Hsa_circ_0000231 activates the MAPK pathway via IGF2BP2-mediated CACNA1H mRNA stabilization to promote cervical cancer progression

Abstract

Background

Circular RNAs (circRNAs) are key regulators in tumorigenesis, including cervical cancer (CC), but their specific roles and molecular mechanisms in CC remain incompletely understood. This study further explored the functional role of hsa_circ_0000231 in CC cells and its underlying molecular mechanisms.

Methods

The circular nature of circ_0000231 was confirmed using Sanger sequencing, divergent primer PCR, RNase R digestion assay, and subcellular fractionation assay. Gain-of-function experiments involved transfecting SiHa and HeLa cells with circ_0000231-overexpressing plasmids, whereas loss-of-function experiments utilized shRNA-mediated silencing of circ_0000231 in MS751 cells and siRNA-mediated knockdown of CACNA1H in SiHa and HeLa cells. Gene expression levels were verified by qPCR. RNA immunoprecipitation (RIP) assay was used to confirm the direct interactions of circ_0000231 and CACNA1H with IGF2BP2, and mRNA stability assay was employed to evaluate the effect of circ_0000231 and IGF2BP2 on CACNA1H mRNA stability. Cell proliferation, cycle distribution, apoptosis, migration, and invasion were analyzed using MTT, flow cytometry, and Transwell assays, respectively. mRNA transcriptome sequencing was performed to identify differentially expressed genes (DEGs) in CC cells after circ_0000231 overexpression, and protein levels were detected by Western blot.

Results

Compared with non-tumorigenic immortalized human keratinocyte Hacat cells, hsa_circ_0000231 was upregulated in most CC cell lines (HeLa, SiHa, MS751) but not in Caski cells. It exhibited resistance to RNase R digestion and was predominantly localized in the cytoplasm of MS751 cells. Overexpression of circ_0000231 promoted cell proliferation, cell cycle progression, migration, and invasion, while inhibiting apoptosis in CC cells. Conversely, silencing circ_0000231 in MS751 cells exerted the opposite effects. mRNA transcriptome sequencing and KEGG pathway analysis identified the MAPK pathway as an enriched pathway. Intersection analysis of DEGs in HeLa and SiHa cells revealed that CACNA1H, a MAPK pathway-related gene, was upregulated in circ_0000231-overexpressing cells. Silencing CACNA1H reversed the pro-tumor effects of circ_0000231 overexpression, specifically attenuating MAPK pathway activation, restoring apoptosis, and inhibiting cell viability, migration, and invasion. Furthermore, RIP assay confirmed that both circ_0000231 and CACNA1H could bind to IGF2BP2. Knockdown of circ_0000231 or IGF2BP2 significantly reduced the mRNA stability of CACNA1H in MS751 cells, indicating that the hsa_circ_0000231/IGF2BP2 axis enhances CACNA1H mRNA stability.

Conclusions

Hsa_circ_0000231 acts as an oncogenic circRNA in CC by promoting cell proliferation, migration, and invasion, and activating the MAPK pathway via CACNA1H. Mechanistically, circ_0000231 regulates CACNA1H mRNA stability through binding to IGF2BP2, which clarifies the molecular mechanism underlying circ_0000231-mediated CC progression. These findings extend the current understanding of circ_0000231 regulatory networks in CC and highlight circ_0000231 as a potential therapeutic target.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12672-026-05378-2.

Introduction

Cervical cancer (CC) is one of the most prevalent gynecological malignancies globally, accounting for approximately 7% of all newly diagnosed female cancers [1]. Despite advancements in surgical resection, chemotherapy, and radiotherapy [2, 3], the five-year survival rate for CC patients remains less than 30% in most regions [4]. Genetic alterations are critical drivers of CC initiation and progression [5], making the identification of key molecular mechanisms essential for improving early diagnosis and therapeutic outcomes.

Circular RNAs (circRNAs) are a class of non-coding RNAs characterized by covalently closed loop structures without 3’ and 5’ ends [6, 7]. Accumulating evidence indicates that circRNAs play pivotal roles in regulating cell proliferation, cycle progression, apoptosis, and metastasis, and are closely implicated in various diseases, particularly cancer [8–13]. For example, CircRNA8924 and CircEIF4G2 have been shown to promote CC progression by regulating downstream molecular targets [14, 15]. High-throughput sequencing technologies have further uncovered extensive circRNA expression profiles in CC [16–18].

