Adipokine CTRP12 Alleviates Experimental Colitis by Participating in Modulating Mesenteric M2 Macrophage Polarization in IL-10 KO Mice

Abstract

Purpose

Crohn’s disease is a chronic inflammatory bowel disease of unknown etiology. Mesentery dysfunction and aberrant adipokine levels participate in the pathogenesis of Crohn’s disease. Macrophage polarization plays important roles in mesenteric inflammation. This study aimed to explore the expression of adipokine CTRP12 in Crohn’s disease patients and possible roles using IL-10 deficient (Il-10^−/−) mice.

Methods

Expression of CTRP12 in mesentery adipose tissue specimens from Crohn’s patients (n = 20) and control patients (n = 10) was detected. Il-10^−/− mice with established colitis were administered with CTRP12, and untreated mice served as controls (n = 8 for each group). Disease activity, and colonic and mesenteric inflammation was evaluated. Modulation of macrophage polarization and related signaling pathway was also analyzed.

Results

Our findings indicate CTRP12 is highly expressed in the mesentery of Crohn’s patients. CTRP12 treatment can reduce intestinal and mesenteric inflammation in chronic colitis model with CD-like features and can promote the polarization of mesenteric macrophages to M2 type, possibly related to the activation of TGFβRII/Smad signaling pathway.

Conclusion

These findings suggest adipokine CTRP12 could ameliorate Crohn’s colitis by modulating polarization of mesenteric macrophages to M2 type, providing new target for Crohn’s disease therapy.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10620-026-09718-8.

Introduction

Crohn’s disease (CD) is a kind of chronic and recurrent inflammatory bowel disease (IBD) that affects the entire intestine and has an increased risk of surgical interventions as the disease progresses. Despite advancement in therapies, CD remains a challenge for physicians due to poor clinical outcomes and unpredictable complications [1, 2]. Emerging evidence indicates that the mesentery may participate in the development and progression of CD [3, 4]. Several studies, including our own, have shown a strong correlation between abnormal mesentery and disease activity, mucosal healing, and intestinal fibrosis [5–7]. In fact, a recent randomized controlled trial discovered that excluding the mesentery might prevent anastomotic recurrence in CD patients [8]. Further studies have focused on specific tissues within the mesenteric adipose tissue (MAT), such as adipocytes, lymphatics, inflammatory cells, to understand their distinct impacts on CD [9–11]. One recent study revealed that MAT may act as a barrier, preventing the spread of intestinal bacteria throughout the body [12]. Our previous studies have also highlighted that MAT exerts a protective role, partially through secretion of adipokines [13, 14]. Adipokines, primarily produced by adipocytes, impact both metabolism and immune system [6].

Macrophages are dominant inflammatory cells in adipose tissue. ‘Classically activated’ M1 macrophages produce large amounts of inflammatory cytokines such as TNF-α, IL-1β, while ‘Alternatively activated’ M2 macrophages are thought to exert anti-inflammatory role and promote wound repair [15]. Studies have shown a predominant presence of M1 macrophages in the abnormal MAT of patients with CD, exhibiting elevated expression of pro-inflammatory cytokines, like IL-1β, IL-6, TNF-α and MCP-1 [11, 16]. In mice models, suppressing the transition from of M1 to M2 macrophages may aggravate colitis, suggesting that modulating macrophages polarization may provide a useful strategy for CD therapy [16, 17].

C1q tumor necrosis factor-related protein 12(CTRP12), also known as adipolin, is a newly identified adipokine that is abundantly expressed in adipose tissue [18]. Research has shown that CTRP12 is upregulated in both visceral and subcutaneous adipose tissue of obese patients compared to normal individuals [19]. Several studies have reported the anti-inflammatory role of CTRP12. In the animal model of obesity, CTRP12 has been found to decrease mesenteric inflammation, and its deficiency can lead to abnormal liquid metabolism [18]. Recent studies have also found that increased levels of CTRP12 may protect against cardiomyocyte injury [20, 21] and prevent pathological vascular remodelling through suppressing the inflammatory response of macrophages [22]. Moreover, CTRP12 has been found to alleviate atherosclerosis by promote macrophages to polarize towards M2 phenotype and reducing vascular inflammation [23]. However, the expression of CTRP12 in CD is not well understood and its potential role in the mesenteric inflammation of CD remains unclear.

