Skip to main content
NCBI home page
Scientific Reports logoLink to Scientific Reports
. 2026 May 30;16:24788. doi: 10.1038/s41598-026-52613-5

Development of loop-mediated isothermal amplification (LAMP)-based assay for rapid detection of fosfomycin resistance gene fosA

Nazareno Scaccia 1,2,3,✉, Inneke Marie van der Heijden Natário 1,2, Letícia Silva Figueiredo 1, Silvia Figueiredo Costa 1,2
PMCID: PMC13458779  PMID: 42218183

Abstract

Fosfomycin is an old treatment agent that has been reintroduced as a first-line antibiotic for the treatment of acute uncomplicated urinary tract infections caused by multidrug-resistant bacteria. However, resistance to fosfomycin is rising, and limited options for its detection are available. In this study, we developed a molecular technique based on loop-mediated isothermal amplification (LAMP) as a rapid and easy-to-perform method for the detection of the fosA resistance gene. LAMP primers were designed using the Primer Explorer V5 software. A total of 63 bacterial strains (34 Klebsiella pneumoniae and 29 Escherichia coli) previously characterized by whole genome sequencing, with different MLST and resistant to fosfomycin were used to evaluate the performance of the new LAMP assay. The fosA LAMP-based assay was standardized for optimum primer concentration and time of reaction. Its sensitivity and specificity were also characterized. LAMP products were detected by visual detection (positive reactions turned yellow while negative controls remained pink) and by electrophoresis. Positive LAMP reaction occurred with incubation at 65 °C for 40 min. Nevertheless, amplification products were already observed at 20 min. The overall sensitivity and specificity of the LAMP assay were 90.5% and 90.9%, respectively. For Klebsiella pneumoniae, sensitivity reached 100%, while specificity could not be determined due to the absence of negative samples. In Escherichia coli, sensitivity was 43% and specificity was 90.9%. The limit of detection of LAMP reaction was 8 pg/µL. To the best of our knowledge, this is the first study to develop a LAMP methodology to detect the fosA gene. This LAMP-based assay is a promising rapid molecular method for fosfomycin detection, which could be implemented for on-site analysis in resource-limited settings, with the potential to improve antibiotic therapy interventions for urinary tract infections.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-52613-5.

Keywords: urinary tract infections, diagnostic method, fosfomycin-resistance gene, loop-mediated isothermal amplification (LAMP)

Subject terms: Biological techniques, Microbiology, Molecular biology

Introduction

Antibiotic resistance is a global challenge and, although the prevalence of antibiotic-resistant bacteria (ARB) continues to rise, the rate of new antibiotic development has been very slow1,2. In this context, the reintroduction of “old” antibiotics, previously abandoned, represents an option to combat multidrug-resistant bacteria. An example is the antibiotic fosfomycin used in the treatment of urinary tract infection (UTIs)3. With the increasing number of ARB, this drug has been reconsidered and prescribed as an alternative treatment for UTIs caused by these pathogens3. Fosfomycin has bactericidal action and a broad-spectrum activity against both Gram-positive and Gram-negative bacteria4,5. Particularly, fosfomycin remains active against various Enterobacteriaceae species that cause UTIs, including those expressing extended-spectrum beta-lactamases (ESBL) and Metallo-Beta-lactamases (MBL) enzymes which confer resistance to beta-lactam antibiotics (e.g., penicillin, cephalosporins, and carbapenems). However, resistance to fosfomycin, especially among ESBL-producing Enterobacterales, is increasing and could represent a challenge, since this antibiotic is considered an alternative treatment for antibiotic-resistant infections such as those caused by ESBL-producing E. coli3,4,6. Among the different mechanisms involved in resistance to fosfomycin, great attention has been given to the fosfomycin-modifying enzyme encoded by fosA, which is located on both chromosomes and plasmids in members of the Enterobacterales and can inactivate the antibiotic3. A rapid and accurate identification of fosfomycin resistance type in Enterobacterales is a challenge due to the lack of commercial phenotypic susceptibility tests and of rapid systems for minimal inhibitory concentration (MIC) detection. Although the agar dilution method is the gold standard for determining fosfomycin MICs, particularly in cases involving novel mutations not detected by molecular methods, it remains a labour-intensive and expensive procedure. For that, molecular methods such as loop-mediated isothermal amplification (LAMP) can provide an accurate identification of resistance mechanisms by directly detecting fosA resistance genes7. LAMP is a molecular biology technique as an alternative method to conventional PCR that amplifies nucleic acids at a single temperature using DNA polymerase with strand displacement activity and primers designed to form loops in the DNA strand7,8. It is considered a low-cost, rapid, field-deployable technique that can be used to detect a wide range of DNA and RNA target7–10. The LAMP method is relatively simple, easy to perform and does not require expensive or sophisticated equipment, making this methodology easy to implement in resource-limited settings. Therefore, this study aimed to develop and evaluate the performance of the LAMP-based assay for the rapid detection of the fosA resistance gene in bacterial isolates obtained from urine samples from UTI patients.