Hsa_circ_0000231 has been implicated in the progression of multiple cancers. In gastric cancer, it serves as a potential diagnostic marker due to its dynamic serum expression [19]. In colorectal cancer, it accelerates tumor progression via the miR-502-5p/MYO6 or miR-140-3p/Bcl-2 pathways [20, 21], while in breast cancer, it interacts with hnRNP K to regulate cell proliferation and apoptosis [22]. A recent study reported that circ_0000231 promotes CC progression through the m6A/FOXM1 axis, with IGF2BP2 (a key m6A reader protein) involved in stabilizing target mRNAs [23]. However, the comprehensive molecular mechanisms by which circ_0000231 regulates CC progression, especially its downstream signaling pathways and interaction with RNA-binding proteins, remain incompletely understood.

In this study, we confirmed the circular structure and expression pattern of circ_0000231 in CC cells. Through gain-of-function and loss-of-function assays, we further verified its pro-tumor effects on biological behaviors of CC cells. Using mRNA transcriptome sequencing, we identified the MAPK pathway as a key regulatory axis, with CACNA1H acting as a critical mediator. Furthermore, we explored the interaction between circ_0000231, IGF2BP2, and CACNA1H, and clarified the regulatory role of the circ_0000231/IGF2BP2 axis in CACNA1H mRNA stability, providing a supplementary downstream regulatory axis for circ_0000231 in CC progression.

Materials and methods

Circular structure confirmation

Sanger sequencing and divergent primer PCR were performed to confirm the circular structure of circ_0000231. Briefly, PCR products were amplified from CC cells using circ_0000231-specific divergent primers, inserted into the T vector, and subjected to Sanger sequencing. Results were verified by alignment with the back-spliced region of circ_0000231 in the circBASE database [24]. For divergent primer PCR, circular and linear transcripts of circ_0000231 were amplified from cDNA and gDNA extracted from CC cells.

The RNase R digestion assay was used to verify the resistance of circ_0000231 to RNase R. Total RNA from CC cells was divided into two aliquots: one treated with RNase R (Epicentre) and the other treated with RNase-free water as a control. The expression of circ_0000231 and its linear transcript ARHGAP12 was detected by RT-PCR.

Subcellular fractionation assay was performed using the Nuclear/Cytoplasmic Fractionation Kit (Thermo Fisher Scientific) to separate nuclear and cytoplasmic fractions of MS751 cells. qRT-PCR was used to detect the distribution of circ_0000231, with U6 as the nuclear reference and GAPDH as the cytoplasmic reference.

Cell culture and transfection

Caski, HeLa, SiHa, MS751 and non-tumorigenic immortalized human keratinocyte (Hacat) cells were purchased from ATCC. All cells were cultured in DMEM supplemented with 10% FBS (Sigma) at 37 °C in a 5% CO₂ incubator.

Cell transfection

For circ_0000231 overexpression, a circ_0000231-overexpression plasmid (Geneseed, Guangzhou, China) was transfected into HeLa and SiHa cells with Lipofectamine 3000 (Invitrogen) for 24 h, with the LV003 plasmid (Yongnuo Bio, Guangzhou, China) as the negative control (NC).

For circ_0000231 silencing, shRNA targeting circ_0000231 (sequence: ACTGAACAGATAAGGGTTTAA) or negative control shRNA (sh-NC) (GenePharma, Shanghai, China) was transfected into MS751 cells using Lipofectamine 3000 for 24 h.

To silence CACNA1H, three siRNA sequences targeting CACNA1H were transfected into SiHa and HeLa cells using Lipofectamine 3000 for 24 h: Positions 411–433: Guide sequence (AAAUAGAGCGUCAAAGGCC), Passenger sequence (CCUUUG AGGCUCUGUUUCAC) ; Positions 1169–1191: Guide sequence (UGAAGUUGUAG AGAGUGGGG), Passenger sequence (CACUCAUUCUACAUCUUCAC) ; Positions 2804–2826: Guide sequence (UGAACUGUCACGCCAGGAAGU), Passenger sequence (CUUUUGGUCUGUUUCGUUCAG) .

For IGF2BP2 silencing, IGF2BP2 siRNA (si-IGF2BP2; sense: 5’-GGGACCAAGAUAACAAUCUTT-3’, antisense: 5’-AGAUUGUUAUCUUGGU CCCTT-3’) and its negative control (si-NC) (GenePharma) were transfected into MS751 cells for subsequent mRNA stability assays.

qPCR analysis

Total RNA was collected from whole-cell lysates or nuclear/cytoplasmic fractions using TRIzol (Invitrogen, USA). cDNA was synthesized with M-MLV reverse transcriptase (TaKaRa). qPCR was performed using TB Green Premix Ex Taq II (TaKaRa Bio) and specific primers (Table 1) on a real-time PCR system. The 2^−ΔΔCt method was used to analyze circ_0000231 expression, with GAPDH as the internal reference.