In this study, we reported for the first time that CTRP12 is highly expressed in the MAT of Crohn’s patients and can decrease the mesenteric and intestinal inflammation of Il‐10^−/− mice, partly through modulating the polarization of macrophages, thereby presenting a novel target for the treatment of CD.

Materials and Methods

Patients

MAT specimens were collected from surgically removed diseased colonic segments from 20 CD patients. Normal specimens from 10 colon cancer patients served as controls. Formalin-fixed and paraffin-embedded specimens are used for histological studies. The study was approved by the Ethics Committee of Nanjing Hospital of Chinese Medicine Affiliated to Nanjing University of Chinese Medicine (Approval No.: KY2020039). All patients provided written informed consent prior to sample collection.

Mice

IL-10^−/− mice on a C57BL/6J background were maintained at the Animal Center of Nanjing University of Chinese Medicine (Nanjing, China). All mice were kept in plastic-bottom wire-lid cages with 25 °C temperature and 12-h light/dark cycle. An article revealed previously [24], specific pathogen-free housing can make 15-week-old IL-10^−/− mice steadily developed colitis, characterized by clinical signs of diarrhea, perianal ulceration, intestinal bleeding and occasional rectal prolapse. Thus, 15-week-old male mice were used for this experiment.

Preparation of Recombinant Mouse CTRP12 Protein

Previously, Ogawa mentioned [22], full-length mouse CTRP12 cDNA was transfected into HEK293F cells by a pCDNA3.1 vector using the Targefect-293F reagent, according to the manufacturer’s instructions. HEK293F cells were then cultured and CTRP12 proteins were collected and purified with a His Ni-NTA resin. The purity of recombinant CTRP12 protein was verified by SDS-PAGE with Coomassie brilliant blue staining, demonstrating > 95% purity (Supplementary Fig. 1).

Drug Administration Protocol and Calculation of the Disease Activity Index

Two groups designed, the CTRP12-treated group with i.p. injections of CTRP12 (0.2 ug/g/d), and the untreated group receiving only PBS. Two groups were observed for 4 weeks [25]. Fifteen-week-old male IL-10^−/− mice were arbitrarily allocated to these two groups. Based on the weight of each mouse every week, drug doses may be adjusted.

We used the numerical system mentioned by Spencer et al. [24] to score the inflammatory bowel disease activity index (DAI) of each IL-10^−/− mouse weekly. In brief, the points of DAI were calculated by the following. Each 1 point was for the subsequent appearance: the index was calculated by scoring 1 point for the appearance of each of the following: ruffled fur, occult fecal blood, rectal prolapse, and soft stool. The DAI is 6-point (0–5) with one more point for diarrhea or severe rectal prolapse > 1 mm.

H&E Staining and Histological Assessment

After 4 weeks, mice were sacrificed under anesthesia. Colonic and mesenteric samples were fixed overnight in 4% paraformaldehyde and embedded in paraffin. Four-μm sections were then stained with hematoxylin and eosin for further histological analysis. Grading of intestinal inflammation was confirmed by a blinded pathologist, as previously described [26]. Summarily, the intestinal inflammation was scored 0–4 as below: 0, no inflammation; 1, modest quantity of infiltrating cells in the lamina propria; 2, penetration of mononuclear cells contributing to mild mucosal hyperplasia and separation of crypts; 3, with enormous inflammatory cells infiltrating, mucosal architecture disrupted, marked mucosal hyperplasia, and loss of goblet cells; and 4, all the above symptoms and ulceration or crypt abscesses. All of sections were scored by 2 independent histologists who were blinded to treatment group.

