Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Aug 12.
Published before final editing as: Mol Cancer Res. 2026 Jul 28:10.1158/1541-7786.MCR-26-0243. doi: 10.1158/1541-7786.MCR-26-0243

3β-HSD1-mediated steroid back-conversion can maintain androgen signaling in prostate cancer

Masoud Bitaraf 1,2,$, Mohammad Alyamani 1,2,$, Nikou Fotouhi 1,2, Jinyuan Shi 1,2, Ziqi Zhu 1,2, Yoon-Mi Chung 1,2, Jennifer Freedman 3, Daniel J George 3, Nima Sharifi 1,2,*
PMCID: PMC13458341  NIHMSID: NIHMS2200375  PMID: 42518214

Abstract

Dihydrotestosterone (DHT), the principal driver of prostate cancer, is inactivated via reduction of its 3-keto group to a 3β-hydroxyl (3β-OH). 3β-Hydroxysteroid dehydrogenase type 1 (3β-HSD1), encoded by HSD3B1, catalyzes 3β-OH oxidation and is stabilized by an adrenal-permissive germline variant, thereby enhancing androgen biosynthesis. Here, we tested whether 3β-HSD1 maintains androgen receptor (AR) signaling by back-converting the inactive metabolite 3β-androstanediol (3β-diol) to DHT, and whether it similarly oxidizes the abiraterone metabolite 3β-OH-5α-abiraterone (3β-OH-5α-Abi) to 3-keto-5α-Abi, a weak AR agonist. Using HSD3B1-overexpression and knockout in vitro models, we quantified steroid interconversion by mass spectrometry and AR-responsive gene expression by qPCR and RNA sequencing following 3β-diol exposure. HSD3B1 overexpression efficiently enabled the conversion of 3β-diol to DHT and 3β-OH-5α-Abi to 3-keto-5α-Abi. In C4–2 prostate cancer cells, 3β-diol–derived DHT regeneration and subsequent AR gene induction were blocked by the 3β-HSD1 inhibitor trilostane or abolished by HSD3B1 knockout. Clinically, in chemotherapy-naïve metastatic castration-resistant prostate cancer (mCRPC) patients treated with abiraterone, apalutamide, and prednisone in the PANTHER trial, men harboring the adrenal-permissive HSD3B1 genotype showed significantly greater serum depletion of 3β-OH-5α-Abi. These findings demonstrate that 3β-HSD1-mediated steroid back-conversion can maintain intratumoral androgens, providing further mechanistic insight into the poor outcomes associated with the adrenal-permissive HSD3B1 genotype and highlighting 3β-HSD1 as a critical therapeutic target in prostate cancer.

Keywords: 3β-HSD1, abiraterone, androgen, AR signaling, prostate cancer

Introduction

Androgen receptor (AR) signaling is a central driver of prostate cancer growth, progression, and therapeutic resistance. Consequently, neoplastic cells frequently overcome androgen deprivation therapy (ADT), which suppresses gonadal testosterone synthesis and has long constituted the therapeutic cornerstone for advanced disease (1, 2). Although tumors typically exhibit initial sensitivity to ADT, they ultimately acquire the ability to maintain AR pathway activity despite castrate-level serum testosterone, marking the development of castration-resistant prostate cancer (CRPC) through multiple mechanisms, including intracrine androgen metabolism and AR pathway alterations (3).

In both eugonadal men and men receiving ADT, intratumoral androgen biosynthesis from extragonadal precursors and/or de novo synthesis from cholesterol ultimately converges on the formation of dihydrotestosterone (DHT), a highly potent AR ligand that drives prostate cancer progression (4). Intracellular DHT is then inactivated through downstream conversion to the androstanediol stereoisomers, 3α-diol and 3β-diol (5) (Fig. 1A) among other metabolic routes. While the back-conversion of 3α-diol to DHT has been investigated, with several enzymes proposed to catalyze this reaction (5, 6, 7, 8, 9), the potential recycling of 3β-diol has been less clear. Prior work suggested that the back-conversion of 3β-diol to DHT could occur via 3β-hydroxysteroid dehydrogenase (3β-HSD) activity (10), but direct enzymatic attribution was not established.

Figure 1. Schematic of endogenous androgen and abiraterone metabolism by steroidogenic enzymes.

Figure 1.

(A) Dihydrotestosterone (DHT) is synthesized via three main routes: the canonical androgen biosynthesis pathway, the 5α-dione pathway (the predominant route from adrenal precursors in prostate cancer), and the back-conversion of androstanediol stereoisomers (3α/β-diol). (B) Abiraterone (Abi) undergoes sequential biotransformation by the same steroidogenic enzymes that drive androgen biosynthesis, resulting in structurally analogous metabolites. Downstream metabolites can undergo back-conversion to generate 3-keto-5α-Abi, a weak androgen receptor (AR) agonist. The structural conversion of the 3β-hydroxyl group (green shading) to the 3-keto group (red shading) is highlighted throughout the pathways. Established and hypothesized enzymatic roles of 3β-HSD1 are denoted by rectangles and pills, respectively. AD, androstenedione; AST, androsterone; Δ4A, Δ4-abiraterone; DHEA, dehydroepiandrosterone; DHT, dihydrotestosterone; diol, androstanediol; HSD, hydroxysteroid dehydrogenase; SRD5A, steroid 5α-reductase.

3β-HSD1, encoded by HSD3B1, catalyzes 3β-OH to 3-keto oxidation in intratumoral androgen biosynthesis from non-testicular precursor steroids (e.g., DHEA) in prostate cancer. A common germline missense-encoding variant, 1245A→C (the adrenal-permissive allele), produces a degradation-resistant enzyme with enhanced androgen-synthetic activity (2, 11). Inheritance of this allele is linked to worse clinical outcomes and accelerated progression to CRPC, consistent with increased androgen synthesis from adrenal precursors (12, 13). We therefore aimed to define whether 3β-HSD1 can oxidize 5α-reduced 3β-diol back to DHT, thereby reactivating an inactivated androgen pool, using pharmacologic inhibition with orthogonal genetic validation through CRISPR-Cas9–mediated genetic ablation.