Materials and methods

Origins of the bacterial isolates

A total of sixty-four bacterial strains, one reference and sixty-three clinical isolates, were used to develop the new lamp-based assay for the detection of the fosfomycin resistance gene (Table 2). The reference strain was Klebsiella pneumoniae LIM1738 (GenBank No. QEFV00000000.1), that belong to our sequenced collection of bacterial strains maintained at the medical research laboratory (LIM-49) at the Institute of Tropical Medicine, which is part of the Clinical Hospital of the Faculty of Medicine at the University of Sao Paulo (HC-FMUSP). Sixty-three genetically distinct clinical bacterial isolates, 34 Klebsiella pneumoniae and 29 Escherichia coli, were used to evaluate the performance of the LAMP assay. These clinical isolates, part of the culture collection of the LIM-49, were previously obtained from urine cultures of UTI patients attended in thirty-four primary health care units in the city of Santo André (Greater São Paulo) with known genotypes and phenotypes (Unpublished). They were sequenced by Ion Torrent 260 Personal Genome Machine™ technology (Life Technologies) and their phenotypic resistance profile and minimum inhibitory concentration (MIC) to fosfomycin were also characterized (Unpublished work).

Table 2.

UTI clinical isolates used to evaluate the performance of fosA-LAMP assay.

Bacterial species MLST Fosfomycin MIC (µg/mL) fosA gene detected by WGS fosA LAMP-based assay
K. pneumoniae ST101 32 fosA6 +
K. pneumoniae ST101-1LV 64 fosA6 +
K. pneumoniae ST11 128 fosA6 +
K. pneumoniae ST11 64 fosA6 +
K. pneumoniae ST11 128 fosA6 +
K. pneumoniae ST1198 256 fosA6 +
K. pneumoniae ST131 128 fosA6 +
K. pneumoniae ST15 128 fosA6 +
K. pneumoniae ST17 128 fosA5 +
K. pneumoniae ST20 32 fosA5 +
K. pneumoniae ST258 128 fosA6 +
K. pneumoniae ST258 128 fosA6 +
K. pneumoniae ST258 > 256 fosA6 +
K. pneumoniae ST258 > 256 fosA6 +
K. pneumoniae ST258 256 fosA6 +
K. pneumoniae ST258 > 256 fosA6 +
K. pneumoniae ST258 > 256 fosA6 +
K. pneumoniae ST258 128 fosA6 +
K. pneumoniae ST258 128 fosA6 +
K. pneumoniae ST258 256 fosA6 +
K. pneumoniae ST258 128 fosA6 +
K. pneumoniae ST258 32 fosA6 +
K. pneumoniae ST258-1LV 256 fosA6 +
K. pneumoniae ST2601-1LV 64 fosA6 +
K. pneumoniae ST29 64 fosA6 +
K. pneumoniae ST307 256 fosA6 +
K. pneumoniae ST307 > 256 fosA6 +
K. pneumoniae ST307-1LV 64 fosA6 +
K. pneumoniae ST37-1LV 128 fosA6 +
K. pneumoniae ST392 16 fosA5 +
K. pneumoniae ST528-1LV > 256 fosA6 +
K. pneumoniae ST528-1LV 128 fosA6 +
K. pneumoniae ST6366-1LV 64 fosA6 +
K. pneumoniae ST784 32 fosA6 +
K. aerogenes ST16 128 fosA5 +
E. coli Unknown 64 NF -
E. coli ST10 2 NF -
E. coli ST10 256 fosA3 -
E. coli ST10 1 NF -
E. coli ST1011 > 256 fosA3 -
E. coli ST10297 1 NF -
E. coli ST1147 1 NF -
E. coli ST1163 256 fosA3 -
E. coli ST131 1 NF +
E. coli ST131 128 NF -
E. coli ST131 128 NF -
E. coli ST131 0,5 NF -
E. coli ST1431 256 NF -
E. coli ST1725 > 256 fosA3 +
E. coli ST192 > 256 fosA3 +
E. coli ST2179 256 fosA3 -
E. coli ST218 32 NF -
E. coli ST3258 > 256 fosA3 +
E. coli ST34 128 NF -
E. coli ST372 64 NF -
E. coli ST410 4 NF +
E. coli ST448 > 256 NF -
E. coli ST641 16 NF -
E. coli ST69 1 NF -
E. coli ST69 0,5 NF -
E. coli ST73 16 NF -
E. coli ST744 32 NF -
E. coli ST744 16 NF -
E. coli ST95 256 NF -
Open in a new tab