Immunohistochemical Analysis

Immunohistochemical analysis contained the following steps [13]. Firstly, we deparaffinized and rehydrated 4 μm paraffin sections. Secondly, it took 15 min with EDTA-retrieval buffer (pH = 9) for Antigen retrieval. Thirdly, 4 μm paraffin sections, at room temperature, were blocked with normal goat serum (Beyotime, Haimen, China) for 60 min. Fourthly, we, first, incubated sections at 4 °C overnight with rabbit monoclonal antibody against F4/80 (1:100), and rabbit polyclonal antibody against CTRP12 antibody (1:100). We, then, incubated sections for 60 min at room temperature with a biotinylated goat anti-rabbit IgG immune serum as the secondary antibody, followed by ABC complexes coupled to peroxidase (Beyotime, Haimen, China). Finally, the antigen–antibody complexes were revealed using 3,3′-diaminobenzidine (DAB kit; Beyotime, Haimen, China), and the sections were dehydrated and mounted. Except for utilizing primary antibody, we applied the same procedures to sections of negative controls. Eight sections of adipose tissue were arbitrarily selected for quantification of antibody staining. In the microscopic field, the integrated optical density (IOD) was analyzed under high-power magnification (× 200 objective) with an image analysis software (Image Pro Plus; Media Cybernetics, Bethesda, MD). All the assessments were analyzed by 2 independent observers blinded to clinical information.

Cell Culture, CTRP12 Overexpression and Signaling Pathway Inhibition

Murine macrophage RAW264.7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS). Lentiviral vector expressing CTRP12 (LV-CTRP12) and empty vector (LV-NC) were provided by Genechem (Shanghai, China). Macrophages were transduced with LV-CTRP12 or LV-NC, with [phosphate buffered saline (PBS) serving as vehicle control. Following transduction, cells were stimulated with 100 ng/mL lipopolysaccharide (LPS), or PBS vehicle for the specified time periods. For signal pathway inhibition studies, macrophages were pretreated with 1 μM SB431542 (MedChemExpress, Shanghai, China)) or dimethyl sulfoxide (DMSO) vehicle for 1 h prior to lentiviral transduction with LV-CTRP12 or LV-NC.

Western-Blot Analysis

Proteins were extracted using 1% NoidetP-40, 50 mM Tris·HCl (pH 8.0), 150 mM NaCl, 1 mM NaF, 0.4 mM PMSF, 0.1 mM Na₃VO₄ and proteinase inhibitors (Cell Signalling Technology, MA, USA). Equal amounts of protein lysates were separated by SDS-PAGE and transferred onto PVDF membranes. After blocking, the membranes were incubated at 4 °C overnight with the following primary antibodies: rabbit anti-β-actin (1:200), rabbit anti-Smad2 (1:200), rabbit anti-Smad3 (1:200), rabbit anti-p-Smad2(phosphoS255,1:500), rabbit anti-p-Smad3(phosphoS423 + S425,1:500); and rabbit anti-TGF-beta ReceptorII (1:200). Blots were then incubated with appropriated HRP-labeled secondary antibodies (Thermo Fisher Scientific, Rockford, USA). Band intensities using Western bolt analysis were quantified by densitometric analysis using ImageJ software (version 1.47v; National Institutes of Health, USA). The grey value of each protein band was calculated using the integrated density value (mean grey value × area). Activation of signaling was quantified as the ratio of phosphorylated and total protein densitometry measurements.

Quantitative Real-Time PCR Analysis

We can use quantitative real-time PCR (qRT-PCR) to determine the quantization of the gene expression of TNF-α, IL-1β, and IL-6. In brief, total RNA was insulated with RNAiso (TaKaRa, Japan) through the manufacturer’s instructions, and reverse transcription was executed with the first strand cDNA synthesis kit (TaKaRa, Japan). Based on the 7300 Fast Real-Time PCR System (Applied Biosystems, Vantaa, Finland), SYBR green PCR Master Mix and real-time PCR reacted (Applied Biosystems, Foster City, CA, USA) for thermal cycling and real-time fluorescence measurements in a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems, Vantaa, Finland). Each sample was examined in triplicate for each PCR, and both negative and positive controls were involved in all experiments. Expression of target genes was normalized to the housekeeping gene GAPDH. The relative changes of RNA levels were determined according to the ΔΔCT method. The primers for RT-PCR used in this study are listed in Table 1.

Table 1.

