Biochar mitigates Fusarium wilt by regulating the rhizosphere microbial community structure

Abstract

BACKGROUND

Continuous cropping of faba bean severely degrades the soil ecosystem, leading to the accumulation of autotoxic compounds and pathogenic fungi, which further aggravates soilborne diseases. Among available strategies, the rational application of biochar has the potential to reshape soil microbial communities. This study aimed to elucidate the rhizosphere microbial mechanisms by which biochar (BC) mitigates Fusarium wilt. Wheat straw BC was applied at 0%, 0.5%, 1%, 1.5%, 2% and 3% to evaluate its effects on soil microbial community. Based on this, a pot experiment was conducted to systematically assess the effects of BC on Fusarium wilt incidence, autotoxic compound accumulation, soil microbial diversity and root pathogenesis‐related protein (PR) expression following inoculation with BC‐conditioned soils.

RESULTS

Compared with the control, BC application mitigated Fusarium wilt, reducing the disease index by 16.66%–52.11%, with the greatest effect observed at 1%. At this level, BC decreased soil phenolic acid accumulation, increased the relative abundance of Proteobacteria, and reduced that of Ascomycota. BC‐induced shifts enhanced the diversity, structure, and composition of rhizosphere microbial communities. Specifically, 1% BC increased the absolute abundance of Bacillus sp. by 119.01% and Sphingomonas sp. by 98.93%, decreased the absolute abundance of Fusarium commune sp. by 77.41%, and upregulated root PR protein gene expression, thereby alleviating Fusarium wilt.

CONCLUSION

The application of 1% wheat straw BC effectively reshaped the soil microbial community, reduced autotoxic compound accumulation, improved soil health and suppressed Fusarium wilt. © 2026 Society of Chemical Industry.

Wheat straw biochar can reshape soil microbial communities and enhance the specific plant defense ability of faba bean against pathogen infection. Wheat straw biochar can indirectly promote the degradation of phenolic acids through its own adsorption effect and by regulating the functions of key microbial groups. Revealing the alleviation effect and mechanism of wheat straw biochar on the Fusarium wilt of faba bean mediated by microorganisms.

1. INTRODUCTION

Healthy soils sustain high crop yield and quality, ensure agroecosystem stability and support long‐term productivity, which are essential for sustainable agricultural development. ¹ , ² However, limited arable land and agricultural intensification have promoted large‐scale monocropping, which often induces soil‐related problems and leads to soil degradation. ³ Continuous cropping results in succession disorders, commonly referred to as soil diseases. These disorders arise from multiple soil factors, including the accumulation of autotoxic compounds, nutrient imbalances, disruption of microbial community structure and increased soilborne pathogens. ⁴ Collectively, these processes result in a high incidence of soilborne diseases and reduced plant growth. Therefore, establishing a healthy soil environment with diverse microbial communities is critical for the ecological management of soilborne diseases.

Conventional strategies to alleviate soilborne diseases in agricultural systems include crop rotation, intercropping, microbial fungicides and organic fertilizer amendment. ⁵ , ⁶ , ⁷ These approaches maintain soil microbial diversity and activity while suppressing harmful microorganisms that proliferate under monoculture, thereby enhancing crop yield. Notably, cereal–legume intercropping can enhance productivity while reducing the accumulation of pathogens and toxic compounds in soil, thereby mitigating soilborne diseases. ⁸ For example, wheat–faba bean intercropping has been shown to reduce rhizosphere pathogen abundance and the incidence of Fusarium wilt. ⁹ In recent years, biochar (BC) application has been proposed as an effective strategy to improve soil fertility and support crop growth. ¹⁰ Owing to its porous structure and high adsorption capacity, BC can adsorb allelopathic substances, thereby reducing their inhibitory effects on seed germination. ¹¹ For example, BC addition has been reported to reduce allelopathic residues in continuous cropping soils and decrease the incidence of reed root rot. ¹² However, the mechanisms by which BC regulates soil microbial communities to suppress soilborne diseases remain poorly understood, particularly when straw‐derived BC is applied to legumes following cereal–legume intercropping.

An imbalance in soil microbial communities has been recognized as a critical factor contributing to the prevalence of soilborne diseases. ¹³ , ¹⁴ Microorganisms are highly active and responsive components of soil and play pivotal roles in soil health and agricultural sustainability. ¹⁵ Tobacco stalk BC has been reported to increase the diversity index of rhizosphere microorganisms in flue‐cured tobacco compared with the control. ¹⁶ Soil microbial diversity and composition are essential for maintaining soil health. Kolton et al. ¹⁷ demonstrated that BC application increased rhizosphere bacterial diversity, enhanced the utilization of carbohydrates and phenolic compounds, and promoted phenolic compound‐degrading bacteria. Moreover, BC has been shown to increase actinomycete abundance, suppress Fusarium oxysporum, and restructure rhizosphere microbial communities, thereby alleviating the apple replant problem. ¹⁸ However, it remains unclear whether BC‐mediated disease suppression is directly associated with shifts in the rhizosphere microbiome.

Faba bean is a protein‐rich, nitrogen‐fixing and highly adaptable legume that plays an important role in food, feed and ecological systems, and represents a key component of sustainable agriculture. ¹⁹ , ²⁰ In China, soilborne diseases associated with continuous cropping have become a major constraint to faba bean production, with Fusarium wilt being one of the most prevalent diseases. ⁹ In our previous studies, wheat–faba bean intercropping significantly alleviated Fusarium wilt. ²¹ , ²² We hypothesized that wheat straw BC could suppress Fusarium wilt by regulating rhizosphere microbial dynamics. Therefore, the objectives of this study were to (1) determine whether wheat straw BC alleviates Fusarium wilt and promotes faba bean growth; (2) evaluate the effects of wheat straw‐derived BC on autotoxic substances in the rhizosphere; and (3) analyze changes in microbial communities and the expression of pathogenesis‐related (PR) genes in the rhizosphere induced by wheat straw BC. These findings provide a theoretical basis for the application of BC in the prevention and control of soilborne diseases.

2. MATERIAL AND METHODS

2.1. Overview of the experiment

The pot experiment was conducted from October 2023 to April 2024 in a greenhouse at the Yunnan Agricultural University. Continuous‐cropping soil was collected from Efeng Village, Eshan County, Yuxi City, Yunnan Province, where faba bean had been cultivated for seven consecutive years. Long‐term continuous cultivation of faba bean in this region has led to the accumulation of allelopathic compounds and soilborne F. oxysporum, which are the primary causes of Fusarium wilt. ⁹ The basic physicochemical properties of the soil are presented in Table 1.

Table 1.

Basic physicochemical properties of the tested soil

Year	pH	OM (g kg–1)	Alkali N (mg kg–1)	Olsen P (mg kg–1)	Avail K (mg kg–1)
2016–2017	6.70	28.90	104.00	36.90	100.50
2023–2024	6.50	22.40	102.00	31.07	113.67

2.2. Materials

The faba bean (Vicia faba L.) variety used in this study was ‘Yuxi Big Grain Bean’, and the seeds were obtained from the Grain Crops Research Institute, Yunnan Academy of Agricultural Sciences. Wheat straw BC was supplied by Zhengzhou Tianchen Purification Materials Co., Ltd (China). The basic physicochemical properties of wheat straw BC are presented in Table 2.

Table 2.

Basic physicochemical properties of wheat straw BC

pH	OC (%)	TN (%)	Olsen P (mg kg–1)	Avail K (g/kg–1)	Cd (μg kg–1)	Pb (μg kg–1)	As (μg kg–1)	Cr (μg kg–1)
9.6	75	1.5	1930	53	5.43	143	31.4	613

2.3. Experimental design and implementation

2.3.1. Experimental design

Experiment 1: Soil cultivation was conducted in pots with wheat straw BC applied at 0.5% (B0.5), 1% (B1), 1.5% (B1.5), 2% (B2) and 3% (B3) (w/w), with untreated soil serving as the control (B0). Six treatments were established, each with three replicates, resulting in a total of 18 pots. Samples were collected 82 days after sowing, and the corresponding indices were determined.

Experiment 2: Following the method of Brinkman et al., ²³ soil microorganisms were removed using high‐temperature steam sterilization. The soil was first passed through a 2‐mm sieve. A portion of the soil was sterilized at 121 °C and 103 kPa for 30 min, with sterilization repeated every 48 h for a total of three cycles, and another portion was left unsterilized. In the soil‐based pot experiment, sterilized and nonsterilized soils were inoculated with 6% (w/w) rhizosphere soil previously treated with BC in Experiment 1. A total of 13 treatments were established: (1) sterilized continuously cropped soil was not inoculated with any rhizosphere soil (CCS); (2) sterilized continuous‐cropping soil inoculated with rhizosphere soil treated with 0% BC (CCS + RSB0); (3) the sterilized continuous‐cropping soil inoculated with rhizosphere soil adjusted with 0.5% BC (CCS + RSB0.5); (4) the sterilized continuous‐cropping soil inoculated with rhizosphere soil adjusted with 1% BC (CCS + RSB1); (5) the sterilized continuous‐cropping soil inoculated with rhizosphere soil adjusted with 1.5% BC (CCS + RSB1.5); (6) the sterilized continuous‐cropping soil inoculated with rhizosphere soil adjusted with 2% BC (CCS + RSB2); (7) the sterilized continuous‐cropping soil inoculated with rhizosphere soil adjusted with 3% BC (CCS + RSB3); and (8–13) corresponding treatments using nonsterilized continuous‐cropping soil (CC). Each treatment was performed in triplicate, resulting in a total of 39 pots. Samples were collected 82 dys after sowing, and relevant parameters were measured.

2.3.2. Test implementation

One week before sowing, wheat straw BC was thoroughly mixed with continuous‐cropping soil and placed in pots for incubation. Uniformly sized faba bean seeds were soaked in 10% (v/v) hydrogen peroxide for 30 min and germinated in the dark. After germination, six seeds were sown per pot (black plastic pots; upper diameter 21 cm, lower diameter 16 cm, height 15 cm), with each pot containing 3.5 kg soil. During plant growth, tap water was applied to maintain soil moisture at 60–70% of field capacity. Plants were grown under natural light at a temperature of 20–25 °C. No pesticides or herbicides were applied during the growth period, and Fusarium wilt developed naturally.

2.4. Measurement of faba bean seedling growth and disease assessment

At 82 days after sowing, three plants were randomly selected from each replicate to measure root length and plant height. The plants were rinsed with distilled water, and the aboveground and belowground parts were separated and placed in pre‐labeled kraft paper bags. The samples were initially heated at 105 °C for 15–30 min, followed by drying at 65 °C to a constant weight. The dry weights (DW) of both parts were then determined. Fusarium wilt was assessed 82 days after sowing. Eighteen plants were selected from each treatment for disease evaluation. Disease severity was scored using a five‐grade scale. ⁸

$$\text{Disease incidence}\left(\%\right)=(\text{number of plants with disease incidence}/\text{total number of plants surveyed})\times 100\%$$

$$\text{Disease index}\left(\%\right)=\begin{array}{l}\mathrm{\Sigma }(\text{number of plants}\mathrm{at}\text{each level}\\ \times \text{corresponding level value})/(\mathrm{Top}\text{value}\\ \times \text{total number of plants surveyed})\times 100\end{array}$$

2.5. Soil sample collection

Soil samples were collected 82 days after sowing. Rhizosphere soil was obtained using the root shaking method. After removing loosely attached soil, the soil tightly adhering to the roots was collected. Soil from 18 plants was pooled, thoroughly homogenized, and cleared of roots and other debris. A portion of the rhizosphere soil was placed in pre‐labeled cryogenic tubes, immediately transported to the laboratory, and stored at −80 °C for high‐throughput sequencing to assess microbial diversity. Another portion was sealed in plastic bags, transported to the laboratory and used to determine phenolic acid content in the rhizosphere soil.

2.6. Test items and methods

2.6.1. Determination of phenolic acid content

Fresh soil (25 g) was weighed and placed in a conical flask, followed by the addition of 25 mL of 1 mol L^–1 NaOH solution. After standing for 24 h, the mixture was centrifuged at 8000×g for 10 min, and the supernatant was collected. The pH of the supernatant was adjusted to 2.5 with 12 mol L^–1 HCl and allowed to stand for an additional 2 h. The solution was then centrifuged again at 8000×g for 10 min, and the resulting supernatant was stored at 4 °C until analysis. The samples were filtered through a 0.22‐μm membrane and analyzed using high‐performance liquid chromatography (HPLC). The detection conditions followed those described by Lv et al. ⁸

Wheat straw BC at 0.5%, 1%, 1.5%, 2% and 3% (w/w) was weighed and placed in 50‐mL centrifuge tubes. Each tube was filled with 40 mL of a pre‐prepared phenolic acid solution to evaluate the effect of BC addition on the adsorption of the five phenolic acids. The tubes were sealed and shaken at 200 rpm for 24 h at room temperature, followed by high‐speed centrifugation. The supernatant was filtered through a 0.22‐μm membrane, and phenolic acid concentrations were determined by HPLC under the conditions described by Lv et al. ⁸

2.6.2. Soil microbial assay

Soil microbial analysis was performed by Shanghai Majorbio Bio‐Pharm Technology Co., Ltd (China). Total microbial DNA was extracted using an E.Z.N.A.® Soil DNA Kit, and DNA concentration and purity were assessed using a NanoDrop 2000 spectrophotometer. For bacterial communities, the V4–V5 region of the 16S rRNA gene was sequenced for relative abundance analysis, and fungal communities were analyzed using the internal transcribed spacer (ITS) region. The primer sequences are presented in Table 3. Sequencing was performed on an Illumina NextSeq 2000 platform, and the data were processed using the Majorbio Cloud Platform.

Table 3.

Primer sequences used for microbial analyses

	Primer name	Primer sequence
338F_806R	338F	ACTCCTACGGGAGGCAGCAG
	806R	GGACTACHVGGGTWTCTAAT
ITS1F_ITS2R	ITS1F	CTTGGTCATTTAGAGGAAGTAA
	ITS2R	GCTGCGTTCTTCATCGATGC

2.6.3. Quantitative PCR analysis of Sphingomonas sp., bacillus sp. and Fusarium commune sp.

Total soil DNA was extracted using the FastPure Soil DNA Isolation Kit T09‐96 (MJYH, Shanghai, China) according to the manufacturer's instructions. Each soil sample was extracted in triplicate, and the extracts were pooled to generate a composite sample. Standard plasmid concentrations were measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The primer sequences are presented in Table 4. ²⁴ , ²⁵ Each 10‐μL quantitative (q)PCR reaction mixture contained 5 μL 2× Tap Plus Master Mix, 0.4 μL forward primer (5 μm), 0.4 μL reverse primer (5 μm), 0.2 μL 50× ROX Reference Dye I, 1 μL template DNA and 3 μL ddH₂O. The amplification program consisted of an initial denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 58 °C for 30 s, and extension at 72 °C for 1 min.

Table 4.

Primer sequences used for microbial quantification

	Primer name	Primer sequence
Sphingomonas sp.	Sphingo108F Sphing420R	GCGTAACGCGTGGGAATCTG TTACAACCCTAAGGCCTTC
Bacillus sp.	BacF	GGGAAACCGGGGCTAATACCGGAT
	BacR	GTCACCTTAGAGTGCCC
Fusarium commune sp.	Fc‐F	ATGAAGAACGCAGCAA
	Fc‐R	ACTACTACGCAATGGAGG

2.6.4. Determination of root PR gene expression

RNA was extracted from faba bean roots using an RNAprep Pure Plant Kit (Tiangen Biotech Co., Ltd, Beijing, China) according to the manufacturer's instructions. First‐strand cDNA was synthesized from 2 μL total RNA using the HiScript II QRT SuperMix for qPCR kit (+gDNA wiper) (Vazyme Biotech Co., Ltd, Beijing, China). Quantitative real‐time (qRT)‐PCR analysis was performed as described by Yang et al. ²⁶ The genes and corresponding primers used for qRT‐PCR are listed in Table 5. The 18S rRNA gene was used as an internal reference. ²⁷ Relative gene expression levels were calculated as described previously. ²⁸

Table 5.

Primer sequences of the defense‐related genes

Gene	Sequence
18S rRNA	TGCCGATGTCACTCCCAGAA
	CAGCGAACTTGGAACCGTAGA
PR1	CAGTGGTGACATAACAGGAGCAG
	CATCCAACCCGAACCGAAT
PR2	CCAATGGGTACAAAGAAACG
	AAACCAAGTAACCAATGAAAGG
PR10	AGCTAAGGGTGATGGAAAAACA
	TGAAAAGGTGATTTGCTTGAGA

2.7. Statistical analysis

Data were analyzed using excel 2010 (Microsoft, Redmond, WA, USA) and are presented as mean ± standard error (n = 3). Data normality was assessed before the statistical analysis. Analysis of variance (ANOVA) was performed using Spss 23.0 (IBM Corp., Armonk, NY, USA). Differences between two groups were analyzed by independent samples t‐test. One‐way and two‐way ANOVA, followed by Tukey's honestly significant difference (HSD) test, were used to evaluate plant growth, disease incidence, phenolic acid concentrations and PR gene expression. Statistical significance was set at P < 0.05. Figures were generated using origin 2024 (OriginLab Corp., Northampton, MA, USA).

3. RESULTS

3.1. Effects of biochar on faba bean growth and Fusarium wilt incidence

Compared with the untreated control, BC application promoted plant growth and alleviated Fusarium wilt [Fig. 1(E)]. Treatments B0.5–B1.5 significantly increased plant height by 13.01%, 21.73% and 20.39%, and root length by 20.25%, 39.89% and 35.71%, respectively. Concurrently, B1 treatment significantly reduced disease incidence by 28.57% and the disease index by 52.11% compared with B0 [Fig. 1(A)–(D)].

Figure 1.

Effects of biochar on the growth of continuously cropped faba bean and Fusarium wilt incidence: (A) plant height, (B) root length, (C) disease incidence, (D) disease index and (E) growth phenotype. Data are the mean values ± standard deviation of three biological replicates. Different lowercase letters indicate significant differences between treatments (P < 0.05).

3.2. Effect of biochar on phenolic acid adsorption in continuously cropped faba bean

As the application rate of wheat straw BC increased, the concentrations of cinnamic acid, benzoic acid, p‐hydroxybenzoic acid, ferulic acid and vanillic acid decreased progressively (Supporting information Fig. S1). Compared with B0, treatments B0.5–B3 significantly reduced cinnamic acid by 5.62–47.34%, benzoic acid by 34.89–73.07%, p‐hydroxybenzoic acid by 19.66–72.49%, ferulic acid by 17.84–53.76% and vanillic acid by 10.23–64.00%. These results indicate that BC directly adsorbs phenolic acids.

Compared with B0, treatments B0.5–B3 reduced cinnamic acid by 8.11–17.00%, p‐hydroxybenzoic acid by 12.76–39.78% and vanillic acid by 21.86–58.33%. Treatments B0.5–B2 further reduced benzoic acid by 11.28–25.56% and ferulic acid by 13.87–41.47% (Fig. 2). The 1% BC treatment showed the greatest reduction in phenolic acid levels in rhizosphere soil. These results indicate that BC reduces phenolic acid levels in the rhizosphere.

Figure 2.

Effects of biochar on phenolic acids in the rhizosphere of continuously cropped faba bean: (A) cinnamic acid, (B) benzoic acid, (C) p‐hydroxybenzoic acid, (D) ferulic acid and (E) vanillic acid. Data are the mean values ± standard deviation of three biological replicates. Different lowercase letters indicate significant differences between treatments (P < 0.05).

3.3. Effects of biochar on soil microbial diversity and community composition in the rhizosphere of continuously cropped faba bean

3.3.1. Microbial diversity and community composition in the rhizosphere of faba bean

Compared with B0, treatments B0.5–B3 significantly increased the Shannon index for both bacterial and fungal communities, whereas B1 significantly increased the Chao index [Fig. S3(A)]. Principal coordinate analysis (PCoA) showed that B1 significantly altered bacterial and fungal community structures compared with B0, with greater separation of sample points from the control [Fig. S3(B)]. These results indicate that BC application influences rhizosphere microbial communities, with the most pronounced effects observed at the 1% addition level.

At the phylum level, B1 treatment increased the relative abundances of Firmicutes, Actinobacteriota and Proteobacteria, whereas it decreased that of Acidobacteriota and Chloroflexi, compared with B0. It also increased the relative abundances of Mortierellomycota, Glomeromycota and Basidiomycota, while reducing that of Ascomycota [Fig. 3(A)].

Figure 3.

Effects of biochar on microbial community composition in the rhizosphere of continuously cropped faba bean: (A) community composition at the phylum level, (B) composition analysis at the genus level and (C) absolute abundance of beneficial bacteria (Sphingomonas sp. and Bacillus sp.) and the pathogenic fungus (Fusarium commune sp.).

At the genus level, B1 increased the relative abundances of Bacillus and Sphingomonas compared with B0, enhanced the relative abundance of Penicillium, and reduced the relative abundances of Gibberella and Fusarium [Fig. 3(B)]. Absolute quantification showed that B1 significantly increased the absolute abundances of Bacillus sp. and Sphingomonas sp. and decreased that of F. commune compared with B0 [Fig. 3(C)].

3.3.2. Correlation analysis

At the bacterial genus level, Sphingomonas, Bacillus and norank_f_Gemmatimonadaceae were negatively correlated with both disease index and phenolic acid concentrations (cinnamic acid, benzoic acid, p‐hydroxybenzoic acid, ferulic acid and vanillic acid) [Fig. 4(A)].

Figure 4.

Correlations among disease index, rhizosphere phenolic acids and microbial communities: (A) bacterial community and (B) fungal community. The colors represent the correlation coefficients (R), as indicated in the legend. Significance levels: *** P < 0.001; ** P < 0.01; and * P < 0.05.

At the fungal genus level, Fusarium and Penicillium were positively correlated with disease index and phenolic acid concentrations, whereas Gibberella showed a significant positive correlation with phenolic acids only [Fig. 4(B)].

3.4. Effect of biochar‐induced changes in rhizosphere microorganisms on Fusarium wilt and faba bean growth

A soil sterilization experiment was conducted to evaluate the effects of BC‐mediated microbial changes on disease incidence and faba bean growth. Compared with the control (RSB0), rhizosphere soil treated with BC significantly enhanced faba bean growth [Fig. 5(A)]. Under nonsterilized conditions, treatments RSB0.5–RSB2 increased plant height by 9.96–37.35%, root length by 29.29–98.21%, aboveground DW by 38.55–95.30% and belowground DW by 27.07–105.63%. Under sterilized conditions, compared with RSB0, treatments RSB0.5–RSB2 increased plant height by 21.73–37.48%, root length by 21.66–49.12%, aboveground DW by 12.50–41.84% and belowground DW by 32.58–77.67% [Fig. 5(B)]. Additionally, sterilization significantly promoted faba bean growth compared with nonsterilized conditions across RSB0–RSB3 treatments [Fig. 5(B)].

Figure 5.

Effects of biochar‐induced changes in rhizosphere microorganisms on Fusarium wilt and faba bean growth: (A) growth phenotype of faba bean; (B) plant height, root length, aboveground DW, belowground DW; disease incidence and disease index; and (C) disease index and DW. CC, nonsterilized continuous cropping soil; CCS, sterilized continuous cropping soil. RSB0, rhizosphere soil treated with 0% biochar; RSB0.5, 0.5% biochar; RSB1, 1% biochar; RSB1.5, 1.5% biochar; RSB2, 2% biochar; and RSB3, 3% biochar. Asterisks (*) indicate significant differences between sterilized and nonsterilized treatments at the same biochar level (P < 0.05). Data are the mean values ± standard deviation of three biological replicates.

With respect to disease resistance, under nonsterilized conditions, treatments RSB1 and RSB1.5 significantly reduced disease incidence by 35.29–41.18% and the disease index by 38.52–52.59% compared with RSB0. Under sterilized conditions, treatments RSB1 and RSB1.5 reduced disease incidence by 46.15–61.54% and the disease index by 73.91–78.53% compared with RSB0. Across RSB0–RSB3 treatments, sterilization significantly reduced disease incidence and disease index compared with nonsterilized conditions [Fig. 5(B)]. These results indicate that BC‐induced changes in rhizosphere microorganisms are associated with reduced Fusarium wilt and improved faba bean growth, with the strongest effects observed at a 1% BC application rate.

3.5. Effects of biochar‐induced changes in rhizosphere microorganisms on phenolic acid content in rhizosphere soil under continuous cropping of faba bean

In order to examine the role of microorganisms in phenolic acid degradation, rhizosphere soil regulated by BC was transferred to sterilized and nonsterilized soils. Under nonsterilized conditions, compared with RSB0, treatments RSB0.5–RSB1.5 reduced cinnamic acid by 11.76–23.77%, benzoic acid by 10.26–19.59%, p‐hydroxybenzoic acid by 12.62–27.91%, ferulic acid by 5.54–26.49% and vanillic acid by 14.82–52.44%. Under sterilized conditions, compared with RSB0, treatments RSB0.5–RSB3 showed an overall decreasing trend in cinnamic acid, benzoic acid, p‐hydroxybenzoic acid, ferulic acid and vanillic acid levels. Specifically, RSB1 treatment reduced the levels of these phenolic acids by 22.69%, 35.03%, 51.55%, 45.31% and 56.82%, respectively. Across RSB0–RSB3 treatments, sterilization significantly reduced phenolic acid levels compared with nonsterilized conditions (Fig. 6). These findings suggest that BC indirectly accelerates the degradation of phenolic acids in rhizosphere soil by modulating microbial communities, thereby reducing the phenolic acid content in the rhizosphere of faba bean.

Figure 6.

Effects of biochar‐induced changes in rhizosphere microorganisms on phenolic acid content in rhizosphere soil: (A) cinnamic acid, (B) benzoic acid, (C) p‐hydroxybenzoic acid, (D) ferulic acid and (E) vanillic acid. Data are the mean values ± standard deviation of three biological replicates.

3.6. Effects of biochar‐induced changes in rhizosphere microorganisms on microbial diversity and community composition in the rhizosphere of continuously cropped faba bean

Under both sterilized and nonsterilized conditions, the Shannon and Chao indices of bacterial and fungal communities were significantly higher in RSB1 than in RSB0. By contrast, sterilization significantly reduced both indices under RSB1 treatment compared with nonsterilized conditions [Fig. S4(A)]. PCoA [Fig. S4(B)] showed that bacterial and fungal community profiles in the RSB1 treatment were more clearly separated from those in RSB0 under both sterilized and nonsterilized conditions. Across RSB0–RSB3 treatments, microbial communities in sterilized soils were more distinct from those in nonsterilized soils. These findings suggest that rhizosphere microorganisms regulated by 1% wheat straw BC significantly modify bacterial and fungal community structures in the rhizosphere soil of faba bean.

At the phylum level within bacterial communities, under both sterilized and nonsterilized conditions, RSB1 treatment increased the relative abundances of Proteobacteria, Bacteroidetes and Actinobacteria, while decreasing that of Chloroflexi and Acidobacteria compared with RSB0. Within fungal phyla, RSB1 treatment decreased the relative abundance of Ascomycota compared with RSB0. Across RSB0–RSB3 treatments, sterilization reduced the relative abundance of Ascomycota and increased that of Basidiomycota and Zygomycota [Fig. 7(A)].

Figure 7.

Effects of biochar‐induced changes in rhizosphere microorganisms on microbial community composition in the rhizosphere of continuously cropped faba bean: (A) community composition at the phylum level, (B) community composition at the genus level and (C) absolute abundances of beneficial bacteria (Sphingomonas sp. and Bacillus sp.) and the pathogenic fungus (Fusarium commune sp.).

At the genus level, under nonsterilized conditions, RSB1 treatment increased the relative abundance of Flavobacterium compared with RSB0. Under sterilized conditions, RSB1 treatment increased the relative abundances of Massilia, Flavobacterium and Arthrobacter compared with RSB0. Within fungal genera, under both sterilized and nonsterilized conditions, RSB1 treatment decreased the relative abundance of Fusarium [Fig. 7(B)].

Absolute quantification showed that, under both sterilized and nonsterilized conditions, RSB1 significantly increased the absolute abundance of beneficial genera, including Sphingomonas sp. and Bacillus sp., while decreasing that of the pathogenic fungus F. commune compared with RSB0 [Fig. 7(C)]. These results indicate that BC enhances the enrichment of beneficial rhizosphere bacteria, thereby suppressing pathogen colonization in faba bean roots.

3.7. Effects of biochar‐induced changes in rhizosphere microorganisms on PR gene expression in roots of continuously cropped faba bean

Under nonsterilized conditions, RSB1 treatment significantly upregulated PR1, PR2 and PR10 expression by 215.09%, 198.57% and 90.45%, respectively, compared with RSB0. Under sterilized conditions, RSB1 treatment significantly increased the expression of PR1 by 191.52%, PR2 by 163.99% and PR10 by 36.57% compared with RSB0. Furthermore, under RSB1 treatment, sterilization markedly increased PR1, PR2 and PR10 expression by 84.19%, 73.95% and 18.73%, respectively, compared with nonsterilized conditions (Fig. 8). These results indicate that BC‐induced microbial changes can substantially upregulate PR gene expression in faba bean roots, thereby enhancing their defense responses. Adding an appropriate amount of wheat straw BC can reduce autotoxic substances, alter microbial communities and taxa, indirectly induce systemic resistance, and thereby decrease Fusarium wilt [Fig. 8(D)].

Figure 8.

Effects of biochar‐induced changes in rhizosphere microbiota on PR gene expression in roots of continuously cropped faba bean: (A) PR1, (B) PR2, (C) PR10 and (D) conceptual model. Data are the mean values ± standard deviation of three biological replicates.

4. DISCUSSION

4.1. Effects of biochar on faba bean growth and Fusarium wilt

Biochar plays an important role in improving crop yield and suppressing plant diseases. ²⁹ , ³⁰ Previous studies have shown that compared with control treatments, rice BC can significantly increase plant height, stem diameter and total biomass of tea plants. ³¹ Additionally, BC application has been reported to reduce the incidence of tomato Fusarium wilt. ³⁰ The results of this study showed that compared with treatments without wheat straw BC, BC application significantly promoted faba bean growth and reduced the incidence of Fusarium wilt (Fig. 1). Moreover, the strongest effects on faba bean growth and disease suppression were observed at a BC application rate of 1%. In general, low doses of BC can suppress plant diseases and promote plant growth, whereas high doses are less effective and may even promote disease development and inhibit plant growth. ³² , ³³ , ³⁴ BC may exert these effects indirectly by altering soil physicochemical properties such as pH, moisture and nutrient availability. ²⁹ In this study, compared with the control, the application of 1% wheat straw BC significantly increased soil pH and nutrient availability (Fig. S2). These results indicate that an appropriate level of BC application is important for maintaining soil chemical stability and promoting healthy faba bean growth.

4.2. Regulatory effects of biochar on soil microbial communities

Soil microorganisms play a crucial role in ecosystems and are key determinants of soil fertility, quality and productivity. ³⁵ Han et al. ³⁶ reported that BC application enhanced microbial community richness and diversity in soils under continuous cotton cropping, which is consistent with our findings. In this study, compared with the control treatment, the application of wheat straw BC and soil transplantation increased the Shannon and Chao indices of bacterial and fungal communities in the rhizosphere of faba bean [Figs S3(A) and S4(A)]. In particular, microbial diversity was highest under unsterilized soil transplantation [Fig. S4(A)]. These results indicate that BC application enhances soil microbial community diversity. PCoA results also showed that the addition of wheat straw BC and soil transplantation altered bacterial and fungal community structures in the rhizosphere compared with the control [Figs S3(B) and S4(B)]. This suggests that BC can restructure the rhizosphere microbial community of faba bean. However, further research is required to clarify how wheat straw BC indirectly suppresses pathogens through microbial regulation.

Specific or functionally specialized microbial taxa are particularly important for the occurrence and control of soilborne diseases. ³⁷ At the phylum level, Proteobacteria, Actinobacteriota and Bacteroidota were enriched in soils treated with wheat straw BC, with the highest enrichment observed under the 1% BC treatment [Fig. 7(A)]. Previous studies have shown that BC application significantly increases the abundance of Pseudomonas sp. in the rhizosphere of tomato plants compared with the control. ³⁰ In this study, BC application increased the relative abundances of Sphingomonas and Bacillus and decreased that of Fusarium [Fig. 3(B)]. The qPCR results further showed increased gene copy numbers of Sphingomonas sp. and Bacillus sp. and decreased gene copy numbers of F. commune [Fig. 3(C)]. Sphingomonas sp. and Bacillus sp. are known to play important roles in antagonizing soilborne fungi. ³⁸ , ³⁹ In the subsequent unsterilized and sterilized soil transplantation experiments, wheat straw BC likewise increased the gene copy numbers of Sphingomonas and Bacillus, while decreasing the Fusarium relative abundances and gene copy numbers of F. commune [Fig. 7(A), (B)]. Moreover, the abundances of Sphingomonas sp. and Bacillus sp. showed a trend of initially increasing and then decreasing, and F. commune exhibited a similar trend. This pattern may be related to the legacy effect of optimal 1% wheat straw BC application on specific beneficial microorganisms, including Sphingomonas sp. and Bacillus sp. ⁴⁰ , ⁴¹ Under resource‐limited conditions (i.e. limited BC and carbon sources), Sphingomonas sp. and Bacillus sp. may exhibit stronger competition against F. commune. As the BC application rate increases, rhizosphere resources become more abundant, and the selective competitive advantage of Sphingomonas sp. and Bacillus sp. over F. commune may be reduced.

4.3. Effects of biochar on autotoxic substances in soil

Continuous cropping over multiple years can lead to the accumulation of allelochemicals released by plants. These compounds are considered primary sources of autotoxins or contributors to soilborne pathogen populations, which directly or indirectly induce crop rotation disorders. ⁴² Owing to its abundant surface functional groups and porous structure, BC has a strong capacity to adsorb harmful substances. ⁴³ , ⁴⁴ Previous studies have reported that BC application reduces coumaric acid accumulation in the rhizosphere of tobacco plants. ⁴⁵ In the present study, increasing the application rate of wheat straw BC reduced phenolic acid concentrations in the solution (Fig. S1). However, in the BC addition and soil transplantation experiments, phenolic acids in rhizosphere soil showed a trend of initially decreasing and then increasing (Figs 2 and 6). This pattern may be related to the increase in beneficial microorganisms following BC application, some of which can degrade phenolic acids. For example, Sphingomonas plays an important role in phenolic acid degradation. ⁴⁶ Compared with appropriate BC application rates, higher application rates resulted in increased phenolic acid levels. This may be associated with enhanced rhizosphere resource availability under high BC addition, which reduces the competitive advantage of beneficial microorganisms over F. commune, allowing it to persist and potentially increase the secretion of phenolic acids by faba bean roots. Our previous study showed that Fusarium oxysporum f. sp. fabae promotes the secretion of phenolic acids by faba bean roots. ⁸

4.4. Biochar enhances specific plant defense responses in faba bean against pathogen infection

Upon pathogen infection, the expression of PRs (pathogenesis‐related protein genes) plays a crucial role in plant disease resistance. ⁴⁷ Based on their structural and functional similarities, PR proteins are classified into 17 families. ⁴⁸ , ⁴⁹ Among these, PR1 expression exhibits antifungal activity, ⁵⁰ PR2 expression is associated with β‐1,3‐glucanase activity, ⁵¹ and PR10 proteins possess RNase activity, which enables the degradation of pathogen RNA and suppresses pathogen growth and reproduction. ⁵² In this study, the soil transplantation experiment showed that, compared with the control treatment, the application of an appropriate amount of BC upregulated the expression of PR1, PR2 and PR10 genes in faba bean roots (Fig. 8). This may be related to the increase in beneficial microorganisms, which not only induce host resistance, but also antagonize Fusarium, thereby alleviating stress on the host. Therefore, beneficial microorganisms stimulated in the rhizosphere may act as potential elicitors of BC‐mediated priming for systemic resistance.

5. CONCLUSION

The accumulation of phenolic acids and proliferation of pathogenic populations are key factors contributing to the high incidence of soilborne crop diseases. The application of wheat straw BC can adsorb phenolic acids, regulate soil microbial communities and alleviate the effects of Fusarium wilt. The rhizosphere soil experiment further confirmed that wheat straw BC enriched beneficial bacteria (Sphingomonas and Bacillus) in the faba bean rhizosphere while reducing the abundance of Fusarium. BC application also promoted phenolic acid degradation by regulating functional microbial groups, thereby lowering phenolic acid levels. Additionally, BC application upregulated the expression of defense‐related proteins in faba bean roots, enhancing plant defense responses against pathogen invasion. Consequently, wheat straw BC effectively mitigated Fusarium wilt and improved plant growth. Overall, BC application is a promising strategy for managing soilborne diseases and improving soil health.

FUNDING INFORMATION

This work was supported by the National Key Research and Development Program of China (2022YFD1901503‐4).

CONFLICT OF INTEREST

All co‐authors have no conflicts of interest.

Supporting information

Figure S1. Effects of biochar application on the adsorption of phenolic acids at different addition levels: (A) cinnamic acid, (B) benzoic acid, (C) p‐hydroxybenzoic acid, (D) ferulic acid and (E) vanillic acid. Different lowercase letters indicate significant differences between treatments (P < 0.05).

Figure S2. Biochar effects on soil chemical properties in faba bean monocropping soil: (A) soil pH, (B) soil organic matter, (C) soil alkali‐hydrolyzable nitrogen, (D) soil available phosphorus and (E) soil available potassium. Different lowercase letters indicate significant differences between treatments (P < 0.05).

Figure S3. Effects of biochar on microbial diversity in the rhizosphere of continuously cropped faba bean: (A) α diversity and (B) β diversity of bacterial and fungal communities.

Figure S4. Effects of biochar‐induced changes in rhizosphere microorganisms on microbial diversity in rhizosphere soil under continuous cropping: (A) α diversity and (B) β diversity.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.