Given the close structural and enzymatic parallels between androgen metabolism and abiraterone (Abi) biotransformation, our findings with endogenous androgens prompted us to investigate whether 3β-HSD1 similarly oxidizes structurally related Abi metabolites. Abi, a cytochrome P450 17A1 (CYP17A1) inhibitor, is widely used in advanced prostate cancer. Its metabolites possess steroidal backbones structurally analogous to intermediates in the androgen biosynthesis pathway, sharing a 17-carbon steroid backbone and conserved C3 functional groups across corresponding pairs (DHEA/Abi, T/D4A, DHT/3-keto-5α-Abi, 3β-diol/3β-OH-5α-Abi) (Fig. 1B). Given the similarity, we also explored whether 3β-HSD1 can back-convert 3β-OH-5α-Abi to 3-keto-5α-Abi, which is a weak androgen receptor agonist (14). Here, we demonstrate that 3β-HSD1 mediates the back-conversion of 3β-diol to DHT and that the HSD3B1 adrenal-permissive genotype is associated with lower serum levels of 3β-OH-5α-Abi in CRPC patients.

Materials and methods

Cell lines and culture conditions

The 293T (RRID:CVCL_0063), LNCaP (RRID:CVCL_0395), and VCaP (RRID:CVCL_2235) cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA), and C4–2 prostate cancer cells were generously provided by Dr. Leland Chung (Cedars-Sinai Medical Center, Los Angeles, CA). Cells were routinely tested for mycoplasma contamination using the MycoStrip 100 assay (rep-mysnc-100, InvivoGen). Cell line identity was confirmed by short tandem repeat (STR) profiling performed by Genetica DNA Laboratories (Cincinnati, OH).

C4–2, LNCaP, and 293T cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 medium (cat#11875119, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; cat#100–106, GeminiBio) and 1% penicillin/streptomycin (cat#15140122, Thermo Fisher Scientific). VCaP cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; cat#10–013-CV, Corning) with 10% FBS and 1% penicillin/streptomycin. Cells were cultured at 37 °C in a humidified incubator with 5% CO2.

For steroid metabolism experiments, cells were seeded in 12-well plates at 1.2–2.0 × 105 cells per well and cultured for 72h in medium containing charcoal-stripped FBS (CSS; cat#100–119, GeminiBio) prior to treatment to minimize background steroid exposure. Dulbecco’s phosphate-buffered saline (DPBS; cat#14190144, Thermo Fisher Scientific) and TrypLE™ Express Enzyme (cat#12-604-021, Thermo Fisher Scientific) were used for routine cell handling.

Generation of HSD3B1-overexpressing and HSD3B1-knockout cell lines

To generate HEK293T cells stably overexpressing HSD3B1, the full-length human HSD3B1 coding sequence (GenBank: NM_000862) was cloned into the p-cs lentiviral expression vector (Addgene plasmid #12158; RRID: Addgene_12158). Lentiviral particles harboring the HSD3B1 construct were generated and subsequently used to infect the HEK293T cells. Following transduction, successful overexpression was confirmed by Western blot analysis of 3β-HSD1 protein levels (Supplementary Fig. S1).

To generate HSD3B1-knockout (HSD3B1-KO) C4–2 cell lines, two distinct CRISPR/Cas9 systems and guide RNAs (gRNAs) were utilized. For the first knockout model, a custom CRISPR/Cas9 construct expressing an HSD3B1-targeting gRNA (5’-CCTTTCTGCTAGTATAAACG-3’) was synthesized by VectorBuilder (Chicago, IL). For the second knockout model, the lentiCRISPR v2 system (Addgene plasmid no. 52961, RRID:Addgene_52961; a gift from Feng Zhang) was utilized, incorporating an alternative HSD3B1-targeting gRNA (5′-CATACACCATTGTATAT-3′) using the LentiCRISPRv2 protocol (15, 16, 17).

Lentiviral particles were produced by co-transfecting 293T packaging cells with the CRISPR/Cas9 plasmid and standard helper plasmids (pMD2.G and psPAX2) using FuGENE HD Transfection Reagent (cat#E2311 Promega Corporation, Madison, WI) according to the manufacturer’s instructions. Viral supernatants were collected at 48 and 72 hours post-transfection, filtered through a 0.45-μm syringe filter, and used to transduce C4–2 cells in the presence of 8 μg/mL polybrene. Following transduction, cells were selected with 1–2 μg/mL puromycin (cat#ant-pr-1, InvivoGen, San Diego, CA). The VectorBuilder-transduced cells were maintained to establish a stable bulk population, whereas the lentiCRISPR v2-transduced cells were further isolated to establish a single-cell colony.

Gene modification efficiency was verified by quantitative real-time PCR (qPCR) using HSD3B1-specific primers, with expression normalized to RPLP0 (Supplementary Fig. S2A). Loss of protein band was confirmed by Western blot (Supplementary Fig. S2B). Furthermore, functional loss of 3β-HSD1 activity was confirmed by mass spectrometry measurement of steroid conversion, demonstrating a 95% reduction in 3β-HSD1-dependent metabolic activity in the bulk population, and a 99% reduction in the single-cell colony compared to control C4–2 cells.

Chemicals and reagents

All androgens, including dehydroepiandrosterone (DHEA), androstenedione (AD), dihydrotestosterone (DHT), testosterone (T), androstenediol (A5-diol), 5α-androstane-3,17-dione (5α-dione), 5α-androstane-3α,17β-diol (3α-diol), 5α-androstane-3β,17β-diol (3β-diol), 5α-androstan-3α-ol-17-one (3α-AST), and 5α-androstan-3β-ol-17-one (3β-AST), were purchased from Steraloids (Newport, RI). Internal standards, including DHEA-d2, 13C3-AD, DHT-d3, AST-d2, and T-d3, were also obtained from Steraloids. Abi and its metabolites were generously provided by Dr. Richard J. Auchus (Departments of Pharmacology and Internal Medicine, University of Michigan, Ann Arbor, MI). Deuterated abiraterone (Abi-d4) was purchased from Toronto Research Chemicals (Toronto, ON, Canada). The chemical 3β-HSD1 inhibitor, trilostane (cat#S1404), was purchased from Selleck Chemicals (Houston, TX).