Primer sequences

Ctrp12	Forward	CCCACATGACATGGCTGAAC
	Reverse	GCAGCTCCTGAAACTCGTGAAG
Tnf-α	Forward	GACGTGGAACTGGCAGAAGAG
	Reverse	TTGGTGGTTTGTGAGTGTGAG
Il-1β	Forward	GAAATGCCACCTTTTGACAGTG
	Reverse	TGGATGCTCTCATCAGGACAG
Il-6	Forward	CCAAGAGGTGAGTGCTTCCC
	Reverse	CTGTTGTTCAGACTCTCTCCCT
Mcp-1	Forward	TCAGCCAGATGCAATCAATG
	Reverse	ATGGTCTTGAAGATCACAGC
Arg-1	Forward	AGACCACAGTCTGGCAGTTG
	Reverse	CCACCCAAATGACACATAGG
Ym-1	Forward	CATGAGCAAGACTTGCGTGAC
	Reverse	GGTCCAAACTTCCATCCTCCA
Mrc-1	Forward	TGATTACGAGCAGTGGAAGC
	Reverse	ACTTCCGAGCCGTTGTTCT
Clec10a	Forward	CTCTGGAGAGCACAGTGGAG
	Reverse	ACTTCCGAGCCGTTGTTCT
Gapdh	Forward	AGGTCGGTGTGAACGGATTTG
	Reverse	TGTAGACCATGTAGTTGAGGTCA

Enzyme-Linked Immunosorbent Assay

Tumor necrosis factor (TNF)-α, IL-1β, IL-6, MCP-1, Arg-1, Ym-1, Mrc-1, Clec10a levels were measured using commercial ELISA kits (R&D Systems) according to the manufacturer’s instructions.

Immunofluorescence

Immunofluorescence was used to evaluate the intestinal mucosal integrity. Colonic segments were immediately harvested, rinsed with PBS, embedded in mounting medium, and stored at − 80 °C. Frozen sections (10 μm) were cut and mounted on slides, then blocked with 5% bovine serum albumin plus 5% newborn bovine serum in PBS for 30 min at room temperature to reduce nonspecific binding. Sections were incubated overnight at 4 °C with rabbit polyclonal antibodies against occludin or ZO-1 (both from Abcam, Cambridge, MA, UK), followed by FITC‐conjugated secondary antibodies. Nuclei were counterstained with DAPI. Negative control slides were processed identically but without primary antibodies. Images were acquired using a Leica confocal scanning (Leica Microsystems, Heidelberg GmbH, Mannheim, Germany).

Statistical Analysis

The Statistical Package for the Social Sciences version 23.0 (SPSS Inc., Chicago, USA) was applied for data analysis in this article. This article used mean ± standard deviation to describe normal distribution data. Unpaired t test was employed to test parametric continuous variables. The chi-square test contributed to analyzing the binary and categorical data for the contingency tables. Fisher’s exact test was performed for cases ≤ 5. We rejected H₀ if p-value is less than 0.05.

Results

CTRP12 Is Highly Expressed in the Mesenteric Adipose Tissue of CD Patients

CTRP12 was expressed in both human and mouse adipocytes with obesity [18]. To identify whether CTRP12 was expressed in the MAT of CD patients, we utilized immunohistochemical analysis. Our data revealed remarkably higher CTRP12 expression in the MAT of CD patients compared to that of control (Fig. 1A, B). Similar results were evident in the CTRP12 mRNA assay (Fig. 1C).

Fig. 1.

CTRP12 was highly expressed in the mesenteric adipose tissue of patients with Crohn’s disease. A and B Immunohistochemical staining with an antibody that recognized CTRP12 was performed on the MAT of control and CD patients (A). The quantitative analysis in B showed a significantly higher expression of CTRP12 in the MAT of Crohn’s patients (n = 24) compared with that of controls (n = 12). Data are presented as the relative IOD per area ± SD. The relative mRNA expression of CTRP12 assessed via qRCR was also revealed higher in the MAT of CD patients compared with that of controls. ^▼p < 0.05 (B, C). CD Crohn’s disease, IOD integrated optical density

Systemic Delivery of CTRP12 Ameliorated Intestinal Inflammation and Restored Mucosal Barrier Structure of Il‐10^−/− Mice

To determine whether CTRP12 affected the disease course of CD, we treated Il‐10^−/− mice with established colitis and observed positive results. CTRP12-teated mice displayed improved clinical signs of colitis, evidenced by a significant decrease in the DAI score, since the third week post-drug administration, compared to untreated Il‐10^−/− mice (Fig. 2C). Additionally, the mean histological inflammatory score for the colonic tissue from the CTRP12-treated mice was remarkably lower than that from untreated Il‐10^−/− mice (Fig. 2B). We found CTRP12 reduced inflammatory cells infiltration and restored the histological appearance of mucosa, as observed in the representative pictures of H&E stains. Furthermore, mRNA levels of inflammatory cytokines TNF-α and IL-1β in the colonic tissue significantly decreased in CTRP12-treated mice. Disruption of the intestinal mucosal barrier represents a major pathological feature of CD, with tight junction (TJ) proteins maintaining barrier integrity. To evaluate the therapeutic effects on barrier structure, we also performed immunofluorescence analysis to examine the expression of key TJ proteins. Our results demonstrated that CTRP12 treatment significantly upregulated the expression of both occludin and ZO-1 in Il-10^−/− mice compared to untreated controls (Fig. 2F, G). Consequently, our data found the protective role of CTRP12 in the chronic colitis of Il‐10^−/− mice.

Fig. 2.

Systemic delivery of CTRP12 ameliorated experimental colitis. Systemic delivery of CTRP12 significantly ameliorated chronic colitis. Representative histological images of colonic sections from two groups showed remarkably decreased mucosal inflammation in CTRP12-treated mice (A). Histological inflammatory score (B) and clinical symptoms scored by the DAI (C) and were both obviously ameliorated in IL-10^−/−mice treated with CTRP12. Compared with that of untreated IL-10^−/− mice, the relative mRNA expression of Tnf-α (D), Il-1β (E) in the colonic tissue assessed via qRCR were significantly decreased in mice treated with CTRP12. Immunoflurescence showed restored intestinal mucosal structure with increased tight junction (TJ) protein (purple, occludin and Zo‐1), and DAPI staining (blue) and merged TJ protein are also presented (F, G). Magnified images clearly reveal the expression of TJ protein in intestinal epithelial cells. All data are presented as the means ± SD. Scale bar: 200 μm; ▼p < 0.05 (B–F); Tnf-α tumor necrosis factor-α, Il-1β interleukin-1β

Systemic Delivery of CTRP12 Ameliorate Mesenteric Inflammation of Il‐10^−/− Mice

Mesenteric dysfunction of CD has been identified and characterized by reduced adipocyte size and aggravated inflammation [11]. We sought to determine whether CTRP12 affected the MAT inflammation. Histologic results confirmed substantial inflammatory infiltration in the MAT of Il‐10^−/− mice (Fig. 3A). However, compared to untreated Il‐10^−/− mice, those treated with CTRP12 displayed a significantly increased mean diameter of adipocyte (Fig. 3B), indicating restored MAT morphology. Macrophages are important inflammatory cells in adipose tissue. Previous studies suggested more macrophage infiltrations in the MAT of Il‐10^−/− mice, suggesting sustaining inflammation like CD patients. Utilizing F4/80, a specific marker of macrophages, we identified reduced F4/80-positive macrophage infiltration in the MAT of CTRP12-treated Il‐10^−/− mice compared to untreated Il‐10^−/− mice (Fig. 3C, D). F4/80 protein in the MAT of both groups showed a similar trend (Fig. 3E).

Fig. 3.

Systemic delivery of CTRP12 ameliorated mesenteric inflammation of Il‐10^−/− mice. MAT inflammation was assessed histologically. H&E stain results confirmed massive inflammatory infiltration in the MAT of Il‐10^−/− mice. But compared with untreated Il‐10^−/− mice, CTRP12-treated Il‐10^−/− mice had a significant less inflammatory infiltration (A) and increased mean diameter of adipocyte (B) in the MAT. F4/80-positive macrophages in the MAT of Il‐10^−/− mice treated with CTRP12 were decreased compared with un-treated Il‐10^−/− mice. Expression of mesenteric F4/80 protein was examined using Western blotting and quantified with β-actin. Experiments were performed as triplicates. Data are presented as the means ± SD (D). ^▼p < 0.05

CTRP12 Modulates Macrophage Polarization in the MAT of Il‐10^−/− Mice

Given reports of CTRP12 modulating macrophage polarization, we investigated its effect on macrophage polarization in the MAT of Il‐10^−/− mice. Our results showed that CTRP12 treatment decreased the gene expression and protein levels of classical (M1) macrophage markers (TNF-α, IL-1β, IL-6 and MCP-1) (Fig. 4A, C). Inversely, alternative (M2) macrophages markers (Arg-1, Ym-1, Mrc-1, Clec10a) were notably increased in CTRP-treated Il‐10^−/− mice compared to untreated mice (Fig. 4B, D). The results illuminate a potential modulation of CTRP12 on the polarization of macrophages.

Fig. 4.

Effects of CTRP12 on the polarization of macrophage in the MAT of Il‐10^−/− mice. After treated with CTRP12, the mRNA and protein expression of M1 cytokines TNF-α, IL-1β, IL-6, MCP-1 (A, C) and M2 cytokines Arg-1, Ym-1, Mrc-1, Clec10a (B, D) in each groups was assayed using qRT-PCR and ELISA, respectively. Data are presented as the means ± SD (D) from three independent experiments. ^▼p < 0.05

Role of CTRP12 Is Related to the TGFβRII/Smad Signaling Pathway

Given that our study presented a protective role of CTRP12 in colitis of Il‐10^−/− mice, potentially via the modulation of MAT macrophage polarization, we sought to further explore the precise mechanism. While CTRP12 has been reported to suppress the proinflammatory response of macrophages in vitro study through the TGFβRII/Smad signaling pathway, no evidence has focused on the MAT inflammation of Il‐10^−/− mice. As expected, TGFβRII expression was higher in the MAT of CTRP12-treated Il‐10^−/− mice (Fig. 5A, B). CTRP12 treatment also up-regulated the phosphorylation of Smad2 and Smad3 in the MAT of Il‐10^−/− mice, suggesting the activation of TGFβRII/Smad signaling pathway (Fig. 5A, C, D).

Fig. 5.

The protective role CTRP12 was related to the activation of the TGFβRII/Smad signaling pathway. CTRP12-treated IL-10^−/− mice showed higher expression of TGFβRII and higher phosphorylation level of Smad2 and Smad3 in the mesenteric tissue than untreated group (A). Experiments were performed as triplicates. The quantification of the relative levels of TGFβRII, p-Smad2 and t-Smad2, p-Smad3 and t-Smad3 in the three groups is shown (B, C, D). Data are presented as the means ± SD (D). ^▼p < 0.05

CTRP12 Modulates Macrophage Polarization via TGFβRII/Smad Signaling In Vitro

To investigate the effect of CTRP12 on macrophage polarization, we transduced murine RAW264.7 macrophages with LV-CTRP12. In LPS-stimulated macrophages, CTRP12 overexpression downregulated M1 markers (iNOS and IL-6) while upregulating M2 markers (Arg-1 and IL-10) at the mRNA level (Fig. 6A–D). Western-blot analysis confirmed these findings, showing decreased TNF-α and iNOS expression alongside increased CD206 and Arg-1 expression compared to LV-NC controls (Fig. 6E–G, K, L). Additionally, CTRP12 overexpression enhanced TGFRII expression and promoted Smad2/3 phosphorylation (Fig. 6E, I, J). Importantly, these effects were reversed by SB-431542, a specific TGFRII/Smad signalling inhibitor, confirming the involvement of this pathway.

Fig. 6.

CTRP12 modulates macrophage polarization in vitro. Murine RAW264.7 macrophages were transduced with LV-CTRP12 or LV-NC and stimulated with LPS. A–D mRNA expression levels of M1 markers (iNOS, IL-6) and M2 markers (Arg-1, IL-10) measured by qRT-PCR. E Representative Western-blot images and F–L quantification showing relative protein expression of TNF-α, iNOS, CD206, ARG-1, TGFRII, p-Smad2, p-Smad3, and total Smad2/3. Data are presented as mean ± SEM. n = 3 independent experiments. *Significance between LPS + CTRP12 and LPS. ^#Significance between LPS + CTRP12 + SB and LPS + CTRP12. *p < 0.05, **p < 0.01, ***p < 0.001. ^#p < 0.05, ^##p < 0.01, ^###p < 0.001. NS nonsense

Discussion

Our study identified a novel adipokine, CTRP12, that was highly expressed in the MAT of CD patients, and for the first time, we reported that CTRP12 could ameliorate chronic colitis of Il‐10^−/− mice through modulating the polarization of mesenteric macrophages, probably by activating TGFbRII/Smad signaling pathway (briefly depicted in Fig. 7). To the best of our knowledge, this is the first study reporting an association between CTRP12 and CD.

Fig. 7.

Graphical summary. Fat wrapping from hypertrophic mesenteric fat of CD characterized by abnormal adipokines and predominant M1 macrophages. Newly identified adipokine CTRP12 was highly expressed in the MAT of CD patients and may ameliorate Crohn’s colitis through modulating adipose tissue macrophages into M2 polarization and decreasing mesenteric inflammation possibly by activation of TGFβRII/Smad signaling pathway

Considering the multifunctional role of the mesentery, it’s no longer a bystander in CD [27]. A recent study also provided crucial evidence that in humans with CD, the phenomenon known as ‘‘creeping fat’’ is a protective response whereby mesenteric adipose tissue migrates to sites of gut barrier, averting systemic dissemination of harmful bacterial antigens penetrating the barrier from the gut lumen [12]. Our previous investigations reveal that CD-like MAT lesions can be treated, contributing to colitis amelioration [14].

Aberrant adipokines predominantly secreted by adipose tissue reveal to be the hallmark of diseases linked to the mesentery like CD. Established adipokines like adiponectin and leptin have garnered attention for their multifunctional role in inflammation and metabolism [28]. Prior research on several adipokines suggest these upregulated adipokines from CD’s MAT may exhibit potential anti-inflammatory effects in experimental colitis and have a crosstalk with other tissues. For instance, apelin may promote the lymphangiogensis and lymphatic drainage function to decrease the intestinal inflammation [13]. Our presented data accentuates the correlation between adipokines and the macrophages. Notably, Kredel et al. reported that adipokines from microenvironment within the creeping fat in CD patients modulate local macrophage towards the M2 subtype [29], proposing creeping fat as a protective enveloping barrier mitigating intestinal inflammation.

While CTRP12 is recognized as an adipokine, studies have focused on its effects on glucose metabolism, liquid metabolism [30], and cardiovascular diseases. CTRP12 was abundantly present in the adipose tissue of obese subjects. Research has indicated lower serum CTRP12 levels in obesity-osteoarthritis (OA) patients compared to non-OA-indiduals [31]. Findings on coronary artery disease (CAD) suggest an inverse relationship between CTRP12 level and CAD severity [32]. Furthermore CTRP12 overexpression significantly reduces myocardial ischemia–reperfusion injury-induced cell injury [21] and ameliorated atherosclerosis by promoting cholesterol efflux and inhibiting inflammatory response [23]. Our study was the first to report that systemic CTRP12 is highly expressed in the MAT of CD and emphasized its contribution to inhibit inflammation in a chronic colitis model. Current results indicate that CTRP12 could ameliorate clinical signs and intestinal inflammation in Il-10^−/− mice. Treatment with CTRP12 in Il-10^−/− mice led to a significant decrease in inflammatory cytokine, including IFN-γ, TNF-α and IL-6, demonstrating the anti-inflammatory role of CTRP12.

Previous studies have shown that CTRP12 reduces inflammation in the adipose tissue of obese mice. Consequently, we examined CD-like mesenteric lesions after treating with CTRP12. In our previous study, we observed that adipocyte size in the MAT of Il-10^−/− mice was smaller and had a higher expression of proinflammatory mediators compared to wide-type mice, which was consistent with those in the MAT of CD patients. Additionally, our current study revealed that administering CTRP12 resulted in increased adipocyte diameter and reduced macrophage infiltration. This result was encouraging because it showed the potential role of CTRP12 in treating the MAT. Considering the concurrent change of macrophage in the MAT of Il-10^−/− mice, our focus shifted towards mesenteric macrophages.

Macrophages constitute a significant portion of resident immune cells in adipose tissue. Under inflammatory conditions, macrophages can polarize into two main phenotypes: classically activated M1 macrophages and alternatively activated M2 macrophages. M1 macrophages secrete proinflammatory cytokines while M2 macrophages help resolve inflammation and promote tissue repair. Earlier studies suggested differential polarization of ATM in obese patients, largely towards to M1 subtype, contributing to a proinflammatory environment [29]. There’s also significant macrophages infiltration in the MAT of CD, characterized by heightened expression of M1 cytokines such as IL-1β, IL-6, TNF-α and MCP-1. This contributes to immune dysfunction of the MAT, potentially exacerbating CD’s intestinal inflammation. Moreover, in a study that suppressing the switch of M1/M2 of macrophages may increase the colonic inflammation of DSS-induced colitis, while inducing macrophages towards M2 subtype may protect the chronic colitis [17]. Importantly, studies have shown that macrophages play a pivotal role in IBD pathogenesis and may be a potential therapeutic target [16]. In our study, we further detected macrophage subtypes. As expected, we observed an increase in M2 macrophages and a decrease in M1 macrophages in the CTRP12-treated Il-10^−/− mice. Notably, prior research has identified CTRP12’s anti-inflammatory effect, particularly in promoting M2 macrophage polarization in atherosclerosis models [23]. These findings led us to delve deeper into potential mechanisms. We identified elevated expression levels of TGFβRII, p-Smad2 and p-Smad3 in CTRP12-treated mice and LV-CTRP12 transduced macrophages. Since TGFβRII/Smad signalings participate in various processes of cell differentiation and proliferation, and recent studies have linked the activation of TGFβRII/Smad signaling with M2 macrophage polarization [33]. It’s plausible that CTRP12 alleviates chronic colitis, at least in part, by supressing inflammatory signal cascades in mesenteric macrophages.

Nevertheless, our study has its limitations. While we identified a high expression of CTRP12 in the MAT of CD patients, a deeper investigation into systemic CTRP12 levels is warranted. While we have focused on the impact of CTRP12 treatment on the mesenteric macrophages, its influence on intestinal macrophages remains to be elucidated. Although ample evidence supports the role of TGFβRII/Smad signaling in macrophage polarization and our research underscores its protective role on colitis, potential adverse effects of TGFβRII/Smad signaling on intestinal fibrosis cannot be overlooked. Additionally, only male mice were used in this study to reduce variability associated with estrous cycle-dependent immune fluctuations; future studies should investigate whether CTRP12 exerts similar effects in female mice. Finally, the Il-10^−/− mouse model, while exhibiting spontaneous chronic colitis with mesenteric adipose tissue alterations resembling those observed in CD patients, does not fully replicate all CD-specific features. Future studies using additional models such as TNBS-induced colitis would further validate our findings.

In conclusion, our study demonstrates a new role for CTRP12 in improving experimental colitis and uncoveres a novel mechanism facilitating the crosstalk between adipose tissue and macrophages in the MAT of CD. This research enhances our understanding of the correlation between adipokines and CD pathogenesis.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

CD

Crohn’s disease

IBD

Inflammatory bowel disease

MAT

Mesenteric adipose tissue

IL-10^−/−

IL-10 deficient

CTRP

C1q tumor necrosis factor-related protein

IOD

Integrated optical density

IFN-γ

Interferon gamma

TNF-α

Tumor necrosis factor-α

IL-1β

Interleukin-1β

IL-6

Interleukin-6

MCP-1

Monocyte chemoattractant protein-1

Arg-1

Arginase 1

Mrc-1

Macrophage mannose recepter1

Clec10a

C-type lectin domain family 10 member A

TGFβ

Transforming growth factor-β

Author Contributions

Yuanyuan Ge and Meng Li, two authors contributed equally to this work; Yuanyuan Ge, Meng Li and Kang Ding contributed to study concept and design, acquisition, analysis, and interpretation of data, and drafting of the manuscript; Dongliang Guo and Tianyi Li contributed to animal experiment and data acquisition. Miao Yu contributed to histological recognition and analysis. Qiang Leng contributed to interpretation of data and manuscript review; All authors read and approved the final manuscript.

Funding

This work was supported by funding from National Natural Science Foundation of China (Grant82200579) and Project of National Clinical Research Base of Traditional Chinese Medicine in Jiangsu Province, China (JD2023SZX10).

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval

This study was approved by the Ethics Committee of Nanjing Hospital of Chinese Medicine Affiliated to Nanjing University of Chinese Medicine (KY2020039). Written informed consent for the use of removed surgical specimen was obtained from each patient and all experiments conform to the Declaration of Helsinki. All animal protocols were approved in advance by the Institutional Ethics Committee of Nanjing Hospital of Chinese Medicine Affiliated to Nanjing University of Chinese Medicine (KY2021072).