Table 1.

Primer sequences for qPCR detection

Primer Name	Primer Sequence (5’–3’)
hsa_circ_0000231-circ-F	ACTAGCTTCTCCCAGGAACA
hsa_circ_0000231-circ-R	AGGAGATCTACACCAGTATCACA
hsa_circ_0000231-line-F	CAAAGCTCTCATGCCACCTG
hsa_circ_0000231-line-R	GGTCAGGTCCAGGCTTAGGT
GAPDH-line-F	AAGGTGAAGGTCGGAGTCAA
GAPDH-line-R	AATGAAGGGGTCATTGATGG
GAPDH-circ-F	TCCTCACAGTTGCCATGTAGACCC
GAPDH-circ-R	TGCGGGCTCAATTTATAGAAACCGGG
CACNA1H-F	CACTTTCCCCAGCCCAGAG
CACNA1H-R	AGGTCGAGATAGTGGCTGGT

F, forward primer; R, reverse primer

MTT assay

Transfected CC cells (3 × 10³ cells/well) were seeded into 96-well plates. At 24, 48 and 72 h after transfection, 20 µl of MTT (Sigma-Aldrich) was added to each well and incubated for 2 h. After removing the supernatant, 150 µl of DMSO was added to dissolve the formazan crystals. Subsequently, the optical density (OD) was measured at 492 nm using a spectrophotometer.

Flow cytometry analysis

Transfected cells (3 × 10⁵ cells/well) were seeded into six-well plates and incubated for 48 h. Cells were trypsinized, washed twice with PBS, fixed, and stained with the Annexin V/PI staining kit (KeyGEN Biotech) according to the manufacturer’s instructions. Apoptosis and cell cycle distribution were detected using a flow cytometer (BD Biosciences), and data were analyzed with FlowJo software.

Transwell assay

Cell migration and invasion were assessed with Corning Costar Transwell chambers (Corning, NY, USA). For migration assays, 4 × 10⁴ transfected cells in serum-free medium were seeded into the upper chamber, and complete medium was added to the lower chamber. For invasion assays, the upper chamber was pre-coated with Matrigel (Corning) before seeding cells. After 24 h of incubation, non-migratory and invasive cells in the upper chamber were removed with a cotton swab. Migrated and invaded cells adhering to the lower surface of the membrane were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and counted under a microscope (five random fields per chamber).

mRNA transcriptome sequencing

After PCR amplification, libraries were quantified using a Qubit 4.0 Fluorometer (Thermo Fisher Scientific) and assessed for size distribution with an Agilent 2100 Bioanalyzer (Agilent Technologies). Library quality control (QC) criteria required an effective library concentration of ≥ 10 nM, an insert fragment peak size between 200 and 300 bp, and the absence of obvious primer dimer or contamination peaks. Sequencing was performed on an Illumina NovaSeq 6000 platform (Illumina, USA) with 150 bp paired-end reads. Raw sequencing data were processed using Trimmomatic (v0.39) to remove low-quality reads (Qscore < 20), adapter sequences, and N-containing reads, yielding clean reads. Core RNA-seq QC metrics (clean data rate, Q30 base percentage, and GC content) were calculated to evaluate sequencing quality. Clean data were aligned to the human reference genome (GRCh38/hg38) using HISAT2 (v2.1.0) with default parameters. DEGs were identified using DESeq2 (v1.38.0) with FDR ≤ 0.05 and |log₂FoldChange| ≥ 1 as thresholds.

KEGG analysis

KEGG pathway enrichment analysis was performed using the KOBAS-i database. KEGG pathways were prioritized based on two statistical indicators: [1] the adjusted P-value (Padj < 0.05) indicating statistical significance; [2] the Rich factor (the ratio of DEGs in the pathway to the total number of genes in the pathway) reflecting the degree of enrichment. Pathways were primarily sorted by Padj in ascending order, with the Rich factor used for secondary sorting in descending order. Due to the lack of statistical significance for enrichment of multiple pathways, a selective visualization strategy was adopted: the top 10 pathways with the largest number of DEG inputs were plotted for individual SiHa/HeLa cells, and the top 20 pathways with the smallest p values were plotted for the intersecting DEGs of the two cell lines.