Immunoblots

Total protein was extracted by direct lysis of cells in Laemmli Sample Buffer (cat#1610747, Bio-Rad), followed by boiling for 10 minutes. Proteins were resolved on 4–20% precast polyacrylamide gels (cat#4568094, Bio-Rad) using a Tris-glycine buffer system and transferred to PVDF membranes. Membranes were blocked for 1 hour at room temperature in TBST (137 mM NaCl, 20 mM Tris, 0.1% Tween-20, pH 7.6) containing 5% non-fat dry milk.

Membranes were incubated overnight at 4°C with anti-3β-HSD1 primary antibody (1:500; cat#ab55268, RRID: AB_942015, Abcam) diluted in TBST containing 3% non-fat dry milk. Following TBST washes, membranes were incubated for 1 hour at room temperature with anti-mouse IgG secondary antibody (1:4,000; cat#7076, RRID: AB_330924, Cell Signaling Technology). Signals were developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (cat#34094, Thermo Scientific) and visualized on ProSignal ECL Blotting Film (cat#30–507L, Genesee Scientific).

Because 3β-HSD1 and β-actin migrate at similar molecular weights, membranes were stripped using Restore Western Blot Stripping Buffer (cat#21059, Thermo Scientific), re-blocked in 5% non-fat dry milk in TBST, and re-probed overnight at 4°C with anti-β-actin 13E5 Rabbit mAb (1:15,000; cat#4970, RRID: AB_2223172, Cell Signaling Technology). After washing, membranes were incubated for 1 hour at room temperature with anti-rabbit IgG secondary antibody (1:4,000; cat#7074, RRID: AB_2099233, Cell Signaling Technology), and β-actin was detected using the same chemiluminescent development procedure described above.

RNA extraction and quantitative PCR (qPCR)

RNA was extracted from cells in 12-well plates using the RNeasy Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol. RNA concentrations were measured using an Implen NanoPhotometer N60. Total RNA (800 ng) was reverse transcribed into complementary DNA (cDNA) using the iScript cDNA Synthesis Kit (cat#1708891, Bio-Rad, Hercules, CA). An aliquot of cDNA corresponding to 20 ng of input RNA was used to perform qPCR on a QuantStudio 6 Pro Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA).

Expression of androgen receptor (AR) target genes (TMPRSS2, FKBP5, and KLK3/PSA) was analyzed using iTaq Universal SYBR Green Supermix (cat#1725124, Bio-Rad). Expression of HSD3B1 was quantified using a probe-based assay with PrimeTime Gene Expression Master Mix (cat#1055772, IDT, Coralville, IA). All analyses were performed in triplicate using the primer sets listed in Table 1. The cycling conditions were as follows: initial denaturation at 95°C for 30 s, followed by 45 cycles of 95°C for 10 s and 60°C for 30 s. For SYBR Green assays, melting curve analysis consisted of 95°C for 15 s, 65°C for 15 s, followed by a gradual temperature ramp from 65°C to 95°C at 0.5°C increments, and a final cooling step to 40°C. Quantification cycle (Cq) values for each gene were normalized to the reference gene RPLP0 using the 2-ΔΔCq method.

Table 1. Primer pairs and TaqMan probe sequences.

Oligonucleotide sequences for forward and reverse primers (5′→3′) and corresponding double-quenched TaqMan probes used for each target gene assay.

Gene name Forward sequence Reverse sequence
RPLP0 CGAGGGCACCTGGAAAAC CACATTCCCCCGGATATGA
FKBP5 AAAAGGCCACCTAGCTTTTTGC CCCCCTGGTGAACCATAATACA
TMPRESS2 CCATTTGCAGGATCTGTCTG GGATGTGTCTTGGGGAGCAA
PSA GGAAATGACCAGGCCAAGAC CAACCCTGGACCTCACACCTA
RPLP0 Taqman ATTACACCTTCCCACTTGCTG ACTCTTCCTTGGCTTCAACCTTA
HSD3B1 TaqMan CACACAGCAAAAAGCTTGCTGAG GTTGTTCAGGGCCTCGTTTATACTAG
RPLP0 Taqman Probe 56-FAM/AGGCCTTCT/ZEN/AGGCCTTCTTGGCTGATCCATCTGC/3IKBkFQ
HSD3B1 TaqMan Probe 56-FAM/TAAGGCACA/ZEN/AGTGTACAGGGTGCCGCC/3IKBkFQ

RNA-sequencing analysis

To assess broader transcriptional changes, starved scrambled control and HSD3B1-KO cells were treated with vehicle (ethanol), 5 nM DHT, or 1 nM 3β-diol before collection as cell pellets and submission to GENEWIZ/Azenta (RRID: SCR_003177, South Plainfield, NJ) for bulk RNA-seq on an Illumina platform. Preranked gene set enrichment analysis (GSEA) was performed using gseapy to evaluate enrichment of androgen receptor–dependent transcriptional programs, with the MSigDB Hallmark Androgen Response gene set serving as the reference signature.

Metabolite extraction and UHPLC-MS/MS analysis

Abi, its metabolites, androgens (DHEA, AD, DHT, T, A5-diol, 5α-dione, 3α-diol, 3β-diol, 3α-AST, and 3β-AST), and internal standards (Abi-d4, DHEA-d2, 13C3-AD, DHT-d3, AST-d2, and T-d3) were extracted from cell media or cell pellets following our previously validated liquid-liquid extraction protocols with slight modifications (18, 19). Briefly, internal standards were dissolved in a 1:1 mixture of H2O:methanol. Sample aliquots (100 μL) were spiked with 10 μL of the internal standard mixture and extracted with 2 mL of methyl tert-butyl ether (ACROS Organics). Samples were vortexed for 3 minutes and centrifuged for 5 minutes at 1,430 × g at 4°C. The organic layer was evaporated under a stream of nitrogen, and residues were reconstituted in 200 μL of H2O:methanol (1:1, v/v).

Metabolite and androgen levels were quantified using an ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) system. Chromatographic separation was performed on a Nexera X3 UHPLC (Shimadzu Corporation, Kyoto, Japan) coupled to a QTRAP 6500+ mass spectrometer (SCIEX, Framingham, MA) operated in positive polarity mode. Separation was achieved using an Agilent Zorbax Eclipse C18 analytical column (150 mm × 2.1 mm, 3.5 μm particle size) maintained at 40°C. The mobile phase consisted of (A) 0.1% formic acid in water and (B) 0.1% formic acid in acetonitrile:methanol (40:60, v/v), delivered via a gradient program at a flow rate of 0.2 mL/min. The injection volume was 10 μL. Analyst software (version 1.7) was used for data acquisition, and SCIEX OS (version 3.4) was used for data processing and quantitation. Analytes were quantified using the peak area ratio of the target compound to its corresponding internal standard.

Clinical sample collection

Samples were obtained from participants enrolled in the PANTHER trial (ClinicalTrials.gov identifier NCT03098836), a multicenter, open-label, phase II study evaluating apalutamide plus abiraterone acetate and prednisone in men with chemotherapy-naïve metastatic CRPC. The study was conducted at Duke University and enrolled patients with histologically confirmed prostate adenocarcinoma, castrate testosterone levels, and radiographic evidence of metastatic disease. The study protocol was approved by the Duke University Institutional Review Board (IRB Protocol Pro00075097), was performed in accordance with the ethical standards of the Declaration of Helsinki, and all participants provided written informed consent prior to inclusion.

Eligible patients received apalutamide (240 mg daily), abiraterone acetate (1,000 mg daily), and prednisone (5 mg twice daily) in 28-day cycles until disease progression or unacceptable toxicity. The primary endpoint was radiographic progression-free survival; secondary endpoints included PSA response, overall survival, and biomarker analyses. Peripheral blood samples were collected at predefined time points and sourced from the PANTHER biorepository under existing consent and material transfer agreements. Buffy coat fractions were used for germline DNA extraction and HSD3B1 genotyping using a validated melting assay (19). Matched serum samples were analyzed by LC-MS/MS to quantify abiraterone and its downstream steroidal metabolites.

Statistical analysis

All in vitro experiments were performed in triplicate. Results are presented as the mean ± standard deviation (SD) or median (interquartile range, IQR), as appropriate. Statistical comparisons between groups were conducted using the unpaired two-tailed Student’s t-test or Mann–Whitney U test in GraphPad Prism (version 10.4.1). A P < 0.05 was considered statistically significant.

Data availability

RNA sequencing data generated in this study are publicly available in the Sequence Read Archive (SRA) under BioProject accession PRJNA1493059. Additional data is available from the corresponding author upon reasonable request.

Code availability

The custom Python scripts used for downstream RNA sequencing analyses are available from the corresponding author upon reasonable request.

Results

3β-HSD1 converts 3β-OH androgens and abiraterone metabolites to their 3-keto forms

Consistent with its established C3 3β-hydroxy oxidation activity, 3β-HSD1 catalyzed oxidation of 3β-OH, 5α-reduced androgen metabolites to their corresponding 3-keto products in a heterologous expression system. 293T cells transfected with empty vector or an HSD3B1 overexpression construct were treated with 3β-AST or 3β-diol, and steroid products were quantified by LC-MS/MS. 5α-dione and DHT, the expected C3-oxidation products of 3β-AST and 3β-diol, respectively, were increased in HSD3B1-overexpressing cells, whereas product formation in control cells remained near background (Fig. 2A–B). In the same model, HSD3B1 overexpression supported conversion of abiraterone (Abi) to Δ4-abiraterone (D4A) and oxidation of 3β-OH-5α-Abi to the corresponding 3-keto metabolite, 3-keto-5α-Abi (Fig. 2C–D). Together, these data identify 3β-HSD1 as an enzyme that can catalyze the C3 oxidation step underlying 3β-OH “back-conversion” to 3-keto products for both endogenous and abiraterone-derived 5α-reduced steroids. Because this is a forced-expression system, these data establish enzymatic capability (sufficiency).

Figure 2. HSD3B1 overexpression in 293T cells drives the back-conversion of endogenous 3β-hydroxysteroids and abiraterone metabolites.

Figure 2.

(A–B) HSD3B1-overexpressing 293T cells efficiently convert 3β-AST to 5α-dione (A) and 3β-diol to DHT (B), with minimal conversion observed in empty vector controls. Data are presented as raw mass spectrometry (MS) intensity, as absolute quantification was not performed due to the lack of standard curves. (C–D) 3β-HSD1 converts abiraterone (Abi) to Δ4-abiraterone (D4A) (C) and catalyzes the back-conversion of 3β-OH-5α-Abi to 3-keto-5α-Abi (D). For all panels, cells were treated with 1 μM of the indicated substrate, and conditioned media were collected after 24 hours. OE, overexpression

3β-HSD1-mediated back-conversion enhances DHT synthesis and activates AR signaling

To evaluate the relevance of 3β-HSD1–dependent back-conversion in prostate cancer cells, we first assessed 3β-HSD1baseline enzymatic activity in C4–2 cells following treatment with 100 nM DHEA. The addition of the 3β-HSD inhibitor trilostane (1 μM) successfully inhibited 3β-HSD1 activity, as measured by LC-MS/MS quantification of downstream metabolites (Fig. 3A). Next, to test whether 3β-HSD1 mediates 3β-diol oxidation back to DHT, C4–2 cells were treated with 3β-diol in the presence or absence of trilostane. Trilostane (1 μM) blocked the back-conversion of 3β-diol to DHT, consistent with 3β-HSD activity contributing to this reaction (Fig. 3B). These findings were further validated in VCaP and LNCaP cells (Supplementary Fig. S3).

Figure 3. Pharmacologic and genetic suppression of 3β-HSD1 blocks 3β-diol back-conversion to DHT and attenuates AR signaling in C4–2 cells.

Figure 3.

(A) Trilostane (1 μM) inhibits 3β-HSD1 activity in C4–2 cells, assessed by LC-MS/MS measurement of downstream metabolites after treatment with 100 nM DHEA. (B) Trilostane (1 μM) blocks back-conversion of 3β-diol to DHT in C4–2 cells. (C) HSD3B1 knockout (HSD3B1-KO) reduces 3β-HSD1 enzymatic activity by ~95%, assessed by LC-MS/MS after treatment with 100 nM DHEA. (D) 3β-diol–derived DHT is detected in control C4–2 cells but is abolished in HSD3B1-KO cells; DHT was quantified in both conditioned media and cell pellets. (E) Expression of AR target genes (TMPRSS2, FKBP5, and KLK3/PSA) normalized to RPLP0 and plotted relative to the 5 nM DHT condition; cells were treated with 1 nM or 5 nM 3β-diol, or 5 nM DHT. (F) Gene Set Enrichment Analysis (GSEA) of RNA-seq data comparing Scrambled control and HSD3B1-KO cells treated with 1nM 3β-diol. The accompanying bar plot displays the individual log2 fold change (log2FC) values for the core enriched genes within this pathway. For all panels, cells were cultured in charcoal-stripped serum for 72 hours before treatment, and data shown are from the 24-hour time point. Error bars indicate SD from biological triplicates. Statistics: unpaired two-tailed t test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). For GSEA analysis, genes were ranked based on the Wald test statistic derived from DESeq2 differential expression analysis. Normalized enrichment scores and statistical significance (nominal p-value and false discovery rate [FDR]) were calculated using the GSEA Preranked algorithm with empirical gene set permutation testing.

To further validate the role of 3β-HSD1 in this reaction, we used CRISPR/Cas9-generated HSD3B1-KO C4–2 cells. Treatment with 100 nM DHEA followed by LC-MS/MS assessment confirmed that HSD3B1 knockout reduced 3β-HSD1 enzymatic activity by ~95% (Fig. 3C). Furthermore, when evaluating the back-conversion pathway, 3β-diol–derived DHT was detected in both the conditioned media and cell pellets of control cells but was completely abolished in HSD3B1-KO cells. This supports 3β-HSD1 as a key mediator of 3β-diol back-conversion to DHT in this model (Fig. 3D). Corresponding data from the second HSD3B1 gRNA knockout C4–2 cell line are provided in Supplementary Fig. S4.

To link this metabolism to AR pathway output, we measured the expression of AR target genes (TMPRSS2, FKBP5, and KLK3/PSA) normalized to RPLP0 using qPCR. Cells were treated with 1 nM or 5 nM 3β-diol, or 5 nM DHT. In control cells, 3β-diol increased transcript levels, plotted relative to the 5 nM DHT condition, whereas induction was attenuated in HSD3B1-KO cells. This is consistent with 3β-HSD1–dependent regeneration of an AR-active ligand pool (Fig. 3E).

To determine whether these ligand-dependent changes in AR target gene expression extended to the broader transcriptome, we performed RNA-seq on starved scrambled control and HSD3B1-KO C4–2 cells treated with 1 nM 3β-diol. GSEA using the Hallmark Androgen Response gene set demonstrated enrichment of androgen-responsive transcriptional programs in scrambled control cells relative to HSD3B1-KO cells following 3β-diol treatment (Fig. 3F).

HSD3B1 genotype is associated with serum 3β-OH-5α-Abi levels in mCRPC

To evaluate clinical relevance, we analyzed serum 3β-OH-5α-Abi concentrations in patients from the multicenter phase II PANTHER trial receiving apalutamide plus abiraterone acetate and prednisone (Fig. 4). Patients were stratified by HSD3B1 adrenal-permissive versus adrenal-restrictive genotype, and 3β-OH-5α-Abi was quantified at predefined collection time points during cycles 1–2. Men with adrenal-permissive genotype had significantly lower serum 3β-OH-5α-Abi levels relative to men with adrenal-restrictive genotype. Because these data quantify a single metabolite level rather than full PK parameters, we describe this as an association consistent with altered abiraterone metabolite handling, rather than definitive modulation of abiraterone pharmacokinetics or a proven increase in 3β-HSD1–mediated oxidation in vivo.

Figure 4. The adrenal-permissive HSD3B1 genotype is associated with enhanced 3β-OH-5α-Abi back-conversion in patients with mCRPC.

Figure 4.

Men carrying the adrenal-permissive HSD3B1 genotype exhibit altered abiraterone metabolism consistent with higher 3β-HSD1-mediated back-conversion of 3β-OH-5α-Abi to 3-keto-5α-Abi. Pharmacokinetic analysis of patient serum from the PANTHER trial demonstrates significantly lower circulating levels of 3β-OH-5α-Abi in the adrenal-permissive group at the 4-hour (A, C) and 8-hour (B, D) post-dose time points during treatment cycle 1 (A, B) and cycle 2 (C, D). Each data point represents an individual patient (adrenal-permissive n=16, adrenal-restrictive n=33). Horizontal lines and error bars denote the median and interquartile range (IQR). Statistical significance was assessed using the two-tailed Mann–Whitney U test (* p < 0.05, ** p < 0.01).

Discussion

The association between inheritance of the adrenal-permissive HSD3B1 (1245C) allele and adverse outcomes in prostate cancer is well established (12, 20, 21, 22, 23, 24, 25, 26). Mechanistic studies attribute this association to sustained 3β-HSD1 activity, which drives intratumoral synthesis of potent androgens, particularly DHT, from adrenal precursors (11, 27). However, once metabolized downstream, DHT can be recycled through back-conversion of androstanediol 3α- and 3β-stereoisomers. Aldo-keto reductase family 1 member C2 (AKR1C2) is the main enzyme thought to metabolize DHT to 3α-diol, which is reconverted to DHT by several hydroxysteroid dehydrogenase enzymes, including 17β-HSD6/3α-HSD, RDH16, DHRS9, and RDH5 (6, 8, 28, 29). It is suggested that the DHT to 3β-diol conversion is mainly catalyzed by AKR1C1 (5, 30). Our results demonstrate that 3β-HSD1 can oxidize 3β-diol to form DHT, thereby providing a mechanism to further maintain levels of AR agonists and sustain AR pathway activation.

The degradation-resistant 3β-HSD1, encoded by the adrenal-permissive allele, catalyzes C3 oxidation of 3β-hydroxysteroids, a required reaction for both classical androgen biosynthesis from DHEA and the back-conversion of downstream 3β-5α-androgens such as 3β-diol. Through this activity, 3β-HSD1 can mediate DHT synthesis from 3β-diol, which may originate either via the backdoor pathway with androsterone as the immediate precursor or through DHT metabolism mediated by AKR1C1 or 3β-HSD1 itself (31, 32). While our heterologous expression models confirm the enzymatic sufficiency of 3β-HSD1 to execute this oxidation, this mechanism may sustain continuous AR signaling in vivo and underscores the relevance of the 3β-HSD1 polymorphism not only under castration but also provides a rationale for increased risk in eugonadal states. In this regard, Darst et al. recently analyzed data from 1,220 men with clinically localized prostate cancer on active surveillance, demonstrating that inheritance of the adrenal-permissive allele is associated with increased 5- and 10-year risk of disease progression (33). Taken together, these clinical observations alongside our mechanistic findings highlight 3β-HSD1 as a potential therapeutic target in prostate cancer, particularly in men harboring the adrenal-permissive allele (34).

Abiraterone is approved in combination with continuous ADT to intensify initiation of systemic therapy in metastatic hormone-sensitive prostate cancer (mHSPC) and later in the course of the disease with mCRPC (35, 36, 37, 38, 39, 40, 41, 42, 43). In patients, 3β-HSD1 converts abiraterone to D4A, which can be 5α-reduced into 3-keto-5α-Abi that acts as an AR agonist promoting disease progression. 3-keto-5α-Abi is subsequently metabolized to 3α-OH-5α-Abi and 3β-OH-5α-Abi (44).

Our PK analysis showed lower levels of 3β-OH-5α-Abi at 4- and 8-hour timepoints following abiraterone administration in men with the adrenal-permissive genotype. While this trend differs from our prior report, where 5α-Abi metabolites were comparatively higher in adrenal-permissive patients (45), the variation may largely stem from differences in study design and treatment context. The previous study analyzed samples collected at variable post-dose intervals and normalized metabolite levels using a pilot PK study in healthy, non-castrated volunteers by modeling the effect of HSD3B1 genotype, whereas the present analysis used strictly predefined sampling in CRPC patients. Moreover, the inclusion of concurrent apalutamide therapy in the current cohort, which is known to influence steroid metabolism, may also have contributed to the observed differences (46). The global decrease in 3β-OH-5α-Abi levels observed at cycle 2 in both groups may reflect changes in precursor availability or broader adaptive alterations in steroidogenic enzyme activity during ongoing therapy.

Notably, the lower 3β-OH-5α-Abi levels observed in adrenal-permissive patients are consistent with a 3β-HSD1–mediated back-conversion mechanism, whereby this downstream metabolite is depleted to regenerate the AR agonist 3-keto-5α-Abi. 3-keto-5α-Abi is subject to multiple metabolic pathways, including conversion to 3α-hydroxylated metabolites, resulting in complex transient dynamics that influence its steady-state levels. Consequently, depletion of 3β-OH-5α-Abi serves as a more reliable indicator of the back-conversion reaction. While circulating 3-keto-5α-Abi is expected to be outcompeted by the high micromolar steady-state concentrations of AR antagonists like apalutamide or enzalutamide, whether locally generated intratumoral amounts of 3-keto-5α-Abi are sufficient to meaningfully contribute to AR signaling or resistance phenotypes remains to be determined.

Taken together, these findings highlight the importance of considering both genetic and biochemical contexts in explaining disease heterogeneity and variability in therapeutic response. In part, the potential for back-conversion of 3β-diol to DHT and 3β-OH-5α-Abi to 3-keto-5α-Abi may explain the differences observed in HSD3B1 genotype-stratified response to intensified upfront AR blockade treatment in a low-volume mHSPC setting in the ENZAMET and STAMPEDE trials (23, 47). While the use of a nonsteroidal agent blocking AR signaling, the enzalutamide, reversed the poor outcomes associated with the 1245C adrenal-permissive genotype in the ENZAMET trial (23), men with this genotype still had worse outcomes after combination therapy with ADT plus enzalutamide and abiraterone in the analysis of the STAMPEDE trial (47). These findings suggest that men harboring the adrenal-permissive allele may derive a greater benefit from a nonsteroidal alternative to abiraterone.

It should be noted that intraprostatic 3β-diol levels were not quantified in this study. While this limits direct tissue-level confirmation, the systemic data remain consistent with 3β-HSD1–mediated back-conversion, warranting further investigation. Nonetheless, this study is primarily mechanistic, demonstrating that 3β-HSD1 can mediate the back-conversion of both 3β-diol and 3β-OH-5α-Abi. The frequency by which this pathway is engaged across prostate cancer models and patients, as well as its quantitative contribution to castration resistance and abiraterone resistance, remains to be defined.

In conclusion, we demonstrated that 3β-HSD1 catalyzes the back-conversion of the DHT downstream metabolite, 3β-diol, in prostate cancer cells. It also back-converts 3β-OH-5α-Abi to the partial AR agonist, 3-keto-5α-Abi. These findings provide further mechanistic explanations for worse outcomes associated with the inheritance of the HSD3B1 adrenal-permissive genotype and highlight 3β-HSD1 inhibition as a potential therapeutic strategy for prostate cancer.

Supplementary Material

1
2
3
4

Implications:

3β-HSD1–mediated back-conversion of inactivated androgens (3β-diol→DHT) and abiraterone metabolites (3β-OH-5α-Abi→3-keto-5α-Abi) regenerates AR-active ligands, supporting sustained AR signaling and motivating 3β-HSD1 targeting and HSD3B1 genotype–informed treatment strategies in CRPC.

Acknowledgement:

The authors thank David Rowland, Ph.D., for reviewing the manuscript.

Funding:

This work is supported by funding from NCI (R01CA172382, R01CA261995 and R01CA249279) and a grant from the Prostate Cancer Foundation.

Footnotes

Conflict of Interest: Nima Sharifi is a co-inventor on patents related to HSD3B1 that is held by his former employer, Cleveland Clinic. The remaining authors have no interests to declare.

References

  • 1.Dai C, Dehm SM, Sharifi N. Targeting the Androgen Signaling Axis in Prostate Cancer. Journal of Clinical Oncology. 2023;41(26):4267–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bitaraf M, Castro E, Sharifi N. Prostate cancer germline variants with therapeutic implications. Trends in Molecular Medicine. 2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Karantanos T, Corn PG, Thompson TC. Prostate cancer progression after androgen deprivation therapy: mechanisms of castrate resistance and novel therapeutic approaches. Oncogene. 2013;32(49):5501–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sharifi N. Mechanisms of Androgen Receptor Activation in Castration-Resistant Prostate Cancer. Endocrinology. 2013;154(11):4010–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang A, Zhang J, Plymate S, Mostaghel EA. Classical and Non-Classical Roles for Pre-Receptor Control of DHT Metabolism in Prostate Cancer Progression. Horm Cancer. 2016;7(2):104–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Fiandalo MV, Stocking JJ, Pop EA, Wilton JH, Mantione KM, Li Y, et al. Inhibition of dihydrotestosterone synthesis in prostate cancer by combined frontdoor and backdoor pathway blockade. Oncotarget. 2018;9(13):11227–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Jones MR, Mathur R, Cui J, Guo X, Azziz R, Goodarzi MO. Independent confirmation of association between metabolic phenotypes of polycystic ovary syndrome and variation in the type 6 17beta-hydroxysteroid dehydrogenase gene. J Clin Endocrinol Metab. 2009;94(12):5034–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bauman DR, Steckelbroeck S, Williams MV, Peehl DM, Penning TM. Identification of the Major Oxidative 3α-Hydroxysteroid Dehydrogenase in Human Prostate That Converts 5α-Androstane-3α,17β-diol to 5α-Dihydrotestosterone: A Potential Therapeutic Target for Androgen-Dependent Disease. Molecular Endocrinology. 2006;20(2):444–58. [DOI] [PubMed] [Google Scholar]
  • 9.Mohler JL, Titus MA, Bai S, Kennerley BJ, Lih FB, Tomer KB, et al. Activation of the androgen receptor by intratumoral bioconversion of androstanediol to dihydrotestosterone in prostate cancer. Cancer Res. 2011;71(4):1486–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ando T, Nishiyama T, Takizawa I, Ishizaki F, Miyashiro Y, Takeda K, et al. Dihydrotestosterone synthesis pathways from inactive androgen 5α-androstane-3β,17β-diol in prostate cancer cells: Inhibition of intratumoural 3β-hydroxysteroid dehydrogenase activities by abiraterone. Scientific Reports. 2016;6(1):32198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chang K-H, Li R, Kuri B, Lotan Y, Roehrborn Claus G, Liu J, et al. A Gain-of-Function Mutation in DHT Synthesis in Castration-Resistant Prostate Cancer. Cell. 2013;154(5):1074–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.McKay RR, Nelson TJ, Pagadala MS, Teerlink CC, Gao A, Bryant AK, et al. Adrenal-Permissive Germline HSD3B1 Allele and Prostate Cancer Outcomes. JAMA Network Open. 2024;7(3):e242976–e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Schiffer L, Sharifi N. Adrenal-Permissive HSD3B1 Genotype—An Invisible Stimulator of Prostate Cancer Mortality. JAMA Network Open. 2024;7(3):e243402–e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li Z, Alyamani M, Li J, Rogacki K, Abazeed M, Upadhyay SK, et al. Redirecting abiraterone metabolism to fine-tune prostate cancer anti-androgen therapy. Nature. 2016;533(7604):547–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11(8):783–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhu Z, Chung YM, Sergeeva O, Kepe V, Berk M, Li J, et al. Loss of dihydrotestosterone-inactivation activity promotes prostate cancer castration resistance detectable by functional imaging. J Biol Chem. 2018;293(46):17829–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fotouhi N, Diaz R, Alyamani M, Chung Y-M, West G, Mukherjee PK, et al. HSD3B1 links ileal steroid metabolism to bile acid regulation in patients with prostate cancer. The Journal of Clinical Investigation. 2026;136(12). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Alyamani M, Li Z, Upadhyay SK, Anderson DJ, Auchus RJ, Sharifi N. Development and validation of a novel LC-MS/MS method for simultaneous determination of abiraterone and its seven steroidal metabolites in human serum: Innovation in separation of diastereoisomers without use of a chiral column. J Steroid Biochem Mol Biol. 2017;172:231–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Alyamani M, McManus J, Patel M, Sharifi N. Chapter Four - Approaches to assessing 3β-hydroxysteroid dehydrogenase-1. In: Penning TM, editor. Methods in Enzymology. 689: Academic Press; 2023. p. 89–119. [DOI] [PubMed] [Google Scholar]
  • 20.Lu C, Terbuch A, Dolling D, Yu J, Wang H, Chen Y, et al. Treatment with abiraterone and enzalutamide does not overcome poor outcome from metastatic castration-resistant prostate cancer in men with the germline homozygous HSD3B1 c.1245C genotype. Annals of Oncology. 2020;31(9):1178–85. [DOI] [PubMed] [Google Scholar]
  • 21.Khalaf DJ, Aragón IM, Annala M, Lozano R, Taavitsainen S, Lorente D, et al. HSD3B1 (1245A>C) germline variant and clinical outcomes in metastatic castration-resistant prostate cancer patients treated with abiraterone and enzalutamide: results from two prospective studies. Annals of Oncology. 2020;31(9):1186–97. [DOI] [PubMed] [Google Scholar]
  • 22.Ganguly S, Lone Z, Muskara A, Imamura J, Hardaway A, Patel M, et al. Intratumoral androgen biosynthesis associated with 3β-hydroxysteroid dehydrogenase 1 promotes resistance to radiotherapy in prostate cancer. J Clin Invest. 2023;133(22). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Sharifi N, Diaz R, Lin H-M, Roberts E, Horvath LG, Martin A, et al. Survival of men with metastatic hormone-sensitive prostate cancer and adrenal-permissive HSD3B1 inheritance. The Journal of Clinical Investigation. 2024;134(18). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hearn JWD, Sweeney CJ, Almassi N, Reichard CA, Reddy CA, Li H, et al. HSD3B1 Genotype and Clinical Outcomes in Metastatic Castration-Sensitive Prostate Cancer. JAMA Oncology. 2020;6(4):e196496–e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hearn JWD, Xie W, Nakabayashi M, Almassi N, Reichard CA, Pomerantz M, et al. Association of HSD3B1 Genotype With Response to Androgen-Deprivation Therapy for Biochemical Recurrence After Radiotherapy for Localized Prostate Cancer. JAMA Oncology. 2018;4(4):558–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hearn JWD, AbuAli G, Reichard CA, Reddy CA, Magi-Galluzzi C, Chang K-H, et al. HSD3B1 and resistance to androgen-deprivation therapy in prostate cancer: a retrospective, multicohort study. The Lancet Oncology. 2016;17(10):1435–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Li X, Berk M, Goins C, Alyamani M, Chung Y-M, Wang C, et al. BMX controls 3βHSD1 and sex steroid biosynthesis in cancer. The Journal of Clinical Investigation. 2023;133(2). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ishizaki F, Nishiyama T, Kawasaki T, Miyashiro Y, Hara N, Takizawa I, et al. Androgen deprivation promotes intratumoral synthesis of dihydrotestosterone from androgen metabolites in prostate cancer. Scientific Reports. 2013;3(1):1528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Penning TM, Byrns MC. Steroid Hormone Transforming Aldo-Keto Reductases and Cancer. Annals of the New York Academy of Sciences. 2009;1155(1):33–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zeng CM, Chang LL, Ying MD, Cao J, He QJ, Zhu H, et al. Aldo-Keto Reductase AKR1C1-AKR1C4: Functions, Regulation, and Intervention for Anti-cancer Therapy. Front Pharmacol. 2017;8:119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Miller WL, Auchus RJ. The “backdoor pathway” of androgen synthesis in human male sexual development. PLoS Biol. 2019;17(4):e3000198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Auchus RJ. The backdoor pathway to dihydrotestosterone. Trends Endocrinol Metab. 2004;15(9):432–8. [DOI] [PubMed] [Google Scholar]
  • 33.Louisa B Goss BG, Menghan Liu et al. , Darst Burcu F.. Common inherited HSD3B1 missense variant and prostate cancer progression in low- and favorable intermediate-risk patients. PCF 32nd scientific retreat. 2025. [Google Scholar]
  • 34.He D, Zhang L, Yu L, Zhang Y, Chen J, Wang L, et al. Fine structural design of 3βHSD1 inhibitors for prostate cancer therapy. Proceedings of the National Academy of Sciences. 2025;122(26):e2422267122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fizazi K, Tran N, Fein L, Matsubara N, Rodriguez-Antolin A, Alekseev BY, et al. Abiraterone plus Prednisone in Metastatic, Castration-Sensitive Prostate Cancer. New England Journal of Medicine. 2017;377(4):352–60. [DOI] [PubMed] [Google Scholar]
  • 36.James ND, Bono JSd, Spears MR, Clarke NW, Mason MD, Dearnaley DP, et al. Abiraterone for Prostate Cancer Not Previously Treated with Hormone Therapy. New England Journal of Medicine. 2017;377(4):338–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lowrance W, Dreicer R, Jarrard DF, Scarpato KR, Kim SK, Kirkby E, et al. Updates to Advanced Prostate Cancer: AUA/SUO Guideline (2023). J Urol. 2023;209(6):1082–90. [DOI] [PubMed] [Google Scholar]
  • 38.Fizazi K, Scher HI, Molina A, Logothetis CJ, Chi KN, Jones RJ, et al. Abiraterone acetate for treatment of metastatic castration-resistant prostate cancer: final overall survival analysis of the COU-AA-301 randomised, double-blind, placebo-controlled phase 3 study. The Lancet Oncology. 2012;13(10):983–92. [DOI] [PubMed] [Google Scholar]
  • 39.Fizazi K, Foulon S, Carles J, Roubaud G, McDermott R, Fléchon A, et al. Abiraterone plus prednisone added to androgen deprivation therapy and docetaxel in de novo metastatic castration-sensitive prostate cancer (PEACE-1): a multicentre, open-label, randomised, phase 3 study with a 2 × 2 factorial design. The Lancet. 2022;399(10336):1695–707. [DOI] [PubMed] [Google Scholar]
  • 40.Attard G, Murphy L, Clarke NW, Sachdeva A, Jones C, Hoyle A, et al. Abiraterone acetate plus prednisolone with or without enzalutamide for patients with metastatic prostate cancer starting androgen deprivation therapy: final results from two randomised phase 3 trials of the STAMPEDE platform protocol. The Lancet Oncology. 2023;24(5):443–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Clarke NW, Armstrong AJ, Thiery-Vuillemin A, Oya M, Shore N, Loredo E, et al. Abiraterone and Olaparib for Metastatic Castration-Resistant Prostate Cancer. NEJM Evidence. 2022;1(9):EVIDoa2200043. [DOI] [PubMed] [Google Scholar]
  • 42.Ryan CJ, Smith MR, Bono JSd, Molina A, Logothetis CJ, Souza Pd, et al. Abiraterone in Metastatic Prostate Cancer without Previous Chemotherapy. New England Journal of Medicine. 2013;368(2):138–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Bono JSd, Logothetis CJ, Molina A, Fizazi K, North S, Chu L, et al. Abiraterone and Increased Survival in Metastatic Prostate Cancer. New England Journal of Medicine. 2011;364(21):1995–2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Li Z, Alyamani M, Li J, Rogacki K, Abazeed M, Upadhyay SK, et al. Redirecting abiraterone metabolism to fine-tune prostate cancer anti-androgen therapy. Nature. 2016;533(7604):547–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Alyamani M, Emamekhoo H, Park S, Taylor J, Almassi N, Upadhyay S, et al. HSD3B1(1245A>C) variant regulates dueling abiraterone metabolite effects in prostate cancer. The Journal of Clinical Investigation. 2018;128(8):3333–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Alyamani M, Li J, Patel M, Taylor S, Nakamura F, Berk M, et al. Deep androgen receptor suppression in prostate cancer exploits sexually dimorphic renal expression for systemic glucocorticoid exposure. Annals of Oncology. 2020;31(3):369–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Sharifi N, Kayani M, Murphy L, Diaz R, Grist E, Kote-Jarai Z, et al. HSD3B1 and overall survival (OS) in high-risk non-metastatic (M0) and metastatic (M1) prostate cancer starting androgen deprivation therapy (ADT) in the enzalutamide (ENZ) and abiraterone acetate plus prednisolone (AAP) STAMPEDE phase 3 trial. Journal of Clinical Oncology. 2025;43(5_suppl):234-.39591542 [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2
3
4

Data Availability Statement

RNA sequencing data generated in this study are publicly available in the Sequence Read Archive (SRA) under BioProject accession PRJNA1493059. Additional data is available from the corresponding author upon reasonable request.

RESOURCES