Comparative analyses of the Serratia marcescens complex reveal variations in their pathogenicity against a fruit pest

Zi‐yuan Li; Xiang Li; Lu‐chen Xu; Miao‐miao Zhang; Yong‐yue Lu; Yi‐xiang Qi

doi:10.1002/ps.70969

. 2026 May 28;82(9):9249–9263. doi: 10.1002/ps.70969

Comparative analyses of the Serratia marcescens complex reveal variations in their pathogenicity against a fruit pest

Zi‐yuan Li ¹, Xiang Li ¹, Lu‐chen Xu ¹, Miao‐miao Zhang ¹, Yong‐yue Lu ^1,^✉, Yi‐xiang Qi ^1,^✉

PMCID: PMC13453261 PMID: 42210564

Abstract

BACKGROUND

Members of the Serratia marcescens complex are opportunistic pathogens affecting a wide range of plants and animals. They are often present in the intestinal tract of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). However, their virulence and interactions with the host remain poorly understood.

RESULTS

Four strains of S. marcescens complex from diverse sources were isolated and characterized. Hemolymph injection caused significantly higher mortality in B. dorsalis compared with oral infection across all four strains. The gut‐derived Bd_SM strain from B. dorsalis showed the lowest virulence, whereas strains from the gut of Bactrocera correcta (Bezzi) (Diptera: Tephritidae) (Bc_SM), Aedes aegypti (L.) (Diptera: Culicidae) (Aa_SM), and a dead B. dorsalis adult (DBd_SM) demonstrated markedly higher virulence. Host immune responses varied with infection route and bacterial strain. Specifically, oral infection induced dose‐dependent gut immune responses, whereas hemolymph injection triggered strain‐specific antimicrobial peptide (AMP) gene activation. Consistent with these phenotypic observations, integrated in vitro assays and comparative genomic analyses revealed substantial variation in predicted virulence determinants, with Bd_SM possessing the fewest such factors.

CONCLUSION

Strains of the S. marcescens complex exhibited differences in virulence and triggered distinct immune responses in B. dorsalis. These findings enhance our understanding of strain‐specific host–microbe interactions and elucidate genomic determinants underlying pathogenicity. © 2026 Society of Chemical Industry.

Keywords: immune, opportunistic pathogen, Tephritidae, virulence

Strain‐specific virulence and genomic traits of Serratia marcescens complex isolated from different insect hosts highlight their potential roles in biological control of the fruit pest Bactrocera dorsalis.

graphic file with name PS-82-9249-g003.jpg

1. INTRODUCTION

The insect gut microbiota has been recognized as an important target for insect population regulation, ¹ , ² , ³ given its critical role in host nutrition and metabolism, insecticide resistance, immune regulation, and reproductive development. ⁴ , ⁵ , ⁶ , ⁷ Within these microbial communities, certain gut‐associated opportunistic pathogens have garnered increasing attention. ⁸ , ⁹ , ¹⁰ Opportunistic pathogens can exist as commensals within the host. However, when the host undergoes stress due to pesticides, antibiotics, or other factors that compromise the gut barrier or suppress immune function, these bacteria may invade the hemolymph. This invasion can lead to septicemia and ultimately result in host mortality. ¹¹ , ¹² Moreover, opportunistic pathogens isolated from dying or moribund insects exhibit significant insecticidal activity. ¹³ , ¹⁴ , ¹⁵ Consequently, there is growing interest in utilizing opportunistic pathogens as tools for pest biological control. Such applications hold promise not only for protecting beneficial insects but also for suppressing major pest species. ¹ , ² , ¹⁶ , ¹⁷

Among these opportunistic pathogens, members of the Serratia marcescens complex are frequently associated with diverse insect hosts, and their pathogenic effects on insects have been widely reported. ¹⁸ , ¹⁹ This complex includes multiple phylogenetic species, such as Serratia nematodiphila, Serratia marcescens, Serratia bockelmannii, Serratia ureilytica, and Serratia nevei. ²⁰ Notably, all species within the S. marcescens complex have been isolated from insect hosts or entomopathogenic nematodes. ¹⁹ , ²¹ , ²² Several studies have demonstrated the insecticidal activity of S. marcescens strains against agricultural and forestry pests. For example, S. marcescens exhibits strong insecticidal activity against the termite Odontotermes formosanus Shiraki, ²³ Spodoptera litura (Fabricius), ²⁴ Spodoptera frugiperda (J. E. Smith), ¹⁶ Bactrocera dorsalis (Hendel), ²⁵ Rhynchophorus ferrugineus (Olivier) ²⁶ and Mythimna separata (Walker), ¹⁶ highlighting the potential of S. marcescens as microbial agents for pest management. Furthermore, investigating how different strains interact with host immune systems and vary in pathogenicity is essential for the development of new insect control strategies based on the manipulation of host‐pathogen immune interactions. ²⁷

Recent studies have shown that strains of the S. marcescens complex isolated from different insect hosts exhibit variation in virulence toward insects and may provoke distinct immune responses. ²¹ , ²⁴ For example, oral infection in Drosophila activates the IMD pathway and induces the production of reactive oxygen species ²⁸ , ²⁹ ; in honey bees, strains from different origins vary in both virulence and the magnitude of the immune responses they elicit. ¹⁴ Similarly, different strains of S. marcescens induce distinct immune responses in mosquitoes, with specific strains activating the IMD signaling pathway and upregulating anti‐Plasmodium effectors. ³⁰ Moreover, strains isolated from dead beetles, termites, or moths have demonstrated significant pathogenicity and immune‐stimulating activity against both their original hosts and other insect pests. ¹ , ²⁵ , ³¹ , ³² , ³³

Bactrocera dorsalis is a globally important pest of fruit crops, characterized by its wide host range, high reproductive capacity, and remarkable adaptability to various and extreme environments. ³⁴ , ³⁵ , ³⁶ This pest inflicts considerable damage on numerous economically vital fruit crops worldwide. ³⁴ , ³⁷ , ³⁸ Currently, management strategies primarily depend on chemical insecticides and parapheromone traps. ³⁹ However, long‐term application of these measures has resulted in challenges such as environmental pollution, pesticide residues, and the development of insecticide resistance. ⁴⁰ , ⁴¹ As a result, the development of safe and sustainable biological control strategies has emerged as a key focus of current research. ⁴² , ⁴³

Serratia marcescens is commonly detected in the guts of dipteran insects, including tephritid pests and mosquitoes. ³⁰ , ⁴⁴ , ⁴⁵ , ⁴⁶ Current understanding of the pathogenic potential and virulence mechanisms of the S. marcescens complex toward B. dorsalis, whether isolated from its gut or other hosts, remains limited. In particular, it is unclear whether strains derived from different sources exhibit variations in their virulence against B. dorsalis, whether they activate distinct immune signaling pathways, and whether such differences correlate with underlying genomic variation. Clarifying these strain‐specific differences in virulence and immune interactions will facilitate the evaluation of S. marcescens strains as potential microbial agents for the biological control of B. dorsalis. In this study, four strains of the S. marcescens complex were examined, including one isolated from the gut of B. dorsalis, one from deceased B. dorsalis individuals, and two sourced from the guts of other dipteran insects. Their virulence toward B. dorsalis and their impacts on the regulation of immune‐related genes were systematically assessed. Additionally, comparative genomic analyses were performed to explore potential factors contributing to variation in virulence, thereby offering insights that may enhance the understanding of host–microbe interactions and guide pathogen‐mediated biological control strategies for insect pests.

2. MATERIALS AND METHODS

2.1. Insects

Adult B. dorsalis and Bactrocera correcta (Bezzi) were reared in wooden cages measuring 30 cm × 30 cm × 30 cm. They were provided with a diet consisting of yeast and sucrose mixed at a ratio of 1:1 (w/w), along with access to water. Adult Aedes aegypti (L.) were maintained in a cage with unlimited access to cotton balls moistened with a sterile 10% sucrose solution. The insects were maintained at a temperature of 27 ± 1 °C and relative humidity of 75 ± 1%, under a photoperiod comprising 14 h of light and 10 h of darkness. All insect rearing and survival assays were conducted under these conditions.

2.2. Bacterial strains

Bacterial isolates utilized in this study were obtained from the midguts of B. dorsalis, B. correcta, and A. aegypti, as well as from a dead B. dorsalis that was naturally infected with pathogenic bacteria (Table 1). To isolate gut‐associated bacteria, adults of B. dorsalis, B. correcta, and A. aegypti were surface‐sterilized with 75% ethanol for 3 min, followed by three rinses in sterile phosphate‐buffered saline (PBS) at pH 7.4. The intestinal tracts were aseptically dissected and homogenized in 200 μL sterile PBS. The resulting homogenates were serially diluted with PBS and plated onto Luria–Bertani (LB) agar plates. All single colonies appearing within 24 h were restreaked to obtain pure cultures. Genomic DNA from each isolate was extracted using the Tianamp Bacteria DNA Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The isolated bacterial DNA was then PCR‐amplified using universal primers for the 16S rRNA gene: 27F (5’‐AGAGTTTGATCCTGGCTCAG‐3′) and 1492R (5’‐GGTTACCTTGTTACGACTT‐3′). PCR products were Sanger sequenced by Sangon Biotech (Shanghai) Co., Ltd. Sequence identities were determined using BLASTn searches against the NCBI non‐redundant database, and isolates showing 99% identity to S. marcescens were identified. Among these, one representative strain was randomly selected from each host species (B. dorsalis, B. correcta, and A. aegypti) for further experiments. For the dead B. dorsalis individual, pink‐pigmented colonies characteristic of S. marcescens were preferentially selected and subsequently confirmed by 16S rRNA sequencing. In total, four strains belonging to the S. marcescens complex were selected for subsequent characterization and infection assays.

Table 1.

Bacterial strains of Serratia marcescens complex and their sources

Strain	Source of isolation	Geographical origin
Bd_SM	Bactrocera dorsalis gut isolation	Guangzhou, China
Bc_SM	Bactrocera correcta gut isolation	Guangzhou, China
Aa_SM	Aedes aegypti gut isolation	Guangzhou, China
DBd_SM	Pink‐dead B. dorsalis	Guangzhou, China

Open in a new tab

2.3. Genomic DNA extraction

The four strains were streaked on LB agar plates and incubated at 37 °C for 12 h. A single colony from each plate was inoculated into 200 mL of LB broth and cultured at 37 °C with shaking at 150 rpm for approximately 12 h. Cells were harvested by centrifugation at 12 000 × g for 10 min. Genomic DNA from the four strains was extracted using a bacterial/fungal DNA extraction kit with magnetic beads (Shanghai Major Biomedical Technology Co., Ltd, Shanghai, China) according to the manufacturer's instructions. The purified genomic DNA was quantified, and high‐quality DNA was used for subsequent analyses.