MLST, multilocus sequence typing; WGS, whole genome sequencing; NF, fosfomycin resistance genes not found; +, positive amplification; -, negative amplification.

DNA extraction

The genomic DNA of the bacterial strains were extracted using the QIAamp DNA Kit (QIAGEN®). The protocol for genetic material extraction was carried out according to the manufacturer’s instructions. The concentration of purified genomic DNA was determined using a NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific, USA).

Primers design

The primers for the detection of the fosfomycin resistance gene were designed in the Primer Explorer V5 software (https://primerexplorer.eiken.co.jp/e/) using K. pneumoniae LIM1738 DNA sequence reference of the fosA6 gene. A total of three primer sets were designed: two primer sets comprised two outer primers (F3 and B3), two inner primers (FIP and BIP), and one loop primer (FLF) whilst one primer set was composed of two outer (F3 and B3) and two inner (FIP and BIP) primers (Table 1). All primer sets were empirically tested.

Table 1.

LAMP primer sets for the detection of the fosA gene.

Primer set Primer name Primers sequence (5′→3′) Base pairs
1 fosA1 F3 GGGACAGCGGGGCTTA 16
fosA1 B3 AATAGTGCGAGGCACCTTC 19
fosA1 FIP TTCCGGCGGAGTAACGCGCTTTTCTCCTGCGGCGATTTGTG 38
fosA1 BIP AGCCGATTTTGCTAGCTTCGCCTTTGCTACGGTTCAGCTTCCAGA 42
fosA1 FLP CGTATCCAGCGACAGGCA 18
2 fosA2 F3 CGGGGCTTATCTCTCCTGC 19
fosA2 B3 GGGATCGAGGAAATAGTGCG 20
fosA2 FIP GCTCTCTTCCGGCGGAGTAACTTTCGATTTGTGGCTGTGCCTG 40
fosA2 BIP AGCCGATTTTGCTAGCTTCGCCTTTCGGTTCAGCTTCCAGATCG 41
fosA2 FLP CGCTGCGTATCCAGCGA 17
3 fosA3 F3 TGCCTGTCGCTGGATACG 18
fosA3 B3 GCAGCTCCAGCTTATGGC 18
fosA3 FIP AGCTAGCAAAATCGGCTTCGCTTTTACTCCGCCGGAAGAGAG 40
fosA3 BIP CGGCGTGGCGATCTGGAATTTTGGGATCGAGGAAATAGTGCG 38
Open in a new tab

LAMP reaction assay

The LAMP reaction assay was performed using the WarmStart® Colorimetric LAMP 2X Master Mix (New England Biolabs®) according to the manufacturer’s instructions. Briefly, the LAMP reaction mixture (25 µL) contained 12.5 µL of WarmStart® Colorimetric LAMP mix, 3 µl of primer mix encompassing 4 µM inner primers FIP and BIP, 1 µM outer primers F3 and B3 and 2 µM forward loop primer FLP, 1 µl of DNA sample, and 8.5 µl of distilled water. To optimize the LAMP protocol for fosA, LAMP-based assays were conducted at 65 ℃, as suggested by the manufacturer, at various incubation times (20, 30, 40, 50, and 60 min) and primer concentrations. Two primer concentration conditions were evaluated: 1:4:2 and 0.2:1.6:0.4 (F3/B3:FIP/BIP: FLP/BLP), the latter according to the manufacturer’s recommendations. Negative control (distilled water) was maintained in each reaction, and the amplification results were evaluated according to the colour change from pink to yellow of the reaction mixtures and with the presence of electrophoresis bands of the amplification products in 1.5% agarose gel.

Specificity and sensitivity of the fosA LAMP-assay

To assess the specificity of the LAMP assay, DNA extracts of twenty-nine strains of clinically different E. coli obtained from urine cultures as explained above (Sect.  2.1) were used. The sensitivity of the LAMP method was evaluated using genomic DNA extracted from Klebsiella pneumoniae LIM1738. The DNA extracted from the reference strain with an initial concentration of 81.2 ng/µL was serially diluted up to 8 fg/µL. The LAMP reactions were executed following the established optimal conditions and were independently replicated.

Results

LAMP optimization

In the first stage of fosA LAMP protocol standardization, three different primer sets (Table 1) were tested. The primer set fosA.1 produced a more intense band than the other two primer sets (Fig. 1). The primer set fosA.3 also showed positive performance during the analyses, whereas fosA.2 did not amplify the gene target. The band produced by the fosA.1 primer set was more intense than that obtained with fosA.3 primer set therefore, the fosA.1 primer set was selected for subsequent tests and optimization of the LAMP protocol.

Fig. 1.

Fig. 1

Open in a new tab

FosA LAMP primer sets performance. Line 3, 6, and 9 are positive controls (K. pneumoniae strain LIM1738; lines 4, 5, 7, 8, 10, and 11 are negative controls; line 1, molecular weight marker; line 2 is empty.

The reaction temperature was 65 °C, as suggested by the manufacturer and the optimal incubation time for the fosA-LAMP assay was identified by testing at 20, 30, 40, 50 and 60 min. Initial results, as shown in Fig. 2, indicated successful amplification at all incubation time points tested. Although the amplification already occurs at 20 min, the optimal incubation time was established at 40 min because of the intensity of the band, which was more intense in comparison to the other one. Also, using fosA1 primer set, we tested two ratios of primer sets, including 1:4:2 (1 µM F3/B3, 4 µM FIP/BIP and 2 µM FLP) and 0.2:1.6:0.4 (0,2 µM F3/B3, 1.6 µM FIP/BIP and 0.4 µM FLP). The amplification occurred with primer ratios of 1:4:1 (1 µM F3/B3, 4 µM FIP/BIP and 1 µM FLP), where both the colour changes from pink to yellow and the gel band confirmed the result.

Fig. 2.

Fig. 2

Open in a new tab

The fosA-LAMP reaction products after incubation at 65 °C using fosA1 primer set with the ratio 1:4:1 (1 µM F3/B3, 4 µM FIP/BIP and 1 µM FLP) for 20, 30, 40, 50 and 60 min. Lines 1, 3, 5, 7 and 9 represent positive control (+) (Klebsiella pneumoniae strain LIM1738) and lines 2, 4, 6, 8 and 10 are no-template control (-) (water). PM, molecular weight marker.

fosA-LAMP sensitivity, specificity and limit of detection

We tested a total of 64 clinically distinct UTI isolates of Klebsiella spp. and E. coli to test the LAMP assay for the fosA gene that had previously been characterized and sequenced for their resistance to fosfomycin (Unpublished work). The overall sensitivity and specificity of the LAMP assay for fosA3, fosA5, and fosA6 were 90.5% and 90.9%, respectively (Fig. 3; Table 2). Species-specific sensitivity was 100% for K. pneumoniae isolates carrying fosA5 and fosA6 genes and 43% for E. coli isolates carrying the fosA3 gene. Species-specific specificity was 90.9% for E. coli, while specificity could not be determined for K. pneumoniae due to the absence of negative samples (Fig. 3). Also, although the primers used in this assay were species-specific and originally designed to target the fosA6 gene from K. pneumoniae, the fosA-LAMP assay was still able to detect approximately 43% (3/7) of the fosA3-positive E. coli isolates.All primer sets were empirically tested

Fig. 3.

Fig. 3

Open in a new tab

Comparison of the overall and species-specific specificity (SPE) and sensitivity (SEN) of the fosA LAMP assay. Performance of the LAMP assay for fosA3, fosA5, and fosA6 detection in Klebsiella and E. coli isolates (A); fosA5 and fosA6 detection in Klebsiella spp, (B); and for fosA3 detection in E. coli. The crosstables show for each group true positives (TP) (pos/pos), true negatives (TN) (neg/neg), false positives (FP) (neg/pos) and false negatives (FN) (pos/neg) of the LAMP assays compared to WGS. SEN and SPE with 95% CI are provided.

The limit of detection (LoD) of the LAMP assay was determined using serially diluted genomic DNA of Klebsiella pneumoniae strain LIM1738. The initial concentration of DNA (81.2 ng/µL) was diluted until 10− 7 and, after an incubation at 65