Western blot analysis

Total protein was extracted from cells using RIPA buffer (Beyotime) supplemented with PMSF (Sigma-Aldrich, USA). Protein concentration was determined using the BCA protein assay kit (Beyotime). Equal amounts of protein (35 µg) were separated by 12% SDS-PAGE and transferred onto PVDF membranes (Millipore). Membranes were blocked with 5% non-fat milk in TBST for 1 h at room temperature, then incubated overnight at 4 °C with primary antibodies: p-ERK (CST, 9106, 1:2000), ERK (CST, 9102, 1:1000), p-P38 (CST, 4511, 1:1000), P38 (CST, 8690, 1:1000), IGF2BP2 (Proteintech, 11601-1-AP, 1:2000), and GAPDH (Proteintech, 60004-1-lg, 1:10000). Following TBST washes, membranes were incubated for 2 h at room temperature with the appropriate secondary antibodies: Mouse IgG (Jackson, 115-035-003, 1:2000) for p-ERK and GAPDH, and Rabbit IgG (Jackson, 111-035-003, 1:2000) for ERK, p-P38, P38, and IGF2BP2. Protein bands were visualized using an ECL kit (Pierce Chemical) and quantified with ImageJ software.

RNA immunoprecipitation (RIP) assay

RIP assay was performed using the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore) according to the manufacturer’s instructions. Briefly, MS751 cells were lysed with RIP lysis buffer, and cell lysates were incubated with magnetic beads conjugated with anti-IGF2BP2 antibody (Proteintech) or normal rabbit IgG (Millipore) as a negative control at 4 °C overnight. After washing, immunoprecipitated RNA was extracted and purified using TRIzol. qPCR was performed to detect the enrichment of circ_0000231 and CACNA1H in the immunoprecipitates.

mRNA stability assay

MS751 cells were transfected with sh-NC, sh-circ_0000231, si-NC, or si-IGF2BP2 for 48 h and subsequently treated with 5 µg/mL actinomycin D (Sigma-Aldrich) to inhibit de novo RNA synthesis. Total RNA was extracted at 0, 3, and 6 h after actinomycin D treatment. qPCR was used to detect CACNA1H mRNA expression, with the 0 h time point set as 100% to calculate relative mRNA levels. mRNA stability was analyzed by fitting the decay curve using GraphPad Prism 8.

Statistical analysis

All experiments were performed with three independent biological replicates, and each biological replicate included three technical replicates for quantitative detection. Data are presented as the mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 8 (San Diego, CA, USA). Comparisons between two groups were analyzed by two-tailed unpaired Student’s t-test, and comparisons among multiple groups were analyzed by one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. For mRNA transcriptome sequencing and KEGG pathway enrichment analysis, the Benjamini-Hochberg (BH) method was used for multiple test correction to calculate FDR and Padj, respectively. Statistical significance was defined as P < 0.05, and “ns” (no significant difference) was used to indicate P ≥ 0.05. P < 0.01 was used to indicate highly significant differences in the figures.

Results

Confirmation of circular characteristics and circ_0000231 expression in CC cells

Hsa_circ_0000231 is derived from exons 2–3 of RhoA GTPase activating protein 12 (ARHGAP12) (Fig. 1A). Divergent primer PCR results showed that circular transcripts of ARHGAP12 were amplified only from cDNA, not from gDNA (Fig. 1B). Additionally, Sanger sequencing (Supplementary Materials; data file S1) confirmed the back-spliced region of circ_0000231 (Fig. 1C), consistent with the circBASE database [24]. The RNase R digestion assay demonstrated that circ_0000231 was resistant to RNase R, while its linear transcript ARHGAP12 was significantly degraded (Fig. 1D), further confirming its circular nature. Subcellular fractionation assay revealed that circ_0000231 was predominantly localized in the cytoplasm of MS751 cells (Fig. 1E). qPCR analysis showed that circ_0000231 expression was significantly upregulated in HeLa, SiHa, and MS751 cells compared with Hacat cells, but no significant difference was observed in Caski cells (Fig. 1F). These results indicate that circ_0000231 may play a context-dependent role in the biological functions of CC cells.

Fig. 1.

Confirmation of circular characteristics and circ_0000231 expression. A Schematic illustration showing that hsa_circ_0000231 is derived from exons 2–3 of ARHGAP12. B Divergent primer PCR validation of circ_0000231 in CC cells. ►◄, convergent primers; ◄►, divergent primers. C Sanger sequencing confirmation of the back-spliced region of circ_0000231. D RT-PCR analysis of circ_0000231 and ARHGAP12 mRNA expression after RNase R digestion. E qPCR analysis of circ_0000231 distribution in nuclear and cytoplasmic fractions of MS751 cells (U6: nuclear reference; GAPDH: cytoplasmic reference). F qPCR analysis of circ_0000231 expression in Caski, HeLa, SiHa, MS751, and Hacat cells. ** p < 0.01 vs. Hacat; ns, no significant difference

Circ_0000231 overexpression promotes CC cell proliferation, migration and invasion

To investigate the functional role of circ_0000231, HeLa and SiHa cells (with relatively low endogenous circ_0000231 expression) were transfected with circ_0000231-overexpressing plasmids. qPCR confirmed that circ_0000231 expression was significantly upregulated in transfected cells compared with NC (Fig. 2A). MTT assay showed that circ_0000231 overexpression significantly enhanced cell proliferation at 48 and 72 h (Fig. 2B). Flow cytometry analysis revealed that circ_0000231 overexpression reduced the proportion of cells in the G0/G1 phase and increased the proportion of cells in the S and G2/M phases (Fig. 2C). Furthermore, it decreased the rate of early and late apoptosis (Fig. 2D). Transwell assay demonstrated that circ_0000231 overexpression significantly increased the number of migratory and invasive cells in both HeLa and SiHa cells (Fig. 2E, F). These results indicate that circ_0000231 overexpression promotes CC cell malignant phenotypes.

Fig. 2.

Circ_0000231 overexpression promotes CC cell malignant phenotypes. A qPCR validation of circ_0000231 overexpression in HeLa and SiHa cells. B MTT assay showing cell proliferation in circ_0000231-overexpressing and NC cells. C Flow cytometry analysis of cell cycle distribution. D Flow cytometry analysis of cell apoptosis. E, F Transwell assay showing cell migration and invasion in SiHa (E) and HeLa (F) cells. ** p < 0.01 vs. NC; ns: no significant difference

Circ_0000231 silencing inhibits MS751 cell proliferation, migration, and invasion

To further verify the oncogenic role of circ_0000231, MS751 cells (with high endogenous circ_0000231 expression) were transfected with sh-circ_0000231. qPCR confirmed that circ_0000231 expression was significantly downregulated compared with sh-NC (Fig. 3A). MTT assay showed that circ_0000231 silencing significantly inhibited cell proliferation at 48 and 72 h (Fig. 3B). Flow cytometry analysis revealed that silencing circ_0000231 increased the proportion of cells in the G0/G1 phase, decreased the proportion of cells in the S and G2/M phases (Fig. 3C), and promoted cell apoptosis (Fig. 3D). Transwell assay demonstrated that circ_0000231 silencing significantly reduced the migration and invasion abilities of MS751 cells (Fig. 3E). These results further confirm that circ_0000231 acts as an oncogenic circRNA in CC cells.

Fig. 3.

Circ_0000231 silencing inhibits MS751 cell malignant phenotypes. A qPCR validation of circ_0000231 silencing in MS751 cells. B MTT assay showing cell proliferation in sh-circ_0000231 and sh-NC cells. C Flow cytometry analysis of cell cycle distribution. D Flow cytometry analysis of cell apoptosis. E Transwell assay showing cell migration and invasion. ** p < 0.01 vs. sh-NC; ns, no significant difference

Identification of the MAPK pathway as a key enriched pathway in circ_0000231- overexpressing CC cells

To explore the molecular mechanisms underlying circ_0000231-mediated CC progression, mRNA transcriptome sequencing was performed on circ_0000231-overexpressing and NC cells. A total of 531 DEGs (160 upregulated, 371 downregulated) were identified in SiHa cells, and 369 DEGs (164 upregulated, 205 downregulated) in HeLa cells (complete DEG lists are provided in Supplementary Materials; Table S1 and Table S2). Heatmaps showed distinct mRNA expression profiles between circ_0000231-overexpressing and NC groups (Fig. 4A, B). KEGG pathway enrichment analysis was performed, and the top 10 pathways with the largest number of DEG inputs were visualized for each cell line (Fig. 4C, D). In SiHa cells, enriched pathways included metabolic pathways, cytokine-cytokine receptor interaction, and pathways in cancer (Fig. 4C). In HeLa cells, enriched pathways included metabolic pathways, oxytocin pathway, and transcriptional misregulation in cancer (Fig. 4D). Notably, the MAPK pathway— a well-recognized canonical pathway regulating tumor cell proliferation, migration, invasion, and apoptosis—was enriched in both cell lines [25–27]. Given its critical role in malignant progression, the MAPK pathway was selected for further mechanistic validation.

Fig. 4.

mRNA transcriptome sequencing and KEGG pathway enrichment analysis of circ_0000231-overexpressing CC cells. A, B Heatmaps of DEGs in SiHa (A) and HeLa (B) cells. C, D KEGG pathway enrichment analysis for DEGs showing the top 10 pathways with the largest number of DEG inputs in SiHa (C) and HeLa (D) cells

Circ_0000231 activates the MAPK pathway via upregulating CACNA1H

Venn diagram analysis of DEGs in HeLa and SiHa cells identified 29 overlapping DEGs (Fig. 5A). A heatmap of 15 core DEGs with consistent expression trends showed that CACNA1H—a well-established upstream regulator of the MAPK pathway—was significantly upregulated in circ_0000231-overexpressing cells (Fig. 5B). KEGG pathway enrichment analysis of intersecting DEGs (top 20 pathways with the smallest p values) further confirmed the enrichment of the MAPK pathway (Fig. 5C). qPCR verified that CACNA1H mRNA expression was significantly upregulated in circ_0000231-overexpressing cells (Fig. 5D). Western blot analysis showed that circ_0000231 overexpression significantly increased the phosphorylation levels of ERK and P38 (core readout molecules of MAPK pathway activation selected for detection) without affecting total ERK and P38 levels (Fig. 5E). These results indicate that circ_0000231 activates the MAPK pathway in CC cells via upregulating CACNA1H.

Fig. 5.

Circ_0000231 activates the MAPK pathway via upregulating CACNA1H. A Venn diagram of overlapping DEGs in HeLa and SiHa cells. B Heatmap of 15 core DEGs with consistent expression trends. C KEGG pathway enrichment analysis of overlapping DEGs (top 20 pathways with the smallest p values). D qPCR analysis of CACNA1H expression in circ_0000231-overexpressing cells. E Western blotting analysis of p-ERK, ERK, p-P38, and P38 protein levels. ** p < 0.01 vs. NC

CACNA1H knockdown reverses the pro-tumor effects of circ_0000231 overexpression

To confirm the role of CACNA1H in circ_0000231-mediated CC progression, SiHa and HeLa cells were co-transfected with circ_0000231-overexpressing plasmids and CACNA1H siRNAs. qPCR confirmed that CACNA1H expression was significantly downregulated in cells transfected with CACNA1H siRNAs (Fig. 6A). MTT assay showed that CACNA1H knockdown reversed the increased cell viability induced by circ_0000231 overexpression (Fig. 6B). Flow cytometry analysis revealed that CACNA1H silencing restored the cell cycle distribution (Fig. 6C) and apoptosis rate (Fig. 6D) to normal levels. Transwell assay demonstrated that CACNA1H knockdown abolished the circ_0000231 overexpression-induced enhancement of migration and invasion (Fig. 6E). Western blot analysis showed that CACNA1H silencing reversed the increased phosphorylation levels of ERK and P38 induced by circ_0000231 overexpression (Fig. 6F). These results confirm that CACNA1H is a key mediator of circ_0000231-induced MAPK pathway activation and CC cell malignant phenotypes.

Fig. 6.

CACNA1H knockdown reverses the pro-tumor effects of circ_0000231 overexpression. A qPCR validation of CACNA1H silencing in HeLa and SiHa cells. B MTT assay showing cell proliferation in co-transfected cells. C Flow cytometry analysis of cell cycle distribution. D Flow cytometry analysis of cell apoptosis. E Transwell assay showing cell migration and invasion. F Western blot analysis of p-ERK, ERK, p-P38, and P38 protein levels. ** p < 0.01 vs. NC or OE-circ231 + siNC; ns: no significant difference

The hsa_circ_0000231/IGF2BP2 axis enhances CACNA1H mRNA stability

Previous studies have reported that hsa_circ_0000231 can bind to IGF2BP2 [23]. As an m6A reader protein, IGF2BP2 recognizes specific sequence motifs to bind target RNAs. We therefore analyzed the sequence characteristics of CACNA1H mRNA. Using the deepSRAMP database (http://www.cuilab.cn/deepsramp/), we identified an experimentally validated m6A modification site (Known m6A) on the CACNA1H transcript. Further analysis via the RBPmap web server (http://rbpmap.technion.ac.il/) revealed a highly matched IGF2BP2 RNA-binding motif approximately 3 nucleotides upstream of this m6A site. The close proximity between the m6A modification and IGF2BP2-binding motif strongly suggested that CACNA1H is a direct target of IGF2BP2. RIP assay confirmed that both circ_0000231 and CACNA1H were significantly enriched in anti-IGF2BP2 immunoprecipitates compared with IgG controls (Fig. 7A), indicating direct binding between circ_0000231, CACNA1H, and IGF2BP2. Western blot verified that si-IGF2BP2 efficiently reduced IGF2BP2 protein expression in MS751 cells (Fig. 7B). mRNA stability assay showed that knockdown of either circ_0000231 or IGF2BP2 significantly accelerated CACNA1H mRNA degradation (Fig. 7C). These findings indicate that hsa_circ_0000231 enhances CACNA1H mRNA stability by interacting with IGF2BP2, thereby upregulating CACNA1H expression in CC cells.

Fig. 7.

The hsa_circ_0000231/IGF2BP2 axis enhances CACNA1H mRNA stability. A RIP assay showing the enrichment of circ_0000231 and CACNA1H in anti-IGF2BP2 immunoprecipitates. B Western blot validation of IGF2BP2 silencing in MS751 cells. C mRNA stability assay showing CACNA1H mRNA decay after circ_0000231 or IGF2BP2 silencing. ** p < 0.01 vs. sh-NC or si-NC; ns: no significant difference

Discussion

CircRNAs have emerged as critical regulators of tumorigenesis [28, 29], and our study confirms that hsa_circ_0000231 acts as an oncogenic circRNA in CC. Consistent with previous reports [23], we found that circ_0000231 is upregulated in most CC cell lines and promotes malignant phenotypes. Notably, circ_0000231 expression was not significantly upregulated in Caski cells, which may be attributed to the heterogeneity of CC cell lines. Caski cells are derived from metastatic cervical squamous cell carcinoma with high-risk HPV16 integration and unique genetic alterations [30]; consequently, these cells may rely on alternative oncogenic signaling networks (e.g., other circRNAs, lncRNAs, or protein-coding genes) instead of circ_0000231. Additionally, differential activation of transcription factors or epigenetic modifications in Caski cells may regulate circ_0000231 expression, highlighting the need for subtype-specific investigations of circRNA functions in CC. Furthermore, the use of different cell lines for gain- and loss-of-function experiments was based on endogenous expression levels of circ_0000231; while this is a common strategy in circRNA functional studies, potential cell line–specific effects should be noted.

Previous studies have shown that circ_0000231 promotes CC progression through the m6A/FOXM1 axis [23]. Our study expands this understanding by identifying a supplementary regulatory axis: circ_0000231/IGF2BP2/CACNA1H/MAPK. We demonstrate that circ_0000231 binds to IGF2BP2 to enhance CACNA1H mRNA stability, thereby activating the MAPK pathway and promoting CC cell proliferation, migration, and invasion. This finding elucidates the post-transcriptional regulatory mechanism of circ_0000231 in CC and underscores its multifaceted role in driving tumor progression through distinct molecular pathways.

The MAPK pathway is an evolutionarily conserved signal transduction pathway that plays a pivotal role in regulating tumor cell biological behaviors [25–27]. In CC, MAPK pathway activation is associated with increased cell proliferation and migration [26, 31], and targeting this pathway enhances chemosensitivity [32]. We selected the MAPK pathway for investigation based on two key rationales: [1] its well-documented role in CC malignant progression; [2] the identification of CACNA1H— a classic upstream regulator of the MAPK pathway— as a core DEG in circ_0000231-overexpressing cells. Among multiple kinases in the MAPK cascade, ERK and P38 were selected as key readouts due to their well-established roles in CC proliferation and invasion [33, 34]. Our results demonstrate that the MAPK pathway is a critical mediator of circ_0000231-induced CC progression, further supporting its potential as a therapeutic target.

CACNA1H, a T-type calcium channel gene, is implicated in the progression of multiple cancers [35–37]. In ovarian clear cell carcinoma, CACNA1H regulates chemotherapy resistance [37]; in gliomas, its inhibition induces apoptosis [36]; and in breast cancer, it modulates calcium signaling during brain metastasis [35]. While CACNA1H has been linked to HPV-related cancers [38], its role in CC remains understudied. CACNA1H was prioritized from overlapping DEGs due to its consistent upregulation, known association with MAPK signaling, and potential functional relevance to CC malignancy, making it a reasonable candidate for mechanistic validation. Our study is the first to report that CACNA1H is a downstream target of circ_0000231 and mediates MAPK pathway activation in CC. Furthermore, we demonstrate that the circ_0000231/IGF2BP2 axis enhances CACNA1H mRNA stability, providing a novel post-transcriptional regulatory mechanism for CACNA1H expression in cancer cells.

Despite these findings, our study has several limitations. First, all results are based on in vitro cell line models; in vivo validation using xenograft or orthotopic CC models is needed to confirm the translational relevance of the circ_0000231/IGF2BP2/CACNA1H/MAPK axis. Second, clinical validation using CC patient samples was not performed in this study. We examined the TCGA database; however, hsa_circ_0000231 expression data are unavailable due to insufficient annotation of circRNAs in public transcriptomic datasets. Furthermore, the expression pattern of CACNA1H in cervical squamous cell carcinoma from TCGA was inconsistent with our in vitro results, which may be attributed to the tumor microenvironment, tissue heterogeneity, HPV status, and pathological subtype differences. Third, although we confirmed the activation of the MAPK pathway by detecting the phosphorylation levels of core kinases ERK and P38, we did not further investigate the upstream regulators (e.g., RAF, MEK) or downstream effectors (e.g., c-FOS, c-JUN) of this pathway. This limited coverage of the MAPK signaling cascade prevents a comprehensive dissection of the exact molecular cascade through which CACNA1H modulates MAPK activity. Fourth, direct evidence for m6A-dependent binding between IGF2BP2 and CACNA1H (e.g., m6A modification validation or motif mutation assays) was not obtained, although the current conclusion is supported by RIP and mRNA stability assays combined with bioinformatic motif analysis. Fifth, the novelty of this study is moderate as the oncogenic role of circ_0000231 in CC and its association with IGF2BP2 have been reported previously [23]; therefore, the primary contribution of this work lies in identifying an additional downstream regulatory axis. Future studies should explore the potential crosstalk between the circ_0000231/IGF2BP2/CACNA1H/MAPK and circ_0000231/m6A/FOXM1 axes, and cautiously evaluate the therapeutic potential of targeting this novel axis in vitro and in vivo.

Conclusion

Hsa_circ_0000231 acts as an oncogenic circRNA in CC by promoting cell proliferation, migration, and invasion, and activating the MAPK pathway. Mechanistically, circ_0000231 binds to IGF2BP2 to enhance CACNA1H mRNA stability, leading to the resulting upregulation of CACNA1H that drives MAPK pathway activation. This study identifies a supplementary regulatory axis of circ_0000231 in CC, providing novel insights into the molecular mechanism of circ_0000231-mediated CC progression.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

CC

Cervical cancer

circRNA

Circular RNA

hsa_circ_0000231

Circular RNA hsa_circ_0000231

CACNA1H

Calcium voltage-gated channel subunit alpha1 H

MAPK

Mitogen-activated protein kinase

qPCR

Quantitative polymerase chain reaction

MTT

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

siRNA

Small interfering RNA

shRNA

Short hairpin RNA

DEGs

Differentially expressed genes

KEGG

Kyoto Encyclopedia of Genes and Genomes

ERK

Extracellular signal-regulated kinase

P38

P38 mitogen-activated protein kinase

ANOVA

Analysis of variance

SD

Standard deviation

NC

Negative control

OE

Overexpression

FDR

False discovery rate

PBS

Phosphate-buffered saline

ECL

Enhanced chemiluminescence

IGF2BP2

Insulin-like growth factor 2 mRNA-binding protein 2

RIP

RNA immunoprecipitation

Author contributions

H.C. was responsible for conceptualization, project administration, and supervision, as well as writing – review & editing. S.M. and J.L. contributed to data curation, formal analysis, investigation, methodology, validation, and writing – original draft. X.D. and Z.L. participated in formal analysis, validation, visualization. All authors reviewed the manuscript.

Funding

No funding was received for this manuscript.

Data availability

The FASTA files of upstream and downstream sequences of hsa_circ_0000231 splice sites (300 bp) were obtained from circBase (https://www.circbase.org/cgi-bin/getseq.cgi). KEGG pathways analysis of DEGs was performed using the KOBAS-i ( http://bioinfo.org/kobas/genelist/) and the KEGG web server ( http://www.kegg.jp/ ). The datasets generated and/or analyzed during the current study are available in the Gene Expression Omnibus (GEO) repository under accession number GSE318117 (token: wncfswkendyvdor).

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.