2.4. Library construction and genome sequencing

Library construction and genome sequencing were performed by Shanghai Major Biomedical Technology Co., Ltd (Shanghai, China). Genomic DNA from each strain was sequenced using a combination of PacBio Sequel IIe and Illumina sequencing platforms. For the Illumina sequencing, genomic DNA was sheared into 400–500 bp fragments using a Covaris M220 Focused Acoustic Shearer according to the manufacturer's protocol. Sequencing libraries were prepared from the sheared fragments using the NEXTFLEX Rapid DNA‐Seq Kit, which included end repair, A‐tailing, adapter ligation, and PCR enrichment. The libraries were subsequently sequenced on an Illumina NovaSeq 6000 platform in paired‐end mode (2 × 150 bp) (Illumina Inc., San Diego, CA, USA). For PacBio sequencing, genomic DNA was sheared into approximately 10 kb fragments, purified, end‐repaired, and ligated with SMRTbell adapters following the manufacturer's recommendations (Pacific Biosciences, CA). The PacBio library was then prepared and sequenced on a single SMRT cell using standard protocols.

2.5. Average nucleotide identity (ANI) analysis and phylogenetic analysis

The complete genome sequences of 74 Serratia strains, representing various species, were obtained from the NCBI database (Supporting Information, Table S1). Average Nucleotide Identity (ANI) analysis was performed using pyani (version 0.2.12) to evaluate genome‐wide nucleotide similarity among the strains.

Genome sequences of Serratia species with ANI values exceeding 95%, including S. bockelmannii, S. marcescens, S. montpellierensis, S. nematodiphila, S. nevei, S. sarumanii, S. surfactantfaciens, and S. ureilytica, were also retrieved from the NCBI database for phylogenomic analysis (Supporting Information, Table S2). These genomes were annotated using Prokka (v1.13.3) to predict gene features. Core genome identification was performed using Roary (v3.12.0) with an identity threshold of 85% to cluster homologous genes shared among all strains. The core protein sequences were aligned individually with MAFFT (v7.407), and the resulting alignments were concatenated to generate a comprehensive sequence representing each genome. Unreliable and ambiguously aligned regions were removed using Gblocks (v0.91b) to retain high‐confidence sites for phylogenetic inference. The best‐fit substitution model was determined by ModelFinder within IQ‐TREE2 based on the Bayesian Information Criterion (BIC). Maximum likelihood phylogenetic trees were constructed using IQ‐TREE2 under the selected model (LG + F + R4), with branch support assessed by 1000 bootstrap replicates. Finally, the phylogenetic tree was visualized and annotated using the Interactive Tree Of Life (iTOL) online tool.

2.6. Survival assays

Survival assays were conducted following the method described by Raymann et al. ¹⁴ Briefly, the virulence of bacterial strains against B. dorsalis was assessed using three exposure methods: feeding, immersion, and hemolymph injection.

For feeding exposure, bacterial cells were suspended in 10% sucrose solution (10% sucrose alone served as the control), ²⁹ , ⁴⁷ adjusted to an optical density (OD) at 600 nm of 1, and provided to B. dorsalis for 24 h. Flies were starved for 12 h before feeding exposure. ²⁵

For immersion exposure, flies were immobilized at 4 °C in 50 mL Falcon tubes, then 10 μL of bacterial suspension (bacteria at an OD of 1 diluted in PBS; PBS alone served as control) was applied per fly. The tubes were gently shaken for 15 s to ensure complete contact between the insect body and the suspension, after which flies were transferred to rearing boxes.

For hemolymph injection, the bacterial suspension (bacteria at an OD of 1 in PBS) was serially diluted to 10⁻⁶ in PBS. A volume of 1 μL of the diluted suspension was injected into the thorax of each fly using a fine‐tipped glass capillary needle, with sterile PBS injections serving as controls. Each bacterial strain constituted a treatment group, with 20 flies per rearing box and 10 replicates per treatment. Survival was monitored every 12 h over a 72‐h period.

The Kaplan–Meier survival curves were generated using the ‘survival’ package ⁴⁸ in R (http://www.r-project.org) and statistical significance was evaluated using the log‐rank test. Visualization of survival data was performed in Origin 2021 (OriginLab Corporation, Northampton, MA, USA).

2.7. Immune response of Bactrocera dorsalis to Serratia marcescens complex infection

At 12 h after exposure to S. marcescens complex strains, flies exposed by injection (as described above in ‘Survival assays’), or by feeding with 10% sucrose solutions containing bacterial suspensions adjusted to an OD of 0.1, 1, or 5 were collected from five biological replicates. In each replicate, the abdomens of injected flies (10 flies per group) and the midguts of fed flies (20 flies per group) were dissected and transferred to RNase‐free 1.5‐mL tubes. Total RNA was isolated from the abdomens or midguts using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Single‐strand cDNA was synthesized from 1 μg total RNA using a PrimeScript™ RT reagent Kit (Perfect Real Time) (Takara Biomedical Technology (Beijing) Co., Ltd.) and used as a template for quantitative PCR (qPCR).

Expression levels of genes encoding antimicrobial peptides (AMPs), phenoloxidase, and dual oxidase (Duox) were determined in both exposed and unexposed B. dorsalis and normalized to the reference gene α‐Tubulin (primers listed in Supporting Information, Table S3). The qPCR reactions were performed on an Applied Biosystems™ 7500 PCR system (Thermo Fisher Scientific Inc., Waltham, MA, USA) using TB Green Premix Ex Taq II (Tli RNase H Plus) (Takara Biomedical Technology (Beijing) Co., Ltd.). Thermal cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. Each sample was run with three technical replicates, and no‐template negative controls were included to check for contamination. Relative transcript levels were quantified using the 2^−ΔΔCT method. Data visualization for quantitative results was conducted in GraphPad Prism 9 (GraphPad Software, San Diego, CA, USA).

2.8. In vitro assays of virulence factors

Protease activity assay was performed following Raymann et al. ¹⁴ Briefly, milk agar plates were prepared by dissolving 2.5 g yeast extract and 7.5 g agar in 350 mL water, and 15 g milk powder in 150 mL water. Both solutions were autoclaved separately, cooled, mixed, and poured into plates. Then, 1 μL of bacterial PBS suspension (OD = 1) was spot plated onto the milk agar plates, which were incubated at 25 °C, 30 °C, and 37 °C. Protease activity was assessed after 24 and 48 h. Protease activity was determined by the presence of a clear zone surrounding the bacterial colony.

Hemolytic activity assay was conducted using blood agar plates (Huankai Microbial, Guangzhou, China). Bacterial suspensions (OD = 1 in PBS) were streaked onto the plates and incubated at 25 °C, 30 °C, and 37 °C. Hemolytic activity was evaluated at 24 and 48 h by observing the formation of a clear hemolysis zone surrounding bacterial growth.

Swimming and swarming motility assays were performed as follows: Swim plates contained 5 g peptone, 3 g yeast extract, and 0.3% agar per liter of water; 1 μL of a 10⁻³ diluted bacterial suspension (OD = 1) was stab‐inoculated in the center. Swarm plates had the same components but with 0.5% agar; 1 μL of diluted suspension was spotted centrally. Both assays were incubated at 25 °C, 30 °C, and 37 °C and assessed at 24 and 48 h.

Gelatinase hydrolysis test used gelatin biochemical tubes (Qingdao Hope Bio‐Technology Co., Ltd., Qingdao, China). A single bacterial colony was stab‐inoculated into gelatin medium and incubated at 25 °C, 30 °C, and 37 °C. After 24 and 48 h, tubes were chilled at 4 °C for 10 min, and medium liquefaction was observed.

DNase activity assay was performed on DNase test agar plates containing methyl green (Rebio Biotechnology Co., Ltd., Shanghai, China). Single colonies of each strain were streaked on plates and incubated at 25 °C, 30 °C, and 37 °C. DNase activity was assessed at 24 and 48 h by observing a clear halo surrounding the bacterial growth along the streak lines, indicating DNA hydrolysis.

Siderophore detection was carried out using CAS detection agar plates (Qingdao Hope Bio‐Technology Co., Ltd., Qingdao, China). Single bacterial colonies were streaked on plates and incubated at 25 °C, 30 °C, and 37 °C. Siderophore production was evaluated at 24 and 48 h by observing a color change from blue to orange/yellow in the medium surrounding bacterial growth, indicating iron chelation.

Urease activity assay was performed on urease agar base plates containing phenol red (Qingdao Hope Bio‐Technology Co., Ltd., Qingdao, China). Single colonies of each strain were streaked on plates and incubated at 25 °C, 30 °C, and 37 °C. Urease activity was assessed at 24 and 48 h by observing a color change of the medium from yellow to pink, indicating ammonia production.

2.9. Comparative genomics

Coding sequences (CDS) in the genome were predicted using Prodigal v2.6.3, ⁴⁹ tRNAs using tRNAscan‐SE v2.0, ⁵⁰ and rRNAs using Barrnap v0.9 (https://github.com/tseemann/barrnap). Functional annotation of the predicted CDS was performed via sequence alignment tools including BLASTP, Diamond, and HMMER against databases such as NR, Swiss‐Prot, Pfam, GO, COG, KEGG, and VFDB. For gene cluster comparison, ⁵¹ , ⁵² , ⁵³ Clinker was employed for visualization. ⁵⁴

3. RESULTS

3.1. Genomic features, genomic average nucleotide identity (ANIm) and phylogenetic analysis

Four strains of the S. marcescens complex were obtained. Bd_SM, Bc_SM, and Aa_SM were isolated from the intestine of B. dorsalis, B. correcta, and A. aegypti, respectively. The strain DBd_SM was isolated from a dead B. dorsalis that exhibited signs of infection, which were characterized by pink pigmentation.

The genomes of the four strains within the S. marcescens complex consist of circular chromosomes with sizes measuring 5 039 769 bp for Bd_SM, 5 187 586 bp for Bc_SM, 5 279 414 bp for Aa_SM, and 5 095 984 bp for DBd_SM. These genomes encode a total of 4632 proteins in Bd_SM; 4761 in Bc_SM; 4858 in Aa_SM; and 4668 in DBd_SM. Bd_SM had a notably smaller chromosome than the other three strains (Table 2).

Table 2.

Genomic features of four Serratia marcescens complex strains

Feature	Bd_SM	Bc_SM	Aa_SM	DBd_SM
Size (bp)	5 039 769	5 187 586	5 279 414	5 095 984
G + C content (%)	59.61	59.52	59.72	59.59
CDS	4632	4761	4858	4668
Coding density (%)	87.51	87.28	87.49	87.41
Mean CDS (bp)	952.18	950.96	950.82	954.24
Repeated regions (%)	0.16	0.11	0.22	0.17
rRNA operons	22	22	22	22
tRNAs	86	89	87	88
IS elements	3	1	3	1
Prophages	3	3	4	1
Pseudogenes	281	299	287	284

Open in a new tab

Members of the S. marcescens complex cannot be reliably distinguished based on 16S rRNA sequencing or matrix‐assisted laser desorption/ionization time‐of‐flight mass spectrometry (MALDI‐TOF MS). ²⁰ , ⁵⁵ To further identify the bacterial species, average nucleotide identity (ANI) analysis was performed with 74 Serratia strains. Results showed that all four isolated strains shared ANI values >95% with S. marcescens strains (Fig. 1(a), Supporting Information, Table S4). Bd_SM and Aa_SM showed the highest ANI values with two S. nevei strains, at 98% and 99%, respectively. Bc_SM displayed the highest ANI (99%) with two S. ureilytica strains. DBd_SM shared the highest ANI (98.838%) with one S. marcescens strain (EGD‐HP20), followed by 98.837% and 98.830% with two S. nematodiphila strains (Fig. 1(a), Supporting Information, Table S4). ANI analysis comfirmed that all four strains are members of S. marcescens complex.

(a) Heatmap of ANIm percentage identity for 74 genomes of *Serratia* obtained from RefSeq and (b) whole‐genome phylogenetic tree of *Serratia marcescens* complex strains.

Phylogenomic tree analysis of strains with ANI greater than 95% with S. marcescens (including species within the S. marcescens complex) revealed a clustering trend among strains with similar origins (Fig. 1(b)). Strain Bd_SM clustered within the human and environmental derived branch, whereas Aa_SM and Bc_SM were grouped in the insect‐isolated branch. Additionally, strain DBd_SM was positioned in a branch that included a higher proportion of insect‐ and plant‐derived strains.

3.2. Virulence of four Serratia marcescens complex strains against Bactrocera dorsalis

In vivo virulence assays demonstrated that all four strains were pathogenic to B. dorsalis, and a clear virulence gradient was observed across the infection routes (Fig. 2). Hemolymph injection resulted in the highest mortality among the three exposure methods, as survival rates significantly decreased within 72 h after injecting the four strains, resulting in over 50% mortality (Fig. 2(a)). Among these strains, Bc_SM injection resulted in the highest mortality rate at 72 h (98.00%, P<0.0001), followed by DBd_SM (79.00%, P<0.0001) and Aa_SM (8 Kaplan–Meier survival curves 0.00%, P < 0.0001), while Bd_SM injection exhibited the lowest mortality rate (58.00%, P < 0.0001).

Kaplan–Meier survival curves of adult *Bactrocera dorsalis* following hemolymph injection (a), immersion exposure (b) and feeding exposure (c) to four strains of the *S. marcescens* complex are indicated. Survival differences among treatments were assessed by the log‐rank (Mantel–Cox) test. *P < 0.05, **P < 0.01, *** P < 0.001.

Following hemolymph injection, immersion also led to significant decreases in survival rates for B. dorsalis immersed in bacterial suspensions at an OD of 1 (Fig. 2(b)). Treatment with DBd_SM caused the highest mortality rate at the end of the observation period (75.50%, P < 0.0001). In comparison to other methods, feeding exposure yielded a higher survival rate exceeding 70%; however, this was still significantly lower than that observed in the control group. Similarly, treatment with Bc_SM resulted in the lowest survival rate during feeding assays (73.50%, P = 0.0009).

Among all tested strains, Bd_SM, identified as a gut symbiont of B. dorsalis—demonstrated the weakest pathogenicity across all three infection methods; conversely, Bc_SM exhibited the highest virulence levels. It is noteworthy that despite its higher genomic similarity to Bd_SM, Aa_SM, a gut isolate from A. aegypti, displayed stronger pathogenicity towards B. dorsalis.

3.3. Immune gene expression in infected Bactrocera dorsalis

To further investigate how these strain‐specific differences in virulence manifest within the host, the immune responses of B. dorsalis to each strain were examined under gut and hemolymph infection conditions. Results indicate that the S. marcescens complex elicited distinct gut immune responses in a dose‐dependent manner. At the lowest concentration (OD of 0.1), none of the strains activated the expression of gut antimicrobial peptides (AMPs), BdPhenoloxidase, or BdDuox (Fig. 3(A)). In contrast, oral administration at OD of 1 with Aa_SM significantly upregulated the expression of multiple AMPs, including Bdcecropin, Bdattacin, Bdphormicin, and Bddefensin (Fig. 3(B)). However, at the highest concentration (OD = 5), Aa_SM no longer significantly induced immune gene expression; instead, both Bd_SM and DBd_SM markedly upregulated AMP gene expression in the gut, with DBd_SM also activating BdDuox (Fig. 3(C)).

Immune‐related gene expression in the midgut of *Bactrocera dorsalis* following oral infection with four strains of *Serratia marcescens* complex at different concentrations. (a) OD = 0.1; (b) OD = 1; (c) OD = 5. Different letters indicate significant differences in relative gene expression, as determined by Kruskal–Wallis test followed by Dunn's *post hoc* test for multiple comparisons (P < 0.05).

For hemolymph injection, all four strains from the S. marcescens complex successfully activated AMP gene expression (Fig. 4). Nevertheless, the specific peptides induced varied among these strains. For instance, Bd_SM, Bc_SM, and DBd_SM increased the expression levels of BdSapecin significantly; conversely, Aa_SM notably promoted the expression of both BdCecropin and BdAttacin. Despite these findings, injection with any of the four strains did not affect either BdPhenoloxidase or BdDuox in B. dorsalis abdomen (Fig. 4).

Immune‐related gene expression in the abdomen of *Bactrocera dorsalis* following hemolymph injection with four strains of *Serratia marcescens* complex. Different letters indicate significant differences in relative gene expression, as determined by Kruskal–Wallis test followed by Dunn's *post hoc* test for multiple comparisons (P < 0.05).

3.4. In vitro virulence characteristics of four Serratia marcescens complex strains

Several enzymatic activities and motility traits, including siderophore production, protease, ⁵⁶ , ⁵⁷ gelatinase, ⁵⁸ , ⁵⁹ DNase, ⁶⁰ hemolytic activity, ⁶¹ , ⁶² as well as swimming and swarming ⁶³ , ⁶⁴ are associated with bacterial virulence and may contribute to colonization and competition within the host. To determine whether the four strains possessed these phenotypes, we performed assays for enzymatic activities and motility. In vitro assays revealed that three gut‐isolated S. marcescens complex strains did not produce prodigiosin across the temperatures tested. However, strain DBd_SM showed temperature‐dependent production, synthesizing the pigment at 25 °C and 30 °C, but not at 37 °C. In contrast, these three strains exhibited urease activity, while DBd_SM showed no such activity (Fig. 5). All four strains demonstrated protease, gelatinase, and DNase activities, as well as the production of siderophores. Additionally, they displayed both swimming and swarming motility. Hemolytic activity was detected in Bc_SM and Aa_SM but was absent in Bd_SM and DBd_SM across all tested temperatures (Fig. 5).

*In vitro* assays of virulence‐associated enzymatic activities. (a) Presence or absence of enzymatic activity for each *Serratia marcescens* complex strain at 25 °C, 30 °C, and 37 °C after 24 and 48 h of incubation. ‘+’ indicates the presence of a given activity, and ‘–’ indicates its absence. (b) Photographs of the plates and culture tubes from each assay after 48 h of incubation at 30 °C.

3.5. Comparative analysis of virulence‐associated genes among four Serratia marcescens complex strains

The quantification of virulence factors indicated that Bd_SM, the strain exhibiting the weakest pathogenicity against B. dorsalis, possessed the fewest predicted virulence factors (653), followed by DBd_SM (656) and Bc_SM (665), while Aa_SM contained the highest number (716). Among the four S. marcescens complex strains analyzed, virulence factors associated with nutrition and metabolism were found to be most abundant, ranging from 163 to 184. Comparative analysis revealed that Bd_SM exhibited a deficiency in several categories of virulence factors, including nutritional/metabolic factors, motility, adherence, and effector delivery systems (Supporting Information, Table S5).

Further investigation into Bd_SM demonstrated that a significant proportion of its missing virulence factors were related to secretion systems. Notably, both Bd_SM and DBd_SM lacked the genes encoding a complete type II secretion system (T2SS) (Fig. 6(a)). Additionally, only one gene cluster for type VI secretion system (T6SS) was identified in Bd_SM; conversely, each of the other three strains harbored two copies of T6SS gene clusters (Fig. 6(b), (c)).

Gene clusters of T2SS and T6SS in the four strains of *Serratia marcescens* complex. (a) The T2SS gene cluster is absent in Bd_SM and DBd_SM. (b) The first T6SS gene cluster in the four strains. (c) Bd_SM contains one fewer T6SS gene cluster than the other three strains.

Regarding insecticidal toxin composition, known insect‐associated virulence factors in S. marcescens include serralysin, chitinase, hemolysin, and prodigiosin. Among the four strains examined, only DBd_SM contained the biosynthetic gene cluster for prodigiosin; meanwhile, Bd_SM had the fewest genes encoding serralysin. (Table 3). All four S. marcescens complex strains carried virulence‐associated genes involved in fimbriae formation, siderophore production, and DNase activity (Supporting Information, Table S5). Furthermore, three strains isolated from insect guts possessed a complete urease operon (ureABCEFGD), which has been recognized as a characteristic feature of S. marcescens isolates associated with insect hosts. ²⁰

Table 3.

Virulence genes of four strains within S. marcescens complex

Function	Product Function	Gene				Insecticidal activity status (in Serratia)
Function	Product Function	Bd_SM	Bc_SM	Aa_SM	DBd_SM	Insecticidal activity status (in Serratia)
Insecticidal toxin	Serralysin	gene0201	gene0166	gene0156	gene0167	Validated ⁶⁵ , ⁶⁶
		gene2003	gene2058	gene2019	gene2038
		gene2240	gene2292	gene2322	gene2273
			gene3175	gene2372	gene2327
			gene3175	gene3203	gene3132
	Chitinase	gene0128	gene0093	gene0083	gene0086	Validated ⁶⁷
		gene1116	gene1153	gene1148	gene1149
		gene2592	gene2682	gene2706	gene2649
		gene3430	gene3518	gene3552	gene3480
	Prodigiosin	Absent	Absent	Absent	gene1057‐1069	Validated ⁶⁸ , ⁶⁹
Haemolysin	shlA/ shlB	gene4314‐4315	gene4455‐4456	gene4529‐4530	gene4345‐4346	Validated ⁷⁰ , ⁷¹
flagellar	Filament	gene 2788–2846	gene 2872–2928	gene 2899–2956	gene 2838–2897	Predicted ¹⁴
Urease	ureABCEFGD	gene842‐848	gene 829–835	gene837‐843	Absent	Predicted ²⁰

Open in a new tab

4. DISCUSSION

In this study, four strains of the S. marcescens complex (Bd_SM, Bc_SM, Aa_SM, and DBd_SM), isolated from various sources, were systematically compared and their pathogenicity against B. dorsalis was evaluated. Survival assays revealed significant differences in virulence: Bd_SM, which was isolated from the gut of B. dorsalis, exhibited the lowest pathogenicity toward its native host. Conversely, the other three strains caused substantially higher mortality. These findings underscore that the virulence of S. marcescens complex strains is highly variable. Evidence from other insect systems has suggested that some gut‐derived isolates can display strong pathogenicity. ¹⁴ However, comparable studies remain limited; cases such as Bd_SM, where a gut‐derived strain exhibits markedly reduced virulence toward its native host highlight that the relationship between isolation source and virulence is not straightforward, but may instead be influenced by host adaptation and strain‐specific genetic backgrounds.

To further investigate how these strain‐specific differences in virulence manifest within the host, we examined the immune responses of B. dorsalis to each strain under gut and hemolymph infection conditions. Insect immune activation inherently incurs costs ⁷² and typically occurs only when microbial threats exceed a certain physiological threshold ⁷³ or when the induction of immune genes depends on bacterial load. ⁷⁴ Consistent with this framework, we observed that the gut immune genes of B. dorsalis were not significantly upregulated during low‐dose oral infection with S. marcescens complex strains. When bacterial density does not reach a pathogenic level, activating immune responses may not provide sufficient fitness benefits to offset their energetic costs; this reflects the trade‐off insects make between investing in immunity and meeting other physiological demands. ⁷² However, as the bacterial dose increased, immune activation became more pronounced and exhibited strain‐specific patterns. For instance, Bd_SM and DBd_SM induced AMP gene expression only at high oral infection doses, which may suggest that B. dorsalis requires pathogens to proliferate beyond a certain threshold before initiating immune recognition and response. Under oral infection at an OD of 1, only Aa_SM induced a robust expression of IMD‐pathway–associated AMP genes, while the other three strains triggered minimal immune responses. We hypothesize that this weak immunogenicity may contribute to potential immune‐evasion strategies that could facilitate their persistence and colonization within the gut. Notably, at higher bacterial doses, Aa_SM ceased to trigger immune gene expression altogether. Similar patterns of immune suppression or pathogen mediated immune modulation following explosive bacterial proliferation have been documented in Galleria mellonella (L.) infected with Enterobacter gergoviae LY2W and in the gut of Spodoptera exigua (Hübner) infected with SeMNPV. ⁷⁵ , ⁷⁶ Such a lack or even reduction of AMP induction may represent a potential pathogenic strategy. However, genotype‐to‐phenotype inference based solely on gene presence has inherent limitations, particularly for opportunistic pathogens. Therefore, the immune‐evasion hypothesis and pathogenic mechanisms await functional validation through targeted gene disruptions.

Unlike oral infection, all four strains induced the expression of AMP genes when directly introduced into the hemolymph. This indicates that once S. marcescens complex enters the hemocoel, it can transition from a ‘low‐virulence commensal’ to a ‘high‐virulence pathogen,’ and is efficiently recognized by the IMD pathway in B. dorsalis. Notably, the phenoloxidase gene was not activated through either infection route, suggesting that this system may not play a significant role in immunity under our experimental conditions. In addition, significant induction of BdDuox was observed only during oral infection with 5 OD DBd_SM, suggesting a gut‐specific immune response in B. dorsalis to this pathogenic strain, which is perceived as an exogenous pathogen. ⁷⁷ However, we detected no clear differences in nucleoside metabolism‐related genes among the four strains. Furthermore, our study did not include in vitro assays to evaluate their ability to convert uridine to uracil. ⁷⁷ Consequently, the mechanisms by which these strains either fail to trigger or induce BdDuox expression remain unresolved. Overall, the magnitude of insect immune responses depends not only on the route of infection, ⁷⁸ , ⁷⁹ but is also influenced by strain‐specific traits, ¹⁴ infectious dose, ⁸⁰ and timing of infection. ⁸¹ , ⁸² Given the limitations inherent in our current assays, more systematic experimentation will be necessary to elucidate how different members of the S. marcescens complex activate immune pathways in B. dorsalis.

The results of this study indicate that all four strains of the S. marcescens complex harbor a multitude of virulence‐related genes. Given that S. marcescens complex is widely distributed in the guts of insects, the presence of these virulence factors may contribute to both colonization and competitive fitness within the intestinal ecosystem. For example, fimbrial adhesins facilitate bacterial attachment to the gut epithelium. ⁸³ Additionally, secretion systems can provide competitive advantages to bacterial strains within the host intestine and promote their invasion. ⁸⁴ , ⁸⁵ Furthermore, insect hosts and their symbiotic bacteria can work synergistically to limit the proliferation of opportunistic pathogens; however, S. marcescens relies on its flexible expression of virulence genes to circumvent such ‘colonization resistance’ and persist in the gut environment. ⁸⁶

Compared to other strains, the reduced virulence of Bd_SM toward B. dorsalis raises the possibility of a potential tendency toward reduced pathogenicity that could be consistent with early stages of host adaptation. Although Bd_SM retains genes encoding proteases, hemolysins, and flagella, it has lost hemolytic activity and possesses fewer serralysin genes than its counterparts, along with a smaller genome size. Whether these characteristics indicate an ongoing evolutionary shift toward a symbiotic lifestyle remains to be confirmed. Similar evolutionary trajectories have been documented in other systems. For example, Serratia symbiotica in aphids has evolved from a pathogenic ancestor into mutualistic and even co‐obligate symbionts, accompanied by progressive genome reduction and loss of virulence. ⁸⁷ , ⁸⁸ , ⁸⁹ Likewise, Sodalis praecaptivus modulates its virulence via quorum sensing to establish low‐pathogenic colonization within insect hosts. ⁹⁰ These cases underscore the dual role of virulence factors: they initially serve as determinants of pathogenic infection but later facilitate colonization, competition, and long‐term persistence within the host during the transition from pathogenicity to symbiosis. Given the absence of direct evidence for transmission or stable association, this interpretation should be regarded as a hypothesis warranting further experimental testing.

Notably, S. marcescens can retain certain virulence factors even under symbiotic conditions; these factors may be reactivated when homeostasis within the host gut is disrupted, leading to renewed pathogenicity. ¹² This indicates that for gut‐associated opportunistic pathogens, disrupting the integrity of the host's gut environment or barrier could potentially trigger their virulent behavior. Such insights offer a perspective for pest management. However, careful consideration must be given to their ecological risks. For instance, both Bd_SM and Aa_SM are closely related to S. nevei based on ANI analysis; however, this species has been rarely isolated from insects and its ecological adaptation along with its virulence remains unclear. Furthermore, another member of the S. marcescens complex, S. ureilytica, has been reported to infect both insects and plants and can even transmit plant diseases via insect vectors. ²⁰ , ⁹¹ More importantly, S. marcescens is a well‐known opportunistic pathogen capable of infecting humans and other animals. ¹⁹ , ²⁰ , ⁹² Its broad host range, environmental persistence, and potential impacts on non‐target organisms raise additional biosafety concerns. ¹⁸ Although the S. marcescens strains evaluated in this study demonstrated insecticidal activity under controlled laboratory conditions, the present work does not establish their safety or suitability for field application as biopesticides. Any future consideration of practical use, whether in open field or confined systems, would require comprehensive biosafety evaluation, rigorous host‐specificity testing, and formal regulatory approval. ⁹³ , ⁹⁴ At this stage, the findings reported here should be regarded primarily as advancing the mechanistic understanding of entomopathogenicity within this bacterial group.

CONFLICT OF INTEREST

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Supporting information

Table S1. Strain information of Serratia species used for ANI analysis.

Table S2. Strain information of Serratia species used for phylogenetic tree construction.

Table S3. Primers used in this study.

Table S4. ANI analysis results.

Table S5. Predicted virulence genes of the four strains.

PS-82-9249-s001.xlsx^{(181.1KB, xlsx)}

ACKNOWLEDGEMENTS

This work was supported by National Natural Science Foundation of China (Grant No. U25A20680) and the National Key R&D Program of China (Grant No. 2024YFD1400601).

Contributor Information

Yong‐yue Lu, Email: luyongyue@scau.edu.cn.

Yi‐xiang Qi, Email: qiyixiang19880922@163.com.

DATA AVAILABILITY STATEMENT

All raw genomic sequencing data for the four strains of S. marcescens complex have been disposed in NCBI's Sequence Read Archive (SRA) and are accessible through BioProject accession PRJNA1454651.

REFERENCES

1. Bidari F, Shams‐Bakhsh M and Mehrabadi M, Isolation and characterization of a Serratia marcescens with insecticidal activity from polyphylla olivieri (col.: Scarabaeidae). J Appl Entomol 142:162–172 (2018). [Google Scholar]
2. Mason CJ, Peiffer M, Hoover K and Felton G, Tomato chemical defenses intensify corn earworm (Helicoverpa zea) mortality from opportunistic bacterial pathogens. J Chem Ecol 49:313–324 (2023). [DOI] [PubMed] [Google Scholar]
3. Raza MF, Yao Z, Bai S, Cai Z and Zhang H, Tephritidae fruit fly gut microbiome diversity, function and potential for applications. Bull Entomol Res 110:423–437 (2020). [DOI] [PubMed] [Google Scholar]
4. Ben‐Yosef M, Pasternak Z, Jurkevitch E and Yuval B, Symbiotic bacteria enable olive flies (Bactrocera oleae) to exploit intractable sources of nitrogen. J Evol Biol 27:2695–2705 (2014). [DOI] [PubMed] [Google Scholar]
5. Cheng D, Guo Z, Riegler M, Xi Z, Liang G and Xu Y, Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel). Microbiome 5:13 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Saha P and Ray RR, Production of polysaccharide degrading enzymes by the gut microbiota of Leucinodes orbonalis and Bactrocera dorsalis . Entomol Zool Stud 3:122–125 (2015). [Google Scholar]
7. Shu R, Hahn DA, Jurkevitch E, Liburd OE, Yuval B and Wong AC‐N, Sex‐dependent effects of the microbiome on foraging and locomotion in Drosophila suzukii . Front Microbiol 12:656406 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Braglia C, Alberoni D, Garrido PM, Porrini MP, Baffoni L, Scott D et al., Vairimorpha (nosema) ceranae can promote Serratia development in honeybee gut: an underrated threat for bees? Front Cell Infect Microbiol 14:1323157 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Mason CJ, Peiffer M, St Clair A, Hoover K and Felton GW, Concerted impacts of antiherbivore defenses and opportunistic Serratia pathogens on the fall armyworm (Spodoptera frugiperda). Oecologia 198:167–178 (2022). [DOI] [PubMed] [Google Scholar]
10. Wei G, Lai Y, Wang G, Chen H, Li F and Wang S, Insect pathogenic fungus interacts with the gut microbiota to accelerate mosquito mortality. Proc Natl Acad Sci U S A 114:5994–5999 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Di Prisco G, Cavaliere V, Annoscia D, Varricchio P, Caprio E, Nazzi F et al., Neonicotinoid clothianidin adversely affects insect immunity and promotes replication of a viral pathogen in honey bees. Proc Natl Acad Sci U S A 110:18466–18471 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Raymann K, Coon KL, Shaffer Z, Salisbury S and Moran NA, Pathogenicity of Serratia marcescens strains in honey bees. MBio 9:e01649‐18 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Devi S, Saini HS and Kaur S, Assessing the pathogenicity of gut bacteria associated with tobacco caterpillar Spodoptera litura (fab.). Sci Rep 12:8257 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Raymann K, Shaffer Z and Moran NA, Antibiotic exposure perturbs the gut microbiota and elevates mortality in honeybees. PLoS Biol 15:e2001861 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Galac MR and Lazzaro BP, Comparative pathology of bacteria in the genus Providencia to a natural host, Drosophila melanogaster. Microbes Infect 13:673–683 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Lin DJ, Zhou J, Ali A, Fu H, Gao S, Jin L et al., Biocontrol efficiency and characterization of insecticidal protein from sugarcane endophytic Serratia marcescens (SM) against oriental armyworm Mythimna separata (walker). Int J Biol Macromol 262:129978 (2024). [DOI] [PubMed] [Google Scholar]
17. Lysyk TJ, Kalischuk‐Tymensen LD and Selinger LB, Comparsion of selected growth media for culturing Serratia marcescens, Aeromonas sp., and Pseudomonas aeruginosa as pathogens of adult Stomoxys calcitrans (Diptera: Muscidae). J Med Entomol 39:89–98 (2002). [DOI] [PubMed] [Google Scholar]
18. Akhtar MR, Younas M and Xia X, Pathogenicity of Serratia marcescens strains as biological control agent: implications for sustainable pest management. Insect Sci 33:13–32 (2026). [DOI] [PubMed] [Google Scholar]
19. Williams DJ, Grimont PAD, Cazares A, Grimont F, Ageron E, Pettigrew KA et al., The genus Serratia revisited by genomics. Nat Commun 13:5195 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Doidge NP, Allen JL, Bushell R, Lynch M, Browning GF and Marenda MS, Development of a qPCR assay to identify and differentiate insect‐associated strains of the Serratia marcescens complex. J Vet Diagn Invest 37:234–243 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Allen JL, Doidge NP, Cheng C, Lynch M, Crabb HK, Scheerlinck JP et al., Genomic characterisation of an entomopathogenic strain of Serratia ureilytica in the critically endangered phasmid Dryococelus australis . PLoS One 17:e0265967 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Zhang CX, Yang SY, Xu MX, Sun J, Liu H, Liu JR et al., Serratia nematodiphila sp. nov., associated symbiotically with the entomopathogenic nematode Heterorhabditidoides chongmingensis (Rhabditida: Rhabditidae). Int J Syst Evol Microbiol 59:1603–1608 (2009). [DOI] [PubMed] [Google Scholar]
23. Wang Z, Wang M, Zhou Y, Feng K and Tang F, A comprehensive analysis of the defense responses of Odontotermes formosanus (shiraki) provides insights into the changes during Serratia marcescens infection. BMC Genomics 25:1044 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Aggarwal C, Paul S, Nain V, Tripathi V, Paul B and Aslam Khan M, Comparative response of Spodoptera litura challenged per os with Serratia marcescens strains differing in virulence. J Invertebr Pathol 183:107562 (2021). [DOI] [PubMed] [Google Scholar]
25. Zeng T, Bai X, Liu YL, Li JF, Lu YY and Qi YX, Intestinal responses of the oriental fruit fly Bactrocera dorsalis (Hendel) after ingestion of an entomopathogenic bacterium strain. Pest Manag Sci 76:653–664 (2020). [DOI] [PubMed] [Google Scholar]
26. Zhong B, Lv C, Li W, Li C and Chen T, Virulence of entomopathogenic bacteria Serratia marcescens against the red palm weevil, Rhynchophorus ferrugineus (Olivier). PeerJ 11:e16528 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Caccia S, Di Lelio I, La Storia A, Marinelli A, Varricchio P, Franzetti E et al., Midgut microbiota and host immunocompetence underlie Bacillus thuringiensis killing mechanism. Proc Natl Acad Sci U S A 113:9486–9491 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Fink C, Hoffmann J, Knop M, Li Y, Isermann K and Roeder T, Intestinal FoxO signaling is required to survive oral infection in Drosophila . Mucosal Immunol 9:927–936 (2016). [DOI] [PubMed] [Google Scholar]
29. Nehme NT, Liégeois S, Kele B, Giammarinaro P, Pradel E, Hoffmann JA et al., A model of bacterial intestinal infections in Drosophila melanogaster . PLoS Pathog 3:e173 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Bai L, Wang L, Vega‐Rodríguez J, Wang G and Wang S, A gut symbiotic bacterium Serratia marcescens renders mosquito resistance to plasmodium infection through activation of mosquito immune responses. Front Microbiol 10:1580 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Yang J, Ji C, Ling B and Zhang M, Isolation and identification of bacteria from Phyllotreta striolata (Fabricius) and determination of its insecticidal bioactivity. Chin J Biol Control 3:025 (2014). [Google Scholar]
32. Feng K, Luo J, Ding X and Tang F, Transcriptome analysis and response of three important detoxifying enzymes to Serratia marcescens bizio (SM1) in Hyphantria cunea (drury) (Lepidoptera: Noctuidae). Pestic Biochem Physiol 178:104922 (2021). [DOI] [PubMed] [Google Scholar]
33. Wang Z, Feng K, Tang F and Xu M, Activation of the host immune response in Hyphantria cunea (drury) (Lepidoptera: Noctuidae) induced by Serratia marcescens bizio. Insects 12:983 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Follett PA, Pinero J, Souder S, Jamieson L, Waddell B and Wall M, Host status of “scifresh” apples to the invasive fruit fly species Bactrocera dorsalis, Zeugodacus cucurbitae, and Ceratitis capitata (Diptera: Tephritidae). J Asia Pac Entomol 22:458–470 (2019). [Google Scholar]
35. Michel ADK, Fiaboe KKM, Kekeunou S, Nanga SN, Kuate AF, Tonnang HEZ et al., Temperature‐based phenology model to predict the development, survival, and reproduction of the oriental fruit fly Bactrocera dorsalis . J Therm Biol 97:102877 (2021). [DOI] [PubMed] [Google Scholar]
36. Zeng Y, Reddy GVP, Li Z, Qin Y, Wang Y, Pan X et al., Global distribution and invasion pattern of oriental fruit fly, Bactrocera dorsalis (diptera: Tephritidae). J Appl Entomol 143:165–176 (2019). [Google Scholar]
37. Shafiq Ansari M, Hasan F and Ahmad N, Threats to fruit and vegetable crops: fruit flies (Tephritidae) ‐ ecology, behaviour, and management. J Crop Sci Biotechnol 15:169–188 (2012). [Google Scholar]
38. Wang Y, Fang G, Xu P, Gao B, Liu X, Qi X et al., Behavioral and genomic divergence between a generalist and a specialist fly. Cell Rep 41:111654 (2022). [DOI] [PubMed] [Google Scholar]
39. Li X, Wu J, Cai X, Li D, Cheng D and Lu Y, Lethal and sublethal effects of broflanilide on four tephritid pests (Diptera: Tephritidae). Pest Manag Sci 79:2862–2868 (2023). [DOI] [PubMed] [Google Scholar]
40. Beyuo J, Sackey LNA, Yeboah C, Kayoung PY and Koudadje D, The implications of pesticide residue in food crops on human health: A critical review. Discov Agric 2:123 (2024). [Google Scholar]
41. Liang J, Xiao F, Ojo J, Chao WH, Ahmad B, Alam A et al., Insect resistance to insecticides: causes, mechanisms, and exploring potential solutions. Arch Insect Biochem Physiol 118:e70045 (2025). [DOI] [PubMed] [Google Scholar]
42. Agboka KM, Tonnang HEZ, Muriithi BW, Niassy S, Ndlela S, Abdel‐Rahman EM et al., Economic impact of a classical biological control program: application to Diachasmimorpha longicaudata against Bactrocera dorsalis fruit fly in Kenya. BioControl 69:269–278 (2024). [Google Scholar]
43. Li X, Zhang J, Li D, Cai X, Qi Y and Lu Y, Toxicity of beauveria bassiana to Bactrocera dorsalis and effects on its natural predators. Front Microbiol 15:1–11 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Aoki S, Weaver M, Simmonds TJ, Shikano I, Geib SM and Mason CJ, Effects of species and sex on the gut microbiome of four laboratory‐reared fruit fly lines (diptera: Tephritidae) using full‐length 16S rRNA PacBio kinnex sequencing. BMC Microbiol 25:455 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Wang A, Yao Z, Zheng W and Zhang H, Bacterial communities in the gut and reproductive organs of Bactrocera minax (Diptera: Tephritidae) based on 454 pyrosequencing. PLoS One 9:e106988 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Wong ACN, Chaston JM and Douglas AE, The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis. ISME J 7:1922–1932 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Flyg C, Kenne K and Boman HG, Insect pathogenic properties of Serratia marcescens: phage‐resistant mutants with a decreased resistance to cecropia immunity and a decreased virulence to Drosophila . Microbiology 120:173–181 (1980). [DOI] [PubMed] [Google Scholar]
48. Therneau TM, until 2009) TL (original S‐>R port and R maintainer, Elizabeth A, and Cynthia C, survival: Survival analysis (2024).
49. Hyatt D, Chen GL, LoCascio PF, Land ML, Larimer FW and Hauser LJ, Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics 11:119 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Chan PP, Lin BY, Mak AJ and Lowe TM, tRNAscan‐SE 2.0: improved detection and functional classification of transfer RNA genes. Nucleic Acids Res 49:9077–9096 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W et al., Gapped BLAST and PSI‐BLAST: A new generation of protein database search programs. Nucleic Acids Res 25:3389–3402 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Johnson LS, Eddy SR and Portugaly E, Hidden markov model speed heuristic and iterative HMM search procedure. BMC Bioinformatics 11:431 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Buchfink B, Xie C and Huson DH, Fast and sensitive protein alignment using DIAMOND. Nat Methods 12:59–60 (2015). [DOI] [PubMed] [Google Scholar]
54. Gilchrist CLM and Chooi Y‐H, Clinker & clustermap.js: automatic generation of gene cluster comparison figures. Bioinformatics 37:2473–2475 (2021). [DOI] [PubMed] [Google Scholar]
55. Harch SAJ, Jenkins F, Farhat R and Van Hal SJ, Complexities in species identification for Serratia marcescens complex for the modern microbiology laboratory. Microbiol Spectr 13:e01361‐24 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
56. Tao K, Long Z, Liu K, Tao Y and Liu S, Purification and properties of a novel insecticidal protein from the locust pathogen Serratia marcescens HR‐3. Curr Microbiol 52:45–49 (2006). [DOI] [PubMed] [Google Scholar]
57. Ishii K, Adachi T, Hara T, Hamamoto H and Sekimizu K, Identification of a Serratia marcescens virulence factor that promotes hemolymph bleeding in the silkworm, Bombyx mori . J Invertebr Pathol 117:61–67 (2014). [DOI] [PubMed] [Google Scholar]
58. Prinsloo HE, The phospholipase and gelatinase activity of gram‐negative bacteria isolated from diseased insects, and typing of strains of Serratia marcescens . J Invertebr Pathol 9:420–427 (1967). [Google Scholar]
59. Pinna A, Usai D, Sechi LA, Carta A and Zanetti S, Detection of virulence factors in Serratia strains isolated from contact lens‐associated corneal ulcers. Acta Ophthalmol 89:382–387 (2011). [DOI] [PubMed] [Google Scholar]
60. Tanikawa T, Nakagawa Y and Matsuyama T, Transcriptional downregulator HexS controlling prodigiosin and serrawettin W1 biosynthesis in Serratia marcescens . Microbiol Immunol 50:587–596 (2006). [DOI] [PubMed] [Google Scholar]
61. Kurz CL, Chauvet S, Andrès E, Aurouze M, Vallet I, Michel GPF et al., Virulence factors of the human opportunistic pathogen Serratia marcescens identified by in vivo screening. EMBO J 22:1451–1460 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Shanks RMQ, Stella NA, Lahr RM, Wang S, Veverka TI, Kowalski RP et al., Serratamolide is a hemolytic factor produced by Serratia marcescens . PLoS One 7:e36398 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
63. Allison C, Coleman N, Jones PL and Hughes C, Ability of Proteus mirabilis to invade human urothelial cells is coupled to motility and swarming differentiation. Infect Immun 60:4740–4746 (1992). [DOI] [PMC free article] [PubMed] [Google Scholar]
64. Overhage J, Bains M, Brazas MD and Hancock REW, Swarming of Pseudomonas aeruginosa is a complex adaptation leading to increased production of virulence factors and antibiotic resistance. J Bacteriol 190:2671–2679 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Lee J and Lee DW, Insecticidal serralysin of Serratia marcescens is detoxified in M3 midgut region of Riptortus pedestris . Front Microbiol 13:1–10 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
66. Lee DJ, Lee JB, Jang HA, Ferrandon D and Lee BL, An antimicrobial protein of the Riptortus pedestris salivary gland was cleaved by a virulence factor of Serratia marcescens . Dev Comp Immunol 67:427–433 (2017). [DOI] [PubMed] [Google Scholar]
67. Wang K, Yan P, Cao L, Ding Q, Shao C and Zhao T, Potential of chitinolytic Serratia marcescens strain JPP1 for biological control of Aspergillus parasiticus and aflatoxin. Biomed Res Int 2013:2013:1–7 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
68. Mnif S, Jardak M, Bouizgarne B and Aifa S, Prodigiosin from serratia: synthesis and potential applications. Asian Pac J Trop Biomed 12:233–242 (2022). [Google Scholar]
69. Suryawanshi RK, Patil CD, Borase HP, Narkhede CP, Salunke BK and Patil SV, Mosquito larvicidal and pupaecidal potential of prodigiosin from Serratia marcescens and understanding its mechanism of action. Pestic Biochem Physiol 123:49–55 (2015). [DOI] [PubMed] [Google Scholar]
70. Aggarwal C, Paul S, Tripathi V, Paul B and Khan MA, Characterization of putative virulence factors of Serratia marcescens strain SEN for pathogenesis in Spodoptera litura . J Invertebr Pathol 143:115–123 (2017). [DOI] [PubMed] [Google Scholar]
71. Lin CS, Horng JT, Yang CH, Tsai YH, Su LH, Wei CF et al., RssAB‐FlhDC‐ShlBA as a major pathogenesis pathway in Serratia marcescens . Infect Immun 78:4870–4881, American Society for Microbiology (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
72. Schwenke RA, Lazzaro BP and Wolfner MF, Reproduction–immunity trade‐offs in insects. Annu Rev Entomol 61:239–256 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
73. Trappeniers K, Matetovici I, Van Den Abbeele J and De Vooght L, The tsetse fly displays an attenuated immune response to its secondary symbiont, Sodalis glossinidius . Front Microbiol 10:1–20 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
74. Bartholomay LC, Fuchs JF, Cheng L‐L, Beck ET, Vizioli J, Lowenberger C et al., Reassessing the role of defensin in the innate immune response of the mosquito, Aedes aegypti. Insect Mol Biol 13:125–132 (2004). [DOI] [PubMed] [Google Scholar]
75. Jakubowska AK, Vogel H and Herrero S, Increase in gut microbiota after immune suppression in baculovirus‐infected larvae. PLoS Pathog 9:e1003379 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
76. Liao C, Zheng M, Chen Y, Wang M and Li B, Immunosuppression mechanism of entomopathogenic bacteria against Galleria mellonella larvae. Process Biochem 81:28–32 (2019). [Google Scholar]
77. Kim EK, Lee KA, Hyeon DY, Kyung M, Jun KY, Seo SH et al., Bacterial nucleoside catabolism controls quorum sensing and commensal‐to‐pathogen transition in the drosophila gut. Cell Host Microbe 27:345–357.e6 (2020). [DOI] [PubMed] [Google Scholar]
78. Behrens S, Peuß R, Milutinović B, Eggert H, Esser D, Rosenstiel P et al., Infection routes matter in population‐specific responses of the red flour beetle to the entomopathogen bacillus thuringiensis. BMC Genomics 15:445 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
79. Vodovar N, Vinals M, Liehl P, Basset A, Degrouard J, Spellman P et al., Drosophila host defense after oral infection by an entomopathogenic pseudomonas species. Proc Natl Acad Sci 102:11414–11419 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
80. Lee KA, Kim SH, Kim EK, Ha EM, You H, Kim B et al., Bacterial‐derived uracil as a modulator of mucosal immunity and gut‐microbe homeostasis in drosophila. Cell 153:797–811, Elsevier (2013). [DOI] [PubMed] [Google Scholar]
81. González‐Santoyo I, Córdoba‐Aguilar A, González‐Tokman DM and Lanz‐Mendoza H, Phenoloxidase activity and melanization do not always covary with sexual trait expression in Hetaerina damselflies (Insecta: Calopterygidae). Behaviour 147:1285–1307 (2010). [Google Scholar]
82. Saejeng A, Tidbury H, Siva‐Jothy MT and Boots M, Examining the relationship between hemolymph phenoloxidase and resistance to a DNA virus, plodia interpunctella granulosis virus (PiGV). J Insect Physiol 56:1232–1236 (2010). [DOI] [PubMed] [Google Scholar]
83. Klemm P and Schembri MA, Bacterial adhesins: function and structure. Int J Med Microbiol 290:27–35 (2000). [DOI] [PubMed] [Google Scholar]
84. Murdoch SL, Trunk K, English G, Fritsch MJ, Pourkarimi E and Coulthurst SJ, The opportunistic pathogen Serratia marcescens utilizes type VI secretion to target bacterial competitors. J Bacteriol 193:6057–6069 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
85. Williams DJ, Hawkins A, Hernandez RE, Mariano G, Mathers K, Buchanan G et al., Competitive behaviors in Serratia marcescens are coordinately regulated by a lifestyle switch frequently inactivated in the clinical environment. Cell Host Microbe 33:252–266.e5 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
86. Zhang S, Wang Z, Liu A, Li J, Zhuang J, Ji X et al., Hosts and commensal bacteria synergistically antagonize opportunistic pathogens at the single‐cell resolution. Adv Sci 12:e00582 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
87. Manzano‐Marín A and Latorre A, Snapshots of a shrinking partner: genome reduction in Serratia symbiotica . Sci Rep 6:6:32590 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
88. Perreau J, Patel DJ, Anderson H, Maeda GP, Elston KM, Barrick JE et al., Vertical transmission at the pathogen‐symbiont interface: Serratia symbiotica and aphids. mBio 12:e00359‐21 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
89. Pons I, Renoz F, Noël C and Hance T, New insights into the nature of symbiotic associations in aphids: infection process, biological effects, and transmission mode of cultivable Serratia symbiotica bacteria. Appl Environ Microbiol 85:e02445‐18 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
90. Munoz MM, Spencer N, Enomoto S, Dale C and Rio RVM, Quorum sensing sets the stage for the establishment and vertical transmission of Sodalis praecaptivus in tsetse flies. PLoS Genet 16:e1008992 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
91. Mphande K, LaSarre B, Paulsen AA, Hartung R, Badilla‐Arias S, Gleason ML et al., Bacteria that cause cucurbit yellow vine disease fall within the Serratia ureilytica wpecies of the S. marcescens complex and can be vectored by cucumber beetles. Phytopathology 115:606–617 (2025). [DOI] [PubMed] [Google Scholar]
92. Aracil‐Gisbert S, Fernández‐De‐Bobadilla MD, Guerra‐Pinto N, Serrano‐Calleja S, Pérez‐Cobas AE, Soriano C et al., The ICU environment contributes to the endemicity of the “Serratia marcescens complex” in the hospital setting. mBio 15:e03054‐23 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
93. Karaolan B, Alkassab AT, Borges S, Fisher T, Link‐Vrabie C, Mcvey E et al., Microbial pesticides: challenges and future perspectives for non‐target organism testing. Environ Sci Eur 36:205 (2024). [Google Scholar]
94. Colagiorgi A, S16‐03 microbial pesticides: a regulatory overview. Toxicol Lett 411:S31 (2025). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1. Strain information of Serratia species used for ANI analysis.

Table S2. Strain information of Serratia species used for phylogenetic tree construction.

Table S3. Primers used in this study.

Table S4. ANI analysis results.

Table S5. Predicted virulence genes of the four strains.

PS-82-9249-s001.xlsx^{(181.1KB, xlsx)}

Data Availability Statement

All raw genomic sequencing data for the four strains of S. marcescens complex have been disposed in NCBI's Sequence Read Archive (SRA) and are accessible through BioProject accession PRJNA1454651.

[ps70969-bib-0001] 1. Bidari F, Shams‐Bakhsh M and Mehrabadi M, Isolation and characterization of a Serratia marcescens with insecticidal activity from polyphylla olivieri (col.: Scarabaeidae). J Appl Entomol 142:162–172 (2018). [Google Scholar]

[ps70969-bib-0002] 2. Mason CJ, Peiffer M, Hoover K and Felton G, Tomato chemical defenses intensify corn earworm (Helicoverpa zea) mortality from opportunistic bacterial pathogens. J Chem Ecol 49:313–324 (2023). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0003] 3. Raza MF, Yao Z, Bai S, Cai Z and Zhang H, Tephritidae fruit fly gut microbiome diversity, function and potential for applications. Bull Entomol Res 110:423–437 (2020). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0004] 4. Ben‐Yosef M, Pasternak Z, Jurkevitch E and Yuval B, Symbiotic bacteria enable olive flies (Bactrocera oleae) to exploit intractable sources of nitrogen. J Evol Biol 27:2695–2705 (2014). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0005] 5. Cheng D, Guo Z, Riegler M, Xi Z, Liang G and Xu Y, Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel). Microbiome 5:13 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0006] 6. Saha P and Ray RR, Production of polysaccharide degrading enzymes by the gut microbiota of Leucinodes orbonalis and Bactrocera dorsalis . Entomol Zool Stud 3:122–125 (2015). [Google Scholar]

[ps70969-bib-0007] 7. Shu R, Hahn DA, Jurkevitch E, Liburd OE, Yuval B and Wong AC‐N, Sex‐dependent effects of the microbiome on foraging and locomotion in Drosophila suzukii . Front Microbiol 12:656406 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0008] 8. Braglia C, Alberoni D, Garrido PM, Porrini MP, Baffoni L, Scott D et al., Vairimorpha (nosema) ceranae can promote Serratia development in honeybee gut: an underrated threat for bees? Front Cell Infect Microbiol 14:1323157 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0009] 9. Mason CJ, Peiffer M, St Clair A, Hoover K and Felton GW, Concerted impacts of antiherbivore defenses and opportunistic Serratia pathogens on the fall armyworm (Spodoptera frugiperda). Oecologia 198:167–178 (2022). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0010] 10. Wei G, Lai Y, Wang G, Chen H, Li F and Wang S, Insect pathogenic fungus interacts with the gut microbiota to accelerate mosquito mortality. Proc Natl Acad Sci U S A 114:5994–5999 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0011] 11. Di Prisco G, Cavaliere V, Annoscia D, Varricchio P, Caprio E, Nazzi F et al., Neonicotinoid clothianidin adversely affects insect immunity and promotes replication of a viral pathogen in honey bees. Proc Natl Acad Sci U S A 110:18466–18471 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0012] 12. Raymann K, Coon KL, Shaffer Z, Salisbury S and Moran NA, Pathogenicity of Serratia marcescens strains in honey bees. MBio 9:e01649‐18 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0013] 13. Devi S, Saini HS and Kaur S, Assessing the pathogenicity of gut bacteria associated with tobacco caterpillar Spodoptera litura (fab.). Sci Rep 12:8257 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0014] 14. Raymann K, Shaffer Z and Moran NA, Antibiotic exposure perturbs the gut microbiota and elevates mortality in honeybees. PLoS Biol 15:e2001861 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0015] 15. Galac MR and Lazzaro BP, Comparative pathology of bacteria in the genus Providencia to a natural host, Drosophila melanogaster. Microbes Infect 13:673–683 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0016] 16. Lin DJ, Zhou J, Ali A, Fu H, Gao S, Jin L et al., Biocontrol efficiency and characterization of insecticidal protein from sugarcane endophytic Serratia marcescens (SM) against oriental armyworm Mythimna separata (walker). Int J Biol Macromol 262:129978 (2024). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0017] 17. Lysyk TJ, Kalischuk‐Tymensen LD and Selinger LB, Comparsion of selected growth media for culturing Serratia marcescens, Aeromonas sp., and Pseudomonas aeruginosa as pathogens of adult Stomoxys calcitrans (Diptera: Muscidae). J Med Entomol 39:89–98 (2002). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0018] 18. Akhtar MR, Younas M and Xia X, Pathogenicity of Serratia marcescens strains as biological control agent: implications for sustainable pest management. Insect Sci 33:13–32 (2026). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0019] 19. Williams DJ, Grimont PAD, Cazares A, Grimont F, Ageron E, Pettigrew KA et al., The genus Serratia revisited by genomics. Nat Commun 13:5195 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0020] 20. Doidge NP, Allen JL, Bushell R, Lynch M, Browning GF and Marenda MS, Development of a qPCR assay to identify and differentiate insect‐associated strains of the Serratia marcescens complex. J Vet Diagn Invest 37:234–243 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0021] 21. Allen JL, Doidge NP, Cheng C, Lynch M, Crabb HK, Scheerlinck JP et al., Genomic characterisation of an entomopathogenic strain of Serratia ureilytica in the critically endangered phasmid Dryococelus australis . PLoS One 17:e0265967 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0022] 22. Zhang CX, Yang SY, Xu MX, Sun J, Liu H, Liu JR et al., Serratia nematodiphila sp. nov., associated symbiotically with the entomopathogenic nematode Heterorhabditidoides chongmingensis (Rhabditida: Rhabditidae). Int J Syst Evol Microbiol 59:1603–1608 (2009). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0023] 23. Wang Z, Wang M, Zhou Y, Feng K and Tang F, A comprehensive analysis of the defense responses of Odontotermes formosanus (shiraki) provides insights into the changes during Serratia marcescens infection. BMC Genomics 25:1044 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0024] 24. Aggarwal C, Paul S, Nain V, Tripathi V, Paul B and Aslam Khan M, Comparative response of Spodoptera litura challenged per os with Serratia marcescens strains differing in virulence. J Invertebr Pathol 183:107562 (2021). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0025] 25. Zeng T, Bai X, Liu YL, Li JF, Lu YY and Qi YX, Intestinal responses of the oriental fruit fly Bactrocera dorsalis (Hendel) after ingestion of an entomopathogenic bacterium strain. Pest Manag Sci 76:653–664 (2020). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0026] 26. Zhong B, Lv C, Li W, Li C and Chen T, Virulence of entomopathogenic bacteria Serratia marcescens against the red palm weevil, Rhynchophorus ferrugineus (Olivier). PeerJ 11:e16528 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0027] 27. Caccia S, Di Lelio I, La Storia A, Marinelli A, Varricchio P, Franzetti E et al., Midgut microbiota and host immunocompetence underlie Bacillus thuringiensis killing mechanism. Proc Natl Acad Sci U S A 113:9486–9491 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0028] 28. Fink C, Hoffmann J, Knop M, Li Y, Isermann K and Roeder T, Intestinal FoxO signaling is required to survive oral infection in Drosophila . Mucosal Immunol 9:927–936 (2016). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0029] 29. Nehme NT, Liégeois S, Kele B, Giammarinaro P, Pradel E, Hoffmann JA et al., A model of bacterial intestinal infections in Drosophila melanogaster . PLoS Pathog 3:e173 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0030] 30. Bai L, Wang L, Vega‐Rodríguez J, Wang G and Wang S, A gut symbiotic bacterium Serratia marcescens renders mosquito resistance to plasmodium infection through activation of mosquito immune responses. Front Microbiol 10:1580 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0031] 31. Yang J, Ji C, Ling B and Zhang M, Isolation and identification of bacteria from Phyllotreta striolata (Fabricius) and determination of its insecticidal bioactivity. Chin J Biol Control 3:025 (2014). [Google Scholar]

[ps70969-bib-0032] 32. Feng K, Luo J, Ding X and Tang F, Transcriptome analysis and response of three important detoxifying enzymes to Serratia marcescens bizio (SM1) in Hyphantria cunea (drury) (Lepidoptera: Noctuidae). Pestic Biochem Physiol 178:104922 (2021). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0033] 33. Wang Z, Feng K, Tang F and Xu M, Activation of the host immune response in Hyphantria cunea (drury) (Lepidoptera: Noctuidae) induced by Serratia marcescens bizio. Insects 12:983 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0034] 34. Follett PA, Pinero J, Souder S, Jamieson L, Waddell B and Wall M, Host status of “scifresh” apples to the invasive fruit fly species Bactrocera dorsalis, Zeugodacus cucurbitae, and Ceratitis capitata (Diptera: Tephritidae). J Asia Pac Entomol 22:458–470 (2019). [Google Scholar]

[ps70969-bib-0035] 35. Michel ADK, Fiaboe KKM, Kekeunou S, Nanga SN, Kuate AF, Tonnang HEZ et al., Temperature‐based phenology model to predict the development, survival, and reproduction of the oriental fruit fly Bactrocera dorsalis . J Therm Biol 97:102877 (2021). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0036] 36. Zeng Y, Reddy GVP, Li Z, Qin Y, Wang Y, Pan X et al., Global distribution and invasion pattern of oriental fruit fly, Bactrocera dorsalis (diptera: Tephritidae). J Appl Entomol 143:165–176 (2019). [Google Scholar]

[ps70969-bib-0037] 37. Shafiq Ansari M, Hasan F and Ahmad N, Threats to fruit and vegetable crops: fruit flies (Tephritidae) ‐ ecology, behaviour, and management. J Crop Sci Biotechnol 15:169–188 (2012). [Google Scholar]

[ps70969-bib-0038] 38. Wang Y, Fang G, Xu P, Gao B, Liu X, Qi X et al., Behavioral and genomic divergence between a generalist and a specialist fly. Cell Rep 41:111654 (2022). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0039] 39. Li X, Wu J, Cai X, Li D, Cheng D and Lu Y, Lethal and sublethal effects of broflanilide on four tephritid pests (Diptera: Tephritidae). Pest Manag Sci 79:2862–2868 (2023). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0040] 40. Beyuo J, Sackey LNA, Yeboah C, Kayoung PY and Koudadje D, The implications of pesticide residue in food crops on human health: A critical review. Discov Agric 2:123 (2024). [Google Scholar]

[ps70969-bib-0041] 41. Liang J, Xiao F, Ojo J, Chao WH, Ahmad B, Alam A et al., Insect resistance to insecticides: causes, mechanisms, and exploring potential solutions. Arch Insect Biochem Physiol 118:e70045 (2025). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0042] 42. Agboka KM, Tonnang HEZ, Muriithi BW, Niassy S, Ndlela S, Abdel‐Rahman EM et al., Economic impact of a classical biological control program: application to Diachasmimorpha longicaudata against Bactrocera dorsalis fruit fly in Kenya. BioControl 69:269–278 (2024). [Google Scholar]

[ps70969-bib-0043] 43. Li X, Zhang J, Li D, Cai X, Qi Y and Lu Y, Toxicity of beauveria bassiana to Bactrocera dorsalis and effects on its natural predators. Front Microbiol 15:1–11 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0044] 44. Aoki S, Weaver M, Simmonds TJ, Shikano I, Geib SM and Mason CJ, Effects of species and sex on the gut microbiome of four laboratory‐reared fruit fly lines (diptera: Tephritidae) using full‐length 16S rRNA PacBio kinnex sequencing. BMC Microbiol 25:455 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0045] 45. Wang A, Yao Z, Zheng W and Zhang H, Bacterial communities in the gut and reproductive organs of Bactrocera minax (Diptera: Tephritidae) based on 454 pyrosequencing. PLoS One 9:e106988 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0046] 46. Wong ACN, Chaston JM and Douglas AE, The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis. ISME J 7:1922–1932 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0047] 47. Flyg C, Kenne K and Boman HG, Insect pathogenic properties of Serratia marcescens: phage‐resistant mutants with a decreased resistance to cecropia immunity and a decreased virulence to Drosophila . Microbiology 120:173–181 (1980). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0048] 48. Therneau TM, until 2009) TL (original S‐>R port and R maintainer, Elizabeth A, and Cynthia C, survival: Survival analysis (2024).

[ps70969-bib-0049] 49. Hyatt D, Chen GL, LoCascio PF, Land ML, Larimer FW and Hauser LJ, Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics 11:119 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0050] 50. Chan PP, Lin BY, Mak AJ and Lowe TM, tRNAscan‐SE 2.0: improved detection and functional classification of transfer RNA genes. Nucleic Acids Res 49:9077–9096 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0051] 51. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W et al., Gapped BLAST and PSI‐BLAST: A new generation of protein database search programs. Nucleic Acids Res 25:3389–3402 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0052] 52. Johnson LS, Eddy SR and Portugaly E, Hidden markov model speed heuristic and iterative HMM search procedure. BMC Bioinformatics 11:431 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0053] 53. Buchfink B, Xie C and Huson DH, Fast and sensitive protein alignment using DIAMOND. Nat Methods 12:59–60 (2015). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0054] 54. Gilchrist CLM and Chooi Y‐H, Clinker & clustermap.js: automatic generation of gene cluster comparison figures. Bioinformatics 37:2473–2475 (2021). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0055] 55. Harch SAJ, Jenkins F, Farhat R and Van Hal SJ, Complexities in species identification for Serratia marcescens complex for the modern microbiology laboratory. Microbiol Spectr 13:e01361‐24 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0056] 56. Tao K, Long Z, Liu K, Tao Y and Liu S, Purification and properties of a novel insecticidal protein from the locust pathogen Serratia marcescens HR‐3. Curr Microbiol 52:45–49 (2006). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0057] 57. Ishii K, Adachi T, Hara T, Hamamoto H and Sekimizu K, Identification of a Serratia marcescens virulence factor that promotes hemolymph bleeding in the silkworm, Bombyx mori . J Invertebr Pathol 117:61–67 (2014). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0058] 58. Prinsloo HE, The phospholipase and gelatinase activity of gram‐negative bacteria isolated from diseased insects, and typing of strains of Serratia marcescens . J Invertebr Pathol 9:420–427 (1967). [Google Scholar]

[ps70969-bib-0059] 59. Pinna A, Usai D, Sechi LA, Carta A and Zanetti S, Detection of virulence factors in Serratia strains isolated from contact lens‐associated corneal ulcers. Acta Ophthalmol 89:382–387 (2011). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0060] 60. Tanikawa T, Nakagawa Y and Matsuyama T, Transcriptional downregulator HexS controlling prodigiosin and serrawettin W1 biosynthesis in Serratia marcescens . Microbiol Immunol 50:587–596 (2006). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0061] 61. Kurz CL, Chauvet S, Andrès E, Aurouze M, Vallet I, Michel GPF et al., Virulence factors of the human opportunistic pathogen Serratia marcescens identified by in vivo screening. EMBO J 22:1451–1460 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0062] 62. Shanks RMQ, Stella NA, Lahr RM, Wang S, Veverka TI, Kowalski RP et al., Serratamolide is a hemolytic factor produced by Serratia marcescens . PLoS One 7:e36398 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0063] 63. Allison C, Coleman N, Jones PL and Hughes C, Ability of Proteus mirabilis to invade human urothelial cells is coupled to motility and swarming differentiation. Infect Immun 60:4740–4746 (1992). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0064] 64. Overhage J, Bains M, Brazas MD and Hancock REW, Swarming of Pseudomonas aeruginosa is a complex adaptation leading to increased production of virulence factors and antibiotic resistance. J Bacteriol 190:2671–2679 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0065] 65. Lee J and Lee DW, Insecticidal serralysin of Serratia marcescens is detoxified in M3 midgut region of Riptortus pedestris . Front Microbiol 13:1–10 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0066] 66. Lee DJ, Lee JB, Jang HA, Ferrandon D and Lee BL, An antimicrobial protein of the Riptortus pedestris salivary gland was cleaved by a virulence factor of Serratia marcescens . Dev Comp Immunol 67:427–433 (2017). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0067] 67. Wang K, Yan P, Cao L, Ding Q, Shao C and Zhao T, Potential of chitinolytic Serratia marcescens strain JPP1 for biological control of Aspergillus parasiticus and aflatoxin. Biomed Res Int 2013:2013:1–7 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0068] 68. Mnif S, Jardak M, Bouizgarne B and Aifa S, Prodigiosin from serratia: synthesis and potential applications. Asian Pac J Trop Biomed 12:233–242 (2022). [Google Scholar]

[ps70969-bib-0069] 69. Suryawanshi RK, Patil CD, Borase HP, Narkhede CP, Salunke BK and Patil SV, Mosquito larvicidal and pupaecidal potential of prodigiosin from Serratia marcescens and understanding its mechanism of action. Pestic Biochem Physiol 123:49–55 (2015). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0070] 70. Aggarwal C, Paul S, Tripathi V, Paul B and Khan MA, Characterization of putative virulence factors of Serratia marcescens strain SEN for pathogenesis in Spodoptera litura . J Invertebr Pathol 143:115–123 (2017). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0071] 71. Lin CS, Horng JT, Yang CH, Tsai YH, Su LH, Wei CF et al., RssAB‐FlhDC‐ShlBA as a major pathogenesis pathway in Serratia marcescens . Infect Immun 78:4870–4881, American Society for Microbiology (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0072] 72. Schwenke RA, Lazzaro BP and Wolfner MF, Reproduction–immunity trade‐offs in insects. Annu Rev Entomol 61:239–256 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0073] 73. Trappeniers K, Matetovici I, Van Den Abbeele J and De Vooght L, The tsetse fly displays an attenuated immune response to its secondary symbiont, Sodalis glossinidius . Front Microbiol 10:1–20 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0074] 74. Bartholomay LC, Fuchs JF, Cheng L‐L, Beck ET, Vizioli J, Lowenberger C et al., Reassessing the role of defensin in the innate immune response of the mosquito, Aedes aegypti. Insect Mol Biol 13:125–132 (2004). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0075] 75. Jakubowska AK, Vogel H and Herrero S, Increase in gut microbiota after immune suppression in baculovirus‐infected larvae. PLoS Pathog 9:e1003379 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0076] 76. Liao C, Zheng M, Chen Y, Wang M and Li B, Immunosuppression mechanism of entomopathogenic bacteria against Galleria mellonella larvae. Process Biochem 81:28–32 (2019). [Google Scholar]

[ps70969-bib-0077] 77. Kim EK, Lee KA, Hyeon DY, Kyung M, Jun KY, Seo SH et al., Bacterial nucleoside catabolism controls quorum sensing and commensal‐to‐pathogen transition in the drosophila gut. Cell Host Microbe 27:345–357.e6 (2020). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0078] 78. Behrens S, Peuß R, Milutinović B, Eggert H, Esser D, Rosenstiel P et al., Infection routes matter in population‐specific responses of the red flour beetle to the entomopathogen bacillus thuringiensis. BMC Genomics 15:445 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0079] 79. Vodovar N, Vinals M, Liehl P, Basset A, Degrouard J, Spellman P et al., Drosophila host defense after oral infection by an entomopathogenic pseudomonas species. Proc Natl Acad Sci 102:11414–11419 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0080] 80. Lee KA, Kim SH, Kim EK, Ha EM, You H, Kim B et al., Bacterial‐derived uracil as a modulator of mucosal immunity and gut‐microbe homeostasis in drosophila. Cell 153:797–811, Elsevier (2013). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0081] 81. González‐Santoyo I, Córdoba‐Aguilar A, González‐Tokman DM and Lanz‐Mendoza H, Phenoloxidase activity and melanization do not always covary with sexual trait expression in Hetaerina damselflies (Insecta: Calopterygidae). Behaviour 147:1285–1307 (2010). [Google Scholar]

[ps70969-bib-0082] 82. Saejeng A, Tidbury H, Siva‐Jothy MT and Boots M, Examining the relationship between hemolymph phenoloxidase and resistance to a DNA virus, plodia interpunctella granulosis virus (PiGV). J Insect Physiol 56:1232–1236 (2010). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0083] 83. Klemm P and Schembri MA, Bacterial adhesins: function and structure. Int J Med Microbiol 290:27–35 (2000). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0084] 84. Murdoch SL, Trunk K, English G, Fritsch MJ, Pourkarimi E and Coulthurst SJ, The opportunistic pathogen Serratia marcescens utilizes type VI secretion to target bacterial competitors. J Bacteriol 193:6057–6069 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0085] 85. Williams DJ, Hawkins A, Hernandez RE, Mariano G, Mathers K, Buchanan G et al., Competitive behaviors in Serratia marcescens are coordinately regulated by a lifestyle switch frequently inactivated in the clinical environment. Cell Host Microbe 33:252–266.e5 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0086] 86. Zhang S, Wang Z, Liu A, Li J, Zhuang J, Ji X et al., Hosts and commensal bacteria synergistically antagonize opportunistic pathogens at the single‐cell resolution. Adv Sci 12:e00582 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0087] 87. Manzano‐Marín A and Latorre A, Snapshots of a shrinking partner: genome reduction in Serratia symbiotica . Sci Rep 6:6:32590 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0088] 88. Perreau J, Patel DJ, Anderson H, Maeda GP, Elston KM, Barrick JE et al., Vertical transmission at the pathogen‐symbiont interface: Serratia symbiotica and aphids. mBio 12:e00359‐21 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0089] 89. Pons I, Renoz F, Noël C and Hance T, New insights into the nature of symbiotic associations in aphids: infection process, biological effects, and transmission mode of cultivable Serratia symbiotica bacteria. Appl Environ Microbiol 85:e02445‐18 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0090] 90. Munoz MM, Spencer N, Enomoto S, Dale C and Rio RVM, Quorum sensing sets the stage for the establishment and vertical transmission of Sodalis praecaptivus in tsetse flies. PLoS Genet 16:e1008992 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0091] 91. Mphande K, LaSarre B, Paulsen AA, Hartung R, Badilla‐Arias S, Gleason ML et al., Bacteria that cause cucurbit yellow vine disease fall within the Serratia ureilytica wpecies of the S. marcescens complex and can be vectored by cucumber beetles. Phytopathology 115:606–617 (2025). [DOI] [PubMed] [Google Scholar]

[ps70969-bib-0092] 92. Aracil‐Gisbert S, Fernández‐De‐Bobadilla MD, Guerra‐Pinto N, Serrano‐Calleja S, Pérez‐Cobas AE, Soriano C et al., The ICU environment contributes to the endemicity of the “Serratia marcescens complex” in the hospital setting. mBio 15:e03054‐23 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ps70969-bib-0093] 93. Karaolan B, Alkassab AT, Borges S, Fisher T, Link‐Vrabie C, Mcvey E et al., Microbial pesticides: challenges and future perspectives for non‐target organism testing. Environ Sci Eur 36:205 (2024). [Google Scholar]

[ps70969-bib-0094] 94. Colagiorgi A, S16‐03 microbial pesticides: a regulatory overview. Toxicol Lett 411:S31 (2025). [Google Scholar]

PERMALINK

Comparative analyses of the Serratia marcescens complex reveal variations in their pathogenicity against a fruit pest

Zi‐yuan Li

Xiang Li

Lu‐chen Xu

Miao‐miao Zhang

Yong‐yue Lu

Yi‐xiang Qi

Abstract

BACKGROUND

RESULTS

CONCLUSION

1. INTRODUCTION

2. MATERIALS AND METHODS

2.1. Insects

2.2. Bacterial strains

Table 1.

2.3. Genomic DNA extraction

2.4. Library construction and genome sequencing

2.5. Average nucleotide identity (ANI) analysis and phylogenetic analysis

2.6. Survival assays

2.7. Immune response of Bactrocera dorsalis to Serratia marcescens complex infection

2.8. In vitro assays of virulence factors

2.9. Comparative genomics

3. RESULTS

3.1. Genomic features, genomic average nucleotide identity (ANIm) and phylogenetic analysis

Table 2.

Figure 1.

3.2. Virulence of four Serratia marcescens complex strains against Bactrocera dorsalis

Figure 2.

3.3. Immune gene expression in infected Bactrocera dorsalis

Figure 3.

Figure 4.

3.4. In vitro virulence characteristics of four Serratia marcescens complex strains

Figure 5.

3.5. Comparative analysis of virulence‐associated genes among four Serratia marcescens complex strains

Figure 6.

Table 3.

4. DISCUSSION

CONFLICT OF INTEREST

Supporting information

ACKNOWLEDGEMENTS

Contributor Information

DATA AVAILABILITY STATEMENT

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases