B51] 51. Baillat G, Garrouste F, Remacle-Bonnet M, Marvaldi J, Pommier G. Bcl-xL/Bax ratio is altered by IFNgamma in TNFalpha- but not in TRAIL-induced apoptosis in colon cancer cell line. Biochim Biophys Acta. (2005) 1745:101–10. doi: 10.1016/j.bbamcr.2004.12.005 [DOI] [PubMed] [Google Scholar]

[B52] 52. Zhang Y, Yang X, Ge X, Zhang F. Puerarin attenuates neurological deficits via Bcl-2/Bax/cleaved caspase-3 and Sirt3/SOD2 apoptotic pathways in subarachnoid hemorrhage mice. BioMed Pharmacother. (2019) 109:726–33. doi: 10.1016/j.biopha.2018.10.161 [DOI] [PubMed] [Google Scholar]

[B53] 53. Shabnam MS, Srinivasan R, Wali A, Majumdar S, Joshi K, Behera D. Expression of p53 protein and the apoptotic regulatory molecules Bcl-2, Bcl-XL, and Bax in locally advanced squamous cell carcinoma of the lung. Lung Cancer. (2004) 45:181–8. doi: 10.1016/j.lungcan.2004.01.021 [DOI] [PubMed] [Google Scholar]

[B54] 54. Dalseno D, Gajic N, Flanagan L, Tait SWG. Cell death and cancer: Metabolic interconnections. Cell Rep. (2025) 44:115804. doi: 10.1016/j.celrep.2025.115804 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55. McCaughan JS, Jr., Williams TE. Photodynamic therapy for endobronchial Malignant disease: a prospective fourteen-year study. J Thorac Cardiovasc Surg. (1997) 114:940–6. doi: 10.1016/s0022-5223(97)70008-4 [DOI] [PubMed] [Google Scholar]

[B56] 56. Schlesinger T, Chapman MS, Tu JH, Cohen JL, Strasswimmer J, Zeitouni NC, et al. Red light photodynamic therapy with 10% aminolevulinic acid gel showed efficacy for treatment of superficial basal cell carcinoma in a randomized, vehicle controlled, double-blind, multicenter phase III study. J Am Acad Dermatol. (2025) 93:1489–98. doi: 10.1016/j.jaad.2025.08.031 [DOI] [PubMed] [Google Scholar]

[B57] 57. Minamide T, Yoda Y, Hori K, Shinmura K, Oono Y, Ikematsu H, et al. Advantages of salvage photodynamic therapy using talaporfin sodium for local failure after chemoradiotherapy or radiotherapy for esophageal cancer. Surg Endosc. (2020) 34:899–906. doi: 10.1007/s00464-019-06846-3 [DOI] [PubMed] [Google Scholar]

[B58] 58. Kato H, Furukawa K, Sato M, Okunaka T, Kusunoki Y, Kawahara M, et al. Phase II clinical study of photodynamic therapy using mono-L-aspartyl chlorin e6 and diode laser for early superficial squamous cell carcinoma of the lung. Lung Cancer. (2003) 42:103–11. doi: 10.1016/s0169-5002(03)00242-3 [DOI] [PubMed] [Google Scholar]

[B59] 59. Usuda J, Ichinose S, Ishizumi T, Hayashi H, Ohtani K, Maehara S, et al. Outcome of photodynamic therapy using NPe6 for bronchogenic carcinomas in central airways >1.0 cm in diameter. Clin Cancer Res. (2010) 16:2198–204. doi: 10.1158/1078-0432.ccr-09-2520 [DOI] [PubMed] [Google Scholar]

[B60] 60. Tsuchida T, Matsumoto Y, Imabayashi T, Uchimura K, Sasada S. Photodynamic therapy can be safely performed with Talaporfin sodium as a day treatment for central-type early-stage lung cancer. Photodiagnosis Photodyn Ther. (2022) 38:102836. doi: 10.1016/j.pdpdt.2022.102836 [DOI] [PubMed] [Google Scholar]

PERMALINK

A novel photosensitizer (hE26) for photodynamic therapy enhances anticancer efficacy via reactive oxygen species-induced mitochondrial apoptosis in non-small cell lung cancer

Baljinnyam Lkham-Erdene

Jargal-Erdene Batmunkh

Jin Matsumoto

Kengo Kai

Koki Shimamawari

Takumi Ishizuka

Toshiki Kubota

Ganzorig Baatar

Phyu Synn Oo

Kham Mo Aung

Haruka Yokogawa

Ryonosuke Kai

Yoshitaka Hishikawa

Roles

Abstract

Introduction

Methods

Results

Conclusion

Introduction

Materials and methods

Cell culture

Hydrogenation of E26

PDT experiment

Cell viability assay

Immunohistochemistry

Wound healing assay

Localization of hE26

Mitochondrial membrane potential assay

Measurement of ROS

Malondialdehyde assay

Assessment of apoptotic cell death

qPCR analysis

Statistical analysis

Results

Preparation and singlet oxygen generation ability of hE26

Potent reduction in the viability of NSCLC cells following low-dose hE26-mediated PDT

Figure 1.

Low-dose hE26-mediated PDT exhibits enhanced anticancer efficacy against NSCLC cells

Figure 2.

Subcellular localization of hE26 to the mitochondria

Figure 3.

Induction of ROS-dependent mitochondrial dysfunction in A549 cells following low-dose hE26-mediated PDT

Figure 4.

Low-dose hE26-mediated PDT triggers the mitochondrial apoptotic pathway in A549 cells

Figure 5.

Discussion

Acknowledgments

Funding Statement

Footnotes

Data availability statement

Ethics statement

Author contributions

Conflict of interest

Generative AI statement

Publisher’s note

Supplementary material

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases