Design, Synthesis, and Antibiofilm Efficacy of Ag/Se‐Doped CuO–Chitosan Nanocomposites as Potent Antifungal Agents Against Candida albicans

ABSTRACT

In this study, we report the fabrication, characterization, and antimicrobial evaluation of copper (II) oxide CuO (TS1) and (CuO)‐based nanocomposites incorporating chitosan (Ch) (TS2), silver (Ag) (Ch‐CuO‐Ag; TS3), and selenium (Se) (Ch‐CuO‐Se; TS4) nanoparticles. X‐ray diffraction (XRD) confirmed the monoclinic crystalline structure of CuO with an average crystallite size of ∼12 nm, and successful integration of Ch, Ag, and Se without phase impurities. FTIR analysis revealed strong interactions between CuO and Ch functional groups, evidenced by spectral shifts and peak broadening, suggesting hydrogen bonding and structural modifications. Morphological analysis via electron microscopy showed a transition from aggregated nanosheets to homogeneous nanospheres upon doping with Ag and Se. Composite TS1 (CuO) exhibited superior antimicrobial activity, surpassing the standard drugs imipenem and fluconazole (FLZ) in terms of inhibition zones and minimum inhibitory concentrations (MICs). Sub‐MIC concentrations of the composites did not affect the growth of Candida albicans, validating their use in biofilm inhibition assays. Notably, TS1 and TS4 (Ch─CuO─Se) significantly enhanced the efficacy of FLZ, reducing its MIC and MBEC values by up to 8‐fold. Biofilm inhibition reached 82.2% with TS1‐FLZ synergy. Gene expression analysis revealed marked downregulation of biofilm‐associated virulence genes (SAP2, SAP6, PLB1, PLB2, LIP4, and LIP5).

Composite TS1 (CuO) exhibited superior antimicrobial activity, surpassing the standard drugs imipenem and fluconazole in terms of inhibition zones and MICs. TS1 and TS4 (Ch─CuO─Se) significantly enhanced the efficacy of fluconazole, reducing its MIC and MBEC values by up to 8‐fold. Biofilm inhibition reached 82.2% with TS1‐fluconazole synergy.

1. Introduction

Microbial infections are responsible for several diseases and health disorders [1, 2, 3]. Although the availability of effective treatments such as antibiotics and antimicrobial drugs are available, the emergence of novel infectious illnesses and the development of antimicrobial resistance remain major concerns and global health challenges [4, 5, 6]. Within this context, polymer‐metal/metal oxide nanocomposites represent a novel class of hybrid materials with the potential to enhance their overall properties, particularly their antimicrobial activities substantially [7, 8].

Nanomaterials, including nanoparticles, nanocrystals, and nanocomposites, become pivotal in driving innovation across multiple sectors [9]. Among them, metal oxide nanoparticles stand out for their remarkable adaptability, finding applications in biomedical applications, food safety, energy storage, drug delivery, and biosensing technologies [10, 11]. Their nanoscale dimensions confer unique chemical and physical characteristics, including a high surface area relative to volume and tunable reactivity, which amplify their performance [11, 12, 13]. These materials can be prepared through chemical, physical, or environmentally friendly methods [14]. Notably, their antimicrobial potential has garnered significant attention, as they can effectively disrupt microbial structures and inhibit vital cellular processes, offering promising solutions for infection control, wound healing, and disease prevention [15].

Copper(II)oxide (CuO) belongs to the class of p‐type semiconductors, crystallizes in a monoclinic structure, and has a narrow bandgap (∼1.7 eV). It has also demonstrated potent antimicrobial activity [15, 16]. Its primary mechanism involves the liberation of reactive oxygen species (ROS), which compromise bacterial membrane integrity and damage subcellular components, including DNA and proteins [15, 17, 18]. While CuO nanoparticles are well‐established in antimicrobial research, their synergistic combination with other agents, particularly silver (Ag), selenium (Se), and chitosan (Ch), remains relatively unexplored, especially in the context of biofilm inhibition [19, 20].

Ag, a noble metal known for its broad‐spectrum antimicrobial properties, enhances the efficacy of metal oxide systems when used as a dopant [21]. It disrupts microbial membranes and promotes ROS generation, making it effective against bacteria, fungi, and viruses [22]. By manipulating particle size, shape, and distribution, Ag's antimicrobial performance can be further optimized [23]. Its integration with CuO not only boosts antimicrobial potency but also expands the material's biomedical applications [24, 25].

Selenium is a micronutrient essential for several bioregulations required by the human immune system for protection from microbial infection and oxidative stress [26, 27, 28]. It exists in most organisms as a component of selenoproteins and selenoenzymes [29, 30]. Significantly, the lack of Se is involved in the progression of viral and bacterial infections, as well as several autoimmune diseases [31]. On the other hand, Se supplementation improves the body's immunity by stimulating antioxidant activities and modulating the redox status [30]. Se nanoparticles (Se‐NPs) demonstrate diverse biological properties, such as antioxidant, antimicrobial, antiviral, anticancer, and anti‐inflammatory activities [12, 32, 33]. Their low toxicity and multifunctionality make them attractive candidates for medical diagnostics and therapeutic development [33, 34]. Interestingly, the incorporation of Se‐NPs into nanocomposites is usually associated with enhanced biomedical applications [31, 32]. The latter is linked to their abilities to generate ROS, which in turn cause microbial membrane disruption and damage to microbial biofilm, thus enhancing the overall antimicrobial efficacy [35, 36]. Notably, mounting reports have shown that Se‐NPs have lower toxicity than the classical metallic nanoparticles, making them a better alternative for biomedical applications in the context of safety [12, 33, 35, 36]. When integrated into the backbone of polymers embedded with metal/metal oxide nanoparticles, Se improves their overall synergistic effect and fosters enhanced biocompatibility, composite stability, and improved antimicrobial activity [32, 37, 38]. These properties make Se‐based nanocomposites particularly promising for overcoming drug resistance.

Chitosan is a biopolymer derived from chitin through partial deacetylation, which offers excellent biocompatibility, low toxicity, and biodegradability [39]. These attributes, along with its reactive amino and hydroxyl groups, make Ch an effective stabilizer and binder in nanoparticle synthesis [40]. Its versatility has led to widespread use in nanotechnology, particularly in the development of hybrid nanomaterials [41, 42]. Despite extensive research on CuO and Ag nanoparticles, there have been limited studies investigating their combined use with Se and Ch for targeted antifungal strategies.

In 2025, Alelah et al. reported the eco‐friendly biosynthesis of a Ch/CuO nanoparticle nanocomposite mediated by grape seed extract, which demonstrated promising antioxidant activity and good antibacterial potency against Escherichia coli and Streptococcus mutans, with inhibition zones of 9 and 14 mm, respectively [43]. In the same year, Hashem and colleagues reported the synthesis of a novel Gum Arabic‐based Ag–CuO (GA@Ag‐CuO) nanocomposite as polydisperse crystalline nanoparticles with a mean diameter of 25.53 ± 1.4 nm. The latter showed potent antibacterial activity against S. epidermis, Staphylococcus aureus, L. plantarum, and S. typhimurium (MICs 15.6–125 µg/mL), antifungal activity against Candida albicans and C. neoformans (MICs 62.5 and 15.62 µg/mL, respectively), and anticancer efficacy toward Hep‐G2 and MCF‐7 cell lines (IC₅₀ = 59.5 and 26.11 µg/mL, respectively). Similarly, Umoren and coworkers used olive leaf extract as the reducing agent for the green synthesis of Ch/CuO nanocomposites, providing stable spherical nanoparticles (3.5–6.0 nm) with remarkable antibacterial activity, that is, inhibition zones ranging from 6–24 mm against both Gram‐positive (B. cereus, S. haemolytica, and M. luteus) and Gram‐negative (E. coli, Pseudomonas aeruginosa, Klebsiella sp.) bacteria [44].

P. aeruginosa, Klebsiella pneumoniae, S. aureus, and C. albicans are representative microorganisms of clinically significant infections that are recognized for their competence to form strong biofilms [45, 46]. The Gram‐negative bacteria P. aeruginosa and K. pneumoniae are documented as high biofilm‐forming bacteria that are considered multidrug‐resistant pathogens, in addition to their clinical significance in hospital‐acquired infections [47]. The Gram‐positive bacterium S. aureus is a well‐established biofilm producer frequently implicated in device‐related, skin, soft tissue, and systemic infections [47, 48, 49].

C. albicans is a commensal organism that is usually a harmless member of the human microbiota, but when immunity is weakened or microbial balance is disrupted, it becomes pathogenic, leading to infections in various body systems [50]. Biofilms are sessile microorganisms enclosed within an extracellular polymeric matrix that adheres to biotic or abiotic surfaces [51]. Biofilms contribute to the persistence of chronic infections by protecting microbial communities from antibiotics and the immune system, therefore intensifying the challenge of antibiotic resistance [52].

Biofilms formed by C. albicans present a major clinical challenge due to their resistance to conventional antifungal agents and their role in chronic infections [53]. These biofilms are regulated by virulence genes such as secreted aspartyl proteases (SAPs), phospholipases (PLBs), and lipases (LIPs), which facilitate adhesion, invasion, and immune evasion [53]. Recent reports have emphasized the importance of targeting biofilm‐associated virulence factors to enhance antifungal efficacy and reduce resistance [1]. Nanocomposites capable of modulating gene expression and synergizing with existing antifungal drugs offer a promising strategy for overcoming biofilm‐related infections.

While CuO and Ag nanoparticles are widely studied, their synergistic combination with Se and Ch for antifungal applications has not been previously explored. This study introduces a novel ternary nanocomposite framework‐simultaneously combining CuO, Ch, and M (Ag/Se)‐explicitly engineered to target C. albicans biofilms. Compounding this structural novelty, the composites were fabricated using an ultrasound‐assisted green synthesis procedure. Compared to traditional stirring or hydrothermal‐only protocols, this sustainable method ensures superior reproducibility, high product purity, and precisely controlled morphology.

In this study, we designed, fabricated, and characterized CuO nanoparticles and Ch/CuO‐M (Ag, Se) nanocomposites using an ultrasound‐assisted method. Their structural and morphological characteristics were thoroughly examined, alongside their antimicrobial activity. The study also assessed their synergistic interaction with fluconazole (FLZ) and their influence on the expression of key virulence genes in C. albicans biofilms, highlighting their potential as advanced antifungal agents.

2. Materials and Methods

2.1. Chemistry

2.1.1. Synthesis of Pure CuO and Its Hybrid Nanocomposite Samples

The synthesis of pure CuO (TS1) and its hybrid nanocomposites (TS3 and TS4), illustrated in Figure 1, was carried out using a systematic approach to ensure uniformity and optimal properties. The process began with the preparation of CuO as the base material through the Ultrasound‐assisted synthesis method, followed by the incorporation of additional components to create hybrid nanocomposites. These composites were synthesized by combining CuO with Ch and doping with metal Ag and Se.

FIGURE 1.

Schematic representation of the synthesis process for pure CuO and its hybrid nanocomposites.

The synthesis of pure CuO began by dissolving 0.5 g of copper (II)acetate monohydrate and 0.5 g of PEG 6000 in 20 mL of deionized H₂O, stirring the solution in air for 10 min. Subsequently, 0.8 g of sodium hydroxide was dissolved in 10 mL of deionized H₂O and added to the initial solution. The mixture was vigorously stirred for 30 min before being subjected to ultrasound treatment in a bath (LUC 405, Daihan Labtech, Co. Ltd.; 60 kHz, 350 W) for 3 h. The reaction product was then separated by centrifugation, thoroughly washed with distilled H₂O, and dried in an oven at 100°C for 3 h. Finally, the material was calcined at 500°C for 3 h to produce CuO.

For the synthesis of the Ch/CuO polymer nanocomposite, 1 g of Ch was dissolved in 50 mL of deionized H₂O with the addition of 2.5 mL of 5% acetic acid. The solution was stirred continuously for 4 h until a homogeneous, viscous solution was obtained. Afterward, 0.3 g of CuO was added to the Ch solution, and the mixture was stirred for 24 h. The resulting nanocomposite was neutralized with 100 mL of 2% NaOH solution, separated by centrifugation, washed several times with distilled H₂O, and dried in an oven at 100°C for 3 h.

The synthesis of the Ch/CuO/Ag and Ch/CuO/Se polymer nanocomposites followed the same procedure as the Ch/CuO composite. However, during this process, 0.3 g of CuO and 0.1 g of Ag were added to the solution to produce Ch─CuO─Ag nanocomposites, and 0.3 g of CuO and 0.1 g of Se were used to synthesize Ch─CuO─Se nanocomposites, respectively.

2.1.2. Characterization

Powder x‐ray diffraction (PXRD) analysis was performed at room temperature using a PANalytical X'Pert PRO diffractometer operating at 45 kV and 40 mA, with CuKα radiation (λ = 1.5418 Å). The scans were conducted at a speed of 1.0° per minute, with a step size of 0.01° across the 2θ range. Surface morphology was investigated using a field emission scanning electron microscope (FEI Quanta 600), operating at an accelerating voltage of 30 kV. Infrared (IR) spectroscopy measurements were performed using a Bruker Alpha ATR spectrometer, equipped with a diamond crystal for attenuated total reflection (ATR). The solid samples were directly pressed onto the crystal surface for analysis.

2.2. Biological Evaluation

2.2.1. Materials

Copper(II) acetate monohydrate (99%) and Ch were obtained from Merck. Polyethylene glycol, acetic acid (99%), Ag nanoparticles (99%), and sodium hydroxide (99.9%) were supplied by Sigma–Aldrich, whereas Se (99+%) was purchased from Alfa Aesar. FLZ was provided by the Egyptian International Pharmaceutical Industries Company (EPICO, Egypt), and dimethyl sulfoxide (DMSO) was acquired from Chem‐lab NV (Industriezone “De Arend” 2, B‐8210 Zedelgem, Belgium). The bacteriological media—Mueller–Hinton Broth (MHB), Sabouraud Dextrose Broth (SDB), Sabouraud Dextrose Agar (SDA), Tryptone Soya Broth (TSB), and Tryptone Soya Agar (TSA)—were all products of Oxoid (United Kingdom). Crystal violet was sourced from Avondale Laboratories (Oxon, England), while methanol and glacial acetic acid were supplied by El‐Nasr Pharmaceutical Chemicals Company (Egypt).

The reference strains used in this work—P. aeruginosa (PAO1), K. pneumoniae ATCC 700603, S. aureus ATCC 6538, and C. albicans ATCC 10251—were kindly supplied by the Department of Microbiology and Immunology, Faculty of Pharmacy, Zagazig University.

RRID is not applicable in this study, as no mammalian or established cell lines were used. The study utilized microbial strains only.

2.2.2. Preliminary Antimicrobial Screening

The in vitro antimicrobial potential of the composites was first screened by the agar well diffusion technique against a panel of reference organisms: the Gram‐negative P. aeruginosa (PAO1) and K. pneumoniae ATCC 700603, the Gram‐positive S. aureus ATCC 6538, and the yeast C. albicans ATCC 10251 [54]. Each composite was loaded at 200 µg/mL into wells cut in Mueller–Hinton Agar (MHA) plates that had been pre‐seeded with the relevant test organism at a density of 1.5 × 10⁸ CFU/mL. The bacterial plates were incubated at 37°C for 24 h, while the C. albicans plates were kept at 25°C for 48 h. Activity was recorded as the diameter of the growth‐inhibition zone around each well. Imipenem and FLZ were included as the positive controls for the bacterial strains and for C. albicans, respectively [55].

2.2.3. Determination of Minimum Inhibitory Concentrations (MICs)

The MICs of FLZ and of the tested composites were established by agar dilution, carried out in line with the recommendations of the Clinical and Laboratory Standards Institute [56]. Graded concentrations of each composite were blended into molten SDA equilibrated at 45°C–50°C, mixed thoroughly, and dispensed into Petri dishes that were left to set at room temperature. A C. albicans inoculum was raised from an overnight SDB culture grown at 25°C for 24 h and adjusted in sterile saline to match the turbidity of a 0.5 McFarland standard, corresponding to approximately 1–5 × 10⁶ CFU/mL. This suspension was further diluted 1:10 in SDB, and 1 µL was spotted onto the surface of the SDA plates containing the various composite dilutions, delivering a final inoculum of about 10³ CFU per spot. Plates prepared without any composite served as growth controls. Following incubation at 37°C for 16–20 h, the MIC was read as the lowest composite concentration that completely suppressed visible fungal growth.

2.2.4. Growth of C. albicans at Sub‐inhibitory Composite Concentrations

To confirm that the composites were not merely fungistatic, the effect of a sub‐MIC dose (¼ MIC) on the growth of C. albicans was monitored by following the optical density at 600 nm (OD₆₀₀) of overnight cultures grown in the presence and absence of the composites [50]. An overnight culture of the strain was standardized to a 0.5 McFarland turbidity, diluted 1:100 in SDB, and then incubated at 25°C for 18 h either with or without ¼ MIC of each composite. After incubation, the turbidity was measured at 600 nm on a UV–vis microplate reader (Synergy HT, BioTek).

2.2.5. Effect of the Composites on C. albicans Susceptibility to FLZ

The influence of sub‐inhibitory composite concentrations (¼ MIC) on the FLZ MIC against C. albicans was evaluated using the agar dilution procedure outlined previously [54].

2.2.6. Biofilm Inhibition Assay

Inhibition of biofilm formation was measured at ¼ MIC of the composites, applied alone and in combination with ¼ MIC of FLZ, following the crystal violet protocol of Stepanović et al. with minor modifications [57]. The fungal suspension was prepared in TSB from an overnight culture grown at 25°C and then standardized to 10⁸ CFU/mL with fresh TSB. A 200 µL aliquot of this suspension was dispensed into each well of a microtiter plate, with and without ¼ MIC of the composites, and the plates were incubated at 25°C for 48 h. The spent broth was then carefully removed, and the wells were rinsed gently with distilled water to discard loosely attached planktonic cells, after which the plates were left to air‐dry. The adherent biofilm was fixed with 200 µL of 99% methanol for 20 min, stained with 200 µL of 1% crystal violet for 15 min, and washed with distilled water to remove the unbound dye. The retained crystal violet was finally solubilized in 33% glacial acetic acid, and its absorbance was read at 570 nm on a BioTek spectrofluorometer.

2.2.7. Minimum Biofilm Eradication Concentration (MBEC)

MBEC values were obtained according to the method of Abbas et al. with slight modifications [58]. Suspensions of the test strain were prepared in TSB at 1 × 10⁸ CFU/mL and then diluted to 5 × 10⁶ CFU/mL in fresh TSB. To permit biofilm development, 100 µL portions of the diluted suspension were added to the wells of 96‐well microtiter plates, which were incubated at 37°C for 24 h. Non‐adherent cells were subsequently aspirated, and the wells were washed three times with phosphate‐buffered saline (PBS). Each well then received 100 µL of ¼ MIC of the composites, either alone or together with a range of FLZ concentrations, and the plates were returned to 37°C for a further 24 h. After treatment, the wells were emptied and washed with PBS; the residual biofilm was dislodged by adding 100 µL of sterile PBS and gently scraping the well surface with a pipette tip. A 10 µL sample taken from each well was spread onto TSA and incubated at 37°C for 24 h. The MBEC was defined as the lowest concentration of the tested agents that yielded no detectable growth on TSA.

2.2.8. Relative Gene Expression by qRT‐PCR

Quantitative real‐time PCR was employed to compare the transcription of the biofilm‐related genes SAP2, SAP6, PLB1, PLB2, LIP4, and LIP5 in C. albicans ATCC 10251 grown in the presence and absence of the tested composites.

Reactions were performed on a StepOne Real‐Time PCR System (Applied Biosystems, USA) using the SensiFAST SYBR Hi‐ROX One‐Step Kit (Bioline, United Kingdom) [59, 60] with the primer sequences listed in Table 1 [61]. The plasma membrane ATPase 1 (PMA1) gene was used as a housekeeping gene to normalize the expression of the target genes. The thermal program comprised an initial enzyme activation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 50–60°C for 30 s, and extension at 72°C for 30 s. Relative expression was then calculated by the comparative threshold cycle (2⁻ΔΔCt) method [62, 63].

TABLE 1.

qRT‐PCR primer sequences.

Gene names	Primer sequence (5′→3′)
PMA1 (F)	TTGCTTATGATAATGCTCCATACGA
PMA1 (R)	TACCCCACAACTTGGCAAGT
SAP2 (F)	GAATTAAGAATTAGTTTGGGTTCAGTTGA
SAP2 (R)	CCACAAGAACATCGACATTATCAGT
SAP6 (F)	TGGTAGCTTCGTTGGTTTGGA
SAP6 (R)	GCTAACGTTTGGTCTACTAGTGCTCATA
PLB1 (F)	GGTGGAGAAGATGGCCAAAA
PLB1(R)	AGCACTTACGTTACGATGCAACA
PLB2 (F)	TGAACCTTTGGGCGACAACT
PLB2 (R)	GCCGCGCTCGTTGTTAA
LIP4 (F)	GCGCTCCTGTTGCTTTGACT
LIP4 (R)	ACACGGTTTGTTTTCCATTGAA
LIP5 (F)	TGGTTCCAAAAATACCCGTGTT
LIP5 (R)	CGACAATAGGGACGATTTGATCA

F forward, R reverse.

2.2.9. Statistical Analysis

A one‐way ANOVA was performed using GraphPad Prism 5, followed by Dunnett's Multiple Comparison Test to evaluate the significance of the inhibitory effect of the tested composites on the biofilm formation of C. albicans. P‐values < 0.05 were considered statistically significant.

3. Results and Discussion

3.1. Chemistry

The fabrication of CuO─Ch nanocomposites doped with Ag and Se was achieved through the ultrasound method, providing a green and reproducible protocol that yielded high yields, uniform morphology, and controlled incorporation of active components. Compared with classical procedures, our methodology offers a more sustainable and straightforward approach while aiming to exploit the synergistic interactions of CuO, Ch, Ag, and Se for enhanced antimicrobial and antioxidant performance [64]. Ch was selected for its biodegradability, biocompatibility, and inherent antimicrobial properties [65, 66]. On the other hand, CuO serves as a stable metal oxide anchorage with well‐known antifungal and antibacterial activities [17]. The doping of Ag and Se was established to provide further improvement in the antimicrobial activities and overcome biological resistance, thereby introducing a synergistic effect with the combined properties of polymer, metal, and metal oxide components, surpassing those of the individual composites [67].

XRD analysis was performed to examine the crystalline phase and nanostructure characteristics of the synthesized materials. Figure 2 shows the comparative XRD patterns of pure CuO, Ch─CuO, Ch─CuO─Se, and Ch─CuO─Ag composites. For the pure CuO nanoparticles (black curve), the characteristic diffraction peaks observed at 2θ values correspond to the (110), (−111)/(002), (111)/(200), (−202), (020), (202), (−113), (−311), (220), (311), and (−222)/(004) lattice planes. These peaks perfectly match the standard monoclinic crystal structure of CuO (JCPDS card no. 89‐5897). The sharp and well‐defined nature of these reflections indicates a high degree of crystallinity. Upon the introduction of Ch in the Ch─CuO composite (red curve), a prominent, broad diffraction peak emerges at approximately 2θ = 25.5_o, which is assigned to the semi‐crystalline/amorphous framework of the Ch matrix. Concurrently, the characteristic crystalline peaks of CuO undergo a significant reduction in intensity, confirming the successful embedding and dispersion of CuO within the biopolymeric matrix. Furthermore, the negligible shift in the 2θ position further signifies that the crystalline phase of CuO remains unchanged.

FIGURE 2.

XRD patterns of pure CuO and its composites with Ch, Ch─Se, and Ch─Ag nanoparticles.

For the ternary Ch─CuO─Se composite (blue curve), additional distinct diffraction peaks appear alongside the broad Ch background. These peaks located at 2θ values of approximately 23.2°, 29.4°, and 43.4° are indexed to the (100), (101), and (110) planes of crystalline Se, respectively. This confirms the successful integration of Se nanoparticles into the polymer matrix. Furthermore, these diffraction reflections are well‐matched with the hexagonal crystalline phase of Se, in strict accordance with JCPDS card no. 06‐0362.

In the case of the Ch─CuO─Ag composite (green curve), the XRD pattern exhibits highly intense and sharp reflections at 2θ values of 37.6°, 43.8°, 64.2°, and 77.1°. These peaks correspond to the (111), (200), (220), and (311) Bragg reflections of metallic Ag, respectively, confirming a face‐centered cubic (fcc) lattice structure. Remarkably, the high intensity of the Ag (111) peak signifies robust crystallization and the successful decoration of Ag nanoparticles onto the composite surface, as indexed by PDF No. 79‐1769.

Notably, the absence of unexpected secondary phases or impurity‐related peaks across all patterns highlights that the fabricated composites are of high purity. Furthermore, the average crystallite size was calculated using the Debye–Scherrer formula, based on the prominent diffraction peaks. The estimated average crystallite size for the CuO nanosheets was approximately 12 nm.

The XPS spectra reveal the surface composition and chemical states of the CuO‐based materials (Figure 3). Each spectrum displays characteristic peaks that correspond to specific elements, demonstrating how the surface chemistry evolves with each modification. The CuO sample serves as the baseline, showing prominent peaks for copper (Cu2p) and oxygen (O1s), which are typical of copper oxide. The peak appearing around 933.5–935.0 eV can be attributed to Cu2p₃/₂ for Cu^{2 +} in CuO, accompanied by satellite peaks between 940–945 eV, which are characteristic of the Cu(II) oxidation state due to shake‐up transitions [68]. The peak appearing between 529–530 eV can be assigned to O1s for lattice oxygen in CuO, distinguishing it from other oxygen species such as hydroxides or carbonates, which show peaks at higher binding energies (531–533 eV) [69, 70]. These values confirm the presence of Cu^{2 +} ions and lattice oxygen, indicating a clean CuO surface.

FIGURE 3.

X‐ray photoelectron spectrum (XPS) survey scans of the obtained CuO‐based samples, high‐resolution Se 3d5/2 spectrum, and high‐resolution Ag 3d spectrum.

Upon introducing CuO into the Ch backbone, new peaks emerged for the nitrogen (N1s) and carbon (C1s). These originate from the amino and carbon‐based groups in Ch, confirming successful surface coating. The N1s peak appears around 399.5–400.5 eV, corresponding to the ─NH₂ groups in Ch, while the C1s peak is observed near 284.6–285.5 eV, attributed to C─C/C─H and C─O/C─N bonds in the glucosamine backbone. These values are consistent with XPS studies of Ch‐based nanocomposites [71, 72]. The interaction between Ch and CuO also caused subtle shifts in the Cu2p peak, suggesting changes in the local chemical environment. In the Ch─CuO─Se sample, the appearance of the Se peak (Se3d) confirms the incorporation of Se. The Se3d₅/₂ peak appears around 55.2 eV, which closely matches the binding energy of elemental Se. This alignment, along with the absence of significant broadening or satellite features, strongly suggests that Se is present in its elemental form rather than as a compound. In contrast, Se oxides or selenides typically exhibit higher binding energies and altered peak shapes due to their chemical bonding environments [73, 74]. The Ch─CuO─Ag sample introduces Ag, as evidenced by the Ag3d peak. The Ag3d₅/₂ peak appears near 368.2 eV, which is characteristic of metallic Ag. These spectral features confirm the presence of Ag on the surface [75]. Across all samples, the consistent Cu2p and O1s peaks serve as reference points within the spectra, while the emergence of N1s, C1s, Se3d, and Ag3d in the modified samples highlights successful functionalization. These changes in peak positions and intensities reflect variations in chemical composition and bonding environments, offering insight into how each additive influences the surface properties of CuO.

FTIR spectra recorded in the 450–4000 cm^{− 1} range display the synthesized materials, including pristine CuO, pristine Ch, and CuO composites containing Ch, Ch─Ag, and Ch─Se nanoparticles (Figure 4). For pristine Ch, the peak at 3350 cm^{− 1} corresponds to the O─H stretching vibration of hydroxyl groups (─OH). The peak observed at 2860 cm^{− 1} is attributed to the C─H stretching vibrations of methyl and methylene groups (─CH₃ and ─CH₂‐) present in the Ch molecule. Additionally, the peaks at 1648 and 1560 cm^{− 1} represent the amide I and amide II vibrations, respectively, associated with acetylated amino groups (─NHCOCH₃). The peak at 1375 cm^{− 1} corresponds to the bending vibration of the ─CH₂‐ groups, while the peak at 1023 cm^{− 1} indicates the C─O─C stretching vibration of the glycosidic linkage (─C─O─C─) in Ch [76]. For pristine CuO, the prominent absorption bands at 620 and 486 cm⁻¹ are characteristic of the Cu─O stretching modes of monoclinic CuO.

FIGURE 4.

FTIR spectra of Ch, CuO NPs, Ch─CuO NPs, Ch─CuO─Se NPs, and Ch─CuO─Ag NPs.

Successful formation of the Ch─CuO, Ch─CuO─Se, and Ch─CuO─Ag nanocomposites is confirmed by significant spectral modifications. Notably, the broad band at 3350 cm⁻¹ shifts to a lower wavenumber, decreases in intensity, and broadens further in the composites, indicating strong hydrogen bonding interactions between the hydroxyl/amino groups of Ch and the surface of the nanoparticles (Scheme 1). Furthermore, the sharp reduction in intensity and slight shifting of the amide I (1648 cm⁻¹) and amide II (1560 cm⁻¹) bands imply that the nitrogen atoms of the Ch amino groups participate in coordination complexes with the metal centers. Lastly, the appearance of the metal‐oxygen vibration features in the lower wavenumber region (< 700 cm⁻¹) across all composites confirms the successful immobilization and integration of the inorganic nanoparticles within the Ch matrix [13].

SCHEME 1.

Structure of Ch/CuO nanocomposite.

The surface morphology of the synthesized nanomaterials was investigated using SEM, as illustrated in Figure 5a–d. The pristine CuO nanoparticles and the Ch─CuO composites exhibit distinctly different microstructures (Figure 5a,b). As shown in Figure 5a, the pristine sample predominantly consists of quasi‐spherical nanoparticles along with some irregular clusters, displaying a relatively small average grain size as indicated by the 200 nm scale bar. Upon coupling with Ch (Figure 5b), a dramatic morphological transition occurs, resulting in stratified, randomly oriented nanosheets with rough, leaf‐like surfaces. These nanosheets exhibit significant variability in both their lateral dimensions and thickness, spanning several micrometers. In contrast, the SEM micrographs for the Ch─CuO─Se (Figure 5c) and Ch─CuO─Ag (Figure 5d) nanocomposites reveal a dense, highly homogeneous network of interconnected, ultra‐fine nanospheres measuring well below 50 nm. This structural shift suggests that the addition of Se and Ag particles introduces abundant new coordination sites within the Ch matrix, effectively restricting anisotropic sheet growth and promoting an isotropic, spheroidal morphology.

FIGURE 5.

SEM images of (a) CuO NPs, (b) Ch─CuO NPs, (c) Ch─CuO─Se NPs, and (d) Ch─CuO─Ag NPs.

3.2. Biological Evaluation

3.2.1. The Antimicrobial Activity of the Tested Composites

Four composites were initially evaluated for their in vitro antimicrobial activity against standard strains of the Gram‐negative P. aeruginosa (PAO1) and K. pneumoniae ATCC (700603), the Gram‐positive S. aureus (ATCC 6538), and the fungus C. albicans (ATCC 10251). Imipenem was used as the reference for antibacterial activity, while FLZ was used as the reference for antifungal activity. Table 2 showed that all the tested strains demonstrated sensitivity to all the tested composites. Noticed that C. albicans was the most affected microbe, having the largest inhibition zones. The composite TS1 exhibited the strongest activity against the tested strains compared to imipenem and FLZ. It highly inhibited C. albicans, followed by S. aureus, P. aeruginosa, and finally K. pneumoniae. TS2 and TS3 exhibited notably more potent activity than imipenem against S. aureus, K. pneumoniae, and P. aeruginosa, respectively, but showed a lower inhibition zone than FLZ against C. albicans. TS4 showed higher efficacy toward S. aureus and P. aeruginosa compared to imipenem, while showing lower activity against K. pneumoniae. Concerning its activity against C. albicans, it has greater efficacy compared to FLZ.

TABLE 2.

Diameter of inhibition zones (mm) of tested microorganisms exposed to targeted composites.

IDs	P. aeruginosa	K. pneumonia	S. aureus	C. albicans
TS1	20	19	28	34
TS2	20	23	24	26
TS3	18	25	26	22
TS4	15	18	20	32
Imipenem	14	20	22	—
FLZ	—	—	—	30

3.2.2. Minimum Inhibitory Concentrations (MICs) of the Tested Composites

All tested composites were assessed for their minimum inhibitory concentration (MIC) against C. albicans, a fungus responsible for infections that range from superficial skin conditions to severe life‐threatening systemic infections, which are often difficult to treat with conventional antifungal agents. The assessments followed the guidelines established by the Clinical and Laboratory Standards Institute (CLSI). TS1 exhibited a lower MIC than FLZ, indicating greater potency. TS2 has comparable activity, while TS3 and TS4 showed higher MICs compared to FLZ (Table 3).

TABLE 3.

MIC and sub‐MIC (1/4 MIC) of the tested composites against C. albicans.

IDs	MIC(µg/mL)	¼ MIC(µg/mL)
TS1	15.625	3.906
TS2	62.5	15.625
TS3	125	31.25
TS4	31.25	7.813
FLZ	31.25	7.813

3.2.3. The Growth Pattern of C. albicans in the Presence of Sub‐Inhibitory Concentrations of the Tested Composites

The impact of sub‐MICs (¼ MIC) on fungal growth was assessed to exclude the possibility that any observed effects of the target composites on C. albicans biofilm inhibition were due to fungistatic activity. Optical density at 600 nm (OD600) was measured for overnight cultures grown in the presence and absence of ¼ MIC of the tested composites, using FLZ as a reference control.

As illustrated in Figure 6, no significant differences in C. albicans growth were observed in treated and untreated cultures. This indicated that ¼ MICs of the tested composites did not negatively affect fungal growth. Consequently, all the target composites were tested against biofilm inhibition assays at a concentration of ¼ MIC.

FIGURE 6.

Effect of ¼ MIC of the tested composites and FLZ on C. albicans growth. No significant variation was observed in the growth of the tested strain (p > 0.05). Data are expressed as mean ± SD. (ns: non‐significant).

3.2.4. Effect of the Tested Composites on the Susceptibility of C. albicans to the Antifungal Drug “FLZ”

To assess the potential potentiation of FLZ by the tested composites, the MIC of FLZ was measured in the presence of ¼ MIC of the target composites. The tested composites reduced the MIC of FLZ by 2‐8‐fold. The highest potentiating effect was observed with TS1 (8‐fold), followed by TS4 (4‐fold). The lowest potentiating effect is with TS2 and TS3 (2‐fold), as shown in Table 4.

TABLE 4.

Effect of the tested composites at ¼ MIC on FLZ MIC.

MICs (µg/mL)
FLZ	FLZ + TS1 (3.906 µg/mL)	FLZ + TS2 (15.625 µg/mL)	FLZ + TS3 (31.25 µg/mL)	FLZ + TS4 (7.813 µg/mL)
7.813	3.9	15.625	15.625	7.8125

3.2.5. Susceptibility of Planktonic and Biofilm Cells to the Tested Composites

Inhibition of biofilm formation was assessed by the crystal violet assay. Biofilm formation by C. albicans planktonic cells was inhibited by 63.84% with composite TS1, which is higher than FLZ (60%), followed by 59.36% inhibition with TS4, 45.6% with TS2, and 41.55% with TS3 (Figure 7). Biofilm cells exhibited greater resistance to the tested composites compared to planktonic cells, as indicated by the ratio of MBEC‐to‐MIC of the targeted composites shown in Table 5. The ratio was higher than that of FLZ for composite TS2 and TS3 (4‐fold), and similar to FLZ for composites TS1 and TS4 (2‐fold).

FIGURE 7.

Inhibition of biofilm formation of planktonic cells by the target composites and FLZ at ¼ MIC, in addition to synergism on biofilm formation inhibition between ¼ MIC of the tested composites combined with ¼ MIC of FLZ. A significant reduction in biofilm formation was recorded. Data are presented as mean ± SD of absorbance at 570 nm. Statistical significance results at p < 0.05 compared to control were assessed using one‐way ANOVA followed by Dunnett's multiple comparison test.

TABLE 5.

Susceptibility of biofilm cells to tested composites.

IDs	MIC(µg/mL)	MBEC(µg/mL)	MBEC/MIC
TS1	15.625	31.25	2
TS2	62.5	250	4
TS3	125	500	4
TS4	31.25	62.5	2
FLZ	31.25	62.5	2

3.2.6. Synergism between FLZ and the Tested Composites as Potential Antibiofilm Agents

To assess the synergism between FLZ and the tested composites, biofilm formation inhibition of planktonic cells was measured in the presence of ¼ MIC of the target composites combined with ¼ MIC of FLZ. The highest potentiating effect, which inhibited biofilm formation, was observed with TS1 (82.2%), followed by TS4 (79.07%) and TS2 (61.88%). The lowest potentiating effect was observed with TS3 (51.87%), as shown in Figure 7.

MBEC was also measured at ¼ MIC of the tested composites in combination with various concentrations of FLZ to assess the synergism between FLZ and the tested composites on C. albicans biofilm cells. A synergy was observed between FLZ and the various tested composites (Table 6). TS1 reduced the MBEC of FLZ by 8‐fold, TS2 and TS3 by 2‐fold, and TS4 by 4‐fold.

TABLE 6.

Effect of ¼ MIC of the tested composites on FLZ MBEC.

IDs	MBEC(µg/mL)
TS1	7.813
TS2	31.25
TS3	31.25
TS4	15.625
FLZ	62.5

3.2.7. The Tested Composites Downregulated the Expression of C. albicans Virulence Genes by Real‐Time PCR

The relative expression of genes associated with biofilm formation was assessed in both treated and untreated C. albicans using TS1 and TS4. Treatment with the tested composites significantly downregulated the expression levels of SAP2, SAP6, PLB1, PLB2, LIP4, and LIP5(Figure 8). Among the two composites, TS1 exhibited greater inhibitory activity against the biofilm‐related genes compared to TS4. SAP2 and SAP6 expressions were reduced by 73.96% and 70.95% with TS1, and by 71.14% and 69.93% with TS4. PLB1 and PLB2 were notably suppressed by TS1 to 67.98% and 67.61%, respectively, while TS4 reduced their expression to 65.82% and 63.50%, respectively. Additionally, TS1 decreased the expression of LIP4 and LIP5 by 71.52% and 68.42%, respectively, whereas TS4 achieved reductions of 57.73% and 56.55%, respectively.

FIGURE 8.

Inhibition of the relative expression of C. albicans genes (SAP2, SAP6, PLB1, PLB2, LIP4, and LIP5) by (a) TS1 and (b) TS4 at (1/4 MIC). Data are expressed as mean ± SD. Statistical significance results at P < 0.05 compared to the control were assessed using one‐way ANOVA followed by Dunnett's multiple comparison test.

4. Comparative Analysis

The present work is the first to simultaneously combine four components: CuO, Ch, Ag, and Se, into a single quaternary nanocomposite framework targeting C. albicans biofilms (see Table 7 for a comprehensive comparison of the present work against the most relevant recently reported CuO/Ch‐based antifungal nanocomposites).

TABLE 7.

A comprehensive comparison of the present work against the most relevant recently reported CuO/Ch‐based antifungal nanocomposites.

Studies	Composites	Main target(s)	Key outcome related to C. albicans	References
Lara et al. (2018)	Ch─SeNPs	C. albicans biofilms	Synergistic fungicidal activity with FLZ on biofilms.	[77]
Ashrafi et al. (2020)	Ch/Ag/Cu	C. albicans	Antifungal activity comparable to amphotericin B.	[78]
Al‐Rajhi et al. (2024)	Ch/Fe2O3/CuO	C. albicans	MIC 31.25 µg/mL; biofilm inhibition 95.31% at 75% MIC.	[79]
Alelah et al. (2025)	Ch/CuO	E. coli, S. mutans	Antioxidant and antibacterial only (no antifungal data).	[43]
Umoren et al. (2022)	Ch/CuO	Bacteria	Good antibacterial activity; no C. albicans data.	[44]
Hashem et al. (2025)	GA@Ag─CuO	C. albicans, C. neoformans	MIC 62.5 µg/mL against C. albicans.	[67]
Zubair et al. (2025)	CuO NPs	Vaginal C. albicans	MIC50 44.5–51.5 µg/mL; qualitative biofilm disruption.	[80]
Ibrahiem et al. (2025)	Ch/SeNPs	C. albicans & others	Antifungal and antibiofilm activity; Ch improves SeNP stability.	[81]
Present work	Ch─CuO─Ag/Ch─CuO─Se	C. albicans (plus bacteria)	MIC 15.625 µg/mL (TS1); strong antibiofilm effect and 8‐fold FLZ potentiation.

In 2018, Lara et al. synthesized Ch‐stabilized Se nanoparticles via pulsed laser ablation in liquid and showed potent synergistic fungicidal activity against C. albicans biofilms in combination with FLZ in a dose‐response manner against the established biofilm [77]. Furthermore, in 2020, Ashrafi et al. fabricated a Ch/Ag/Cu nanocomposite with antifungal effects against C. albicans with similar activity to amphotericin B [78]. In 2024, Al‐Rajhi et al. fabricated a Ch/Fe₂O₃/CuO nanocomposite with good antimicrobial activity against C. albicans (MIC of 31.25 µg/mL) alongside biofilm inhibition reaching 95.31% at 75% MIC [79].

In 2025, Alelah et al. reported a green biosynthesis of Ch/CuO nanocomposites mediated by grape seed extract and showed good antioxidant and antibacterial activity against E. coli and S. mutans [43]. Similarly, Umoren et al. (2022) fabricated Ch/CuO composites using olive leaf extract and exhibited good antibacterial activities against several Gram‐positive and Gram‐negative strains [44]. Furthermore, Hashem et al. (2025) synthesized an Ag/CuO nanocomposite using Arabic‐based gum and showed antifungal activity against C. albicans [67].

Moreover, Zubair et al. (2025) reported biogenic CuO nanoparticles from Moringa oleifera with MIC₅₀ values of 44.5–51.5 µg/mL against vaginal C. albicans isolates and demonstrated qualitative biofilm disruption at sub‐MIC concentrations [80].

Finally, Ibrahiem et al. (2025) reported the mycosynthesis of a Ch/Se nanoparticle nanocomposite using a fungal cell‐free filtrate, providing well‐dispersed, biogenic SeNPs incorporated within a Ch matrix [81]. Interestingly, these nanocomposites exhibited antifungal and antibiofilm activity against C. albicans and other fungal pathogens, with the Ch coating shown to significantly enhance the stability and biological performance of the Se nanoparticles compared to bare SeNPs.

5. Structure–Activity Relationship of the Tested Composites

The antifungal performance of the four composites against C. albicans followed a consistent rank order across all independent endpoints—agar‐well inhibition zone, agar‐dilution minimum inhibitory concentration (MIC), crystal‐violet biofilm inhibition, and FLZ potentiation—namely TS1 > TS4 > TS2 > TS3. The reproducibility of this ordering across mechanistically distinct assays indicates that activity is governed by a limited set of structural determinants rather than by assay‐specific artefacts, thereby permitting a coherent structure–activity interpretation. The principal structural descriptors and the corresponding activity metrics are collated in Table 8.

TABLE 8.

Structure–Activity correlation for the tested composites against C. albicans.

Composites	Key distinguishing structural features	MIC (µg/mL)	Biofilm inhibition (%)	FLZ potentiation	Activity rank
TS1 (CuO)	Uncapped, monoclinic, ∼12 nm crystallite; quasi‐spherical; maximal exposed surface Cu2 +	15.625	63.84	8‐fold	1
TS4 (Ch–CuO–Se)	Ch‐capped; elemental Se0 (hexagonal); interconnected sub‐50 nm nanospheres	31.25	59.36	4‐fold	2
TS2 (Ch–CuO)	Ch‐capped CuO; micrometre‐scale, leaf‐like nanosheets	62.5	45.60	2‐fold	3
TS3 (Ch–CuO–Ag)	Ch‐capped; highly crystalline fcc metallic Ag0; sub‐50 nm nanospheres	125	41.55	2‐fold	4

5.1. Effect of the Ch Matrix (TS1 vs TS2)

Comparison of pristine CuO (TS1) with the binary Ch─CuO composite (TS2) isolates the contribution of the Ch matrix. Incorporation of Ch raised the MIC 4‐fold (15.625 → 62.5 µg/mL) and lowered planktonic biofilm inhibition from 63.84% to 45.60%. FTIR and XPS evidence attributes this attenuation to coordination of the Ch amino and hydroxyl groups to the CuO surface, manifested as the red shift, broadening, and intensity loss of the ∼3350 cm^{− 1} hydroxyl/amino band, the diminution and shift of the amide I (1648 cm^{− 1}) and amide II (1560 cm^{− 1}) bands, and a discernible shift of the Cu 2p envelope. Such coordination passivates surface Cu^{2 +} centres and, in conjunction with the transition from accessible nanoparticles to micrometre‐scale nanosheets, reduces the density of catalytically active sites available for ROS generation and Cu^{2 +} release. The Ch matrix therefore depresses intrinsic antifungal potency despite improving colloidal integration and dispersion of the inorganic phase.

5.2. Influence of Dopant Identity at Constant Matrix and Morphology (TS3 vs. TS4)

The most rigorously controlled comparison within the series is that between Ch─CuO─Ag (TS3) and Ch─CuO─Se (TS4), which share an identical Ch─CuO matrix and a closely comparable sub‐50 nm nanosphere morphology and differ solely in the doping element. Despite this structural parity, TS4 was 4‐fold more potent than TS3 (MIC 31.25 vs. 125 µg/mL) and afforded markedly superior biofilm inhibition (59.36% vs. 41.55%) and FLZ potentiation (4‐ vs. 2‐fold). Because morphology and matrix are held constant, the divergence can be assigned unambiguously to dopant redox chemistry. XRD identified Ag as a highly crystalline face‐centred‐cubic (fcc) metallic phase exhibiting intense, sharp reflections, whereas Se was present as elemental Se⁰ of comparatively lower crystalline order, consistent with the XPS Se 3d₅/₂ signature at ∼55.2 eV. The bioactivity of Ag is contingent upon its oxidative dissolution to Ag⁺; large, well‐crystallized, low‐surface‐area Ag⁰ domains release Ag⁺ slowly, thereby limiting their antifungal contribution. In contrast, elemental Se⁰ participates in redox cycling that augments ROS generation, accounting for its superior performance under otherwise identical structural conditions.

5.3. Opposing Contributions of the Two Dopants to the Capped Matrix (TS2 → TS3/TS4)

Referenced to the binary TS2, doping exerted opposing effects: Se partially restored activity (MIC 62.5 → 31.25 µg/mL), whereas Ag further diminished it (62.5 → 125 µg/mL), even though both dopants induced the favorable nanosheet‐to‐nanosphere morphological transition. The increased surface area afforded by the spheroidal morphology was thus insufficient to offset the slow Ag⁺ release in TS3, whereas the additional redox pathway provided by Se⁰ outweighed the residual surface passivation by Ch in TS4. This demonstrates that, within the present system, dopant redox accessibility dominates over morphological surface‐area gains as a determinant of activity.

5.4. Origin of the Superior Activity of Pristine CuO (TS1)

Pristine CuO (TS1) retained the highest activity of the series, notwithstanding its simpler composition and the absence of the morphological refinement observed in the doped composites. XRD assigned TS1 a monoclinic structure with an average crystallite size of approximately 12 nm, conferring a high surface‐to‐volume ratio and a correspondingly high density of exposed, redox‐active Cu^{2 +} and surface‐oxygen sites, as corroborated by the Cu 2p₃/₂ and lattice‐O 1s XPS signals. Because this surface is neither capped by Ch nor diluted by a slowly dissolving secondary phase, TS1 presents the greatest concentration of accessible active sites, which accounts for its superiority even over the Se‐doped TS4. Antifungal activity across the series therefore correlates positively with the accessible density of redox‐active metal sites and inversely with the degree of surface passivation.

5.5. Consistency at the Biofilm and Transcriptional Levels

The same structural ordering extended to the sessile phenotype and to the molecular level. The MBEC/MIC ratio, a measure of the residual susceptibility of biofilm cells relative to planktonic cells, was lowest (2) for TS1 and TS4 and higher (4) for TS2 and TS3, indicating that the two most active composites retained proportionally greater efficacy against biofilm‐embedded cells. Consistently, at the transcriptional level, TS1 elicited stronger downregulation than TS4 of all six biofilm‐associated virulence genes (SAP2, SAP6, PLB1, PLB2, LIP4, and LIP5), with the largest divergence observed for the LIP genes (LIP4: 71.52% vs. 57.73%; LIP5: 68.42% vs. 56.55%). This molecular‐level ranking mirrors that established by the phenotypic assays and is consistent with the higher effective Cu^{2 +}/ROS burden delivered by the uncapped TS1.

5.6. Unifying Structure–Activity Principle

Taken together, the structure–activity data converge on a single governing principle: antifungal efficacy in this series is dictated primarily by the accessibility and release kinetics of redox‐active metal centers. This accessibility is maximal in uncapped, fine‐crystallite CuO (TS1); partially preserved when an intrinsically redox‐active elemental dopant (Se⁰) is introduced into the Ch matrix (TS4); suppressed upon Ch coordination of the CuO surface (TS2); and not recovered by a slowly dissolving, highly crystalline metallic dopant (Ag⁰, TS3). Particle morphology and surface area function as secondary modulators that influence activity only when they are not overridden by surface capping or dissolution‐controlled ion release.

6. Conclusion

This study demonstrates the synthesis and functional enhancement of CuO‐based nanocomposites through the incorporation of Ch, Ag, and Se nanoparticles. Structural characterizations were performed via XRD, which confirmed the monoclinic phase of CuO with high purity and crystallinity. Furthermore, FTIR analysis revealed strong molecular interactions between CuO and Ch, likely mediated by hydrogen bonding between amino and hydroxyl groups. These interactions were further supported by spectral shifts and peak broadening, indicating modifications in bond strength and polarity. Morphological analysis showed a transition from aggregated nanosheets to more uniform nanospheres upon doping with Ag and Se, suggesting improved dispersion and surface homogeneity. The antimicrobial evaluation revealed that all synthesized composites exhibited significant activity against Gram‐positive (S. aureus), Gram‐negative (P. aeruginosa, K. pneumoniae), and fungal (C. albicans) strains. Among them, TS1 (CuO) demonstrated the most potent broad‐spectrum antimicrobial effect, outperforming standard antibiotics (imipenem) and antifungals (FLZ) in both inhibition zone diameter and MIC values. Notably, TS1 showed the lowest MIC against C. albicans (15.625 µg/mL), indicating its superior antifungal potency. Sub‐inhibitory concentrations (¼ MIC) of the composites did not affect fungal growth, validating their use in biofilm inhibition assays without confounding fungistatic effects. Biofilm formation by C. albicans was significantly inhibited, with TS1 achieving 63.84% inhibition alone and 82.2% when combined with FLZ, highlighting a strong synergistic effect. TS4 (Ch─CuO─Se) also showed notable synergy, reducing FLZ's MBEC by 4‐fold. These findings suggest that the composites not only possess intrinsic antimicrobial properties but also enhance the efficacy of conventional antifungal agents. Furthermore, gene expression analysis revealed substantial downregulation of key C. albicans virulence genes involved in biofilm formation and pathogenicity, including SAP2, SAP6, PLB1, PLB2, LIP4, and LIP5. TS1 was particularly effective, reducing expression levels by over 70% in most targets, indicating its potential to disrupt fungal virulence mechanisms at the molecular level.

In conclusion, the engineered CuO‐based nanocomposites, especially TS1 and TS4, offer a promising platform for antimicrobial and antifungal applications. Their ability to inhibit biofilm formation, potentiate the effects of existing antifungal drugs, and suppress virulence gene expression underscores their therapeutic potential in managing drug‐resistant infections and biofilm‐associated diseases. Future studies should explore their biocompatibility, in vivo efficacy, and potential for integration into clinical formulations such as wound dressings, coatings, or targeted drug delivery systems.

A limitation of the present study is that it did not include cytotoxicity or biocompatibility testing of the prepared composites. Such an assessment, encompassing evaluation against mammalian cell lines and hemocompatibility, will be the focus of our future work to establish the safety profile of these composites prior to any biomedical application.

Author Contributions

Tarek Alammar: conceptualization, methodology, investigation, writing – original draft, visualization, project administration, funding acquisition. Saad Shaaban: conceptualization, formal analysis, investigation, writing – original draft, supervision, visualization, project administration, funding acquisition. Amany I. Gad: methodology, formal analysis, investigation, writing – original draft, visualization. Nagih M. Shaalan: methodology, visualization. Ahmed A. Al‐Karmalawy: formal analysis, investigation, writing – original draft, supervision, visualization, project administration. Mohamed E. Eissa: visualization.

Funding

This work was supported by the Deanship of Scientific Research, Vice Presidency for Graduate Studies and Scientific Research, King Faisal University, Saudi Arabia [Grant No. KFU263838].

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that supports the findings of this study are available in the Supporting Information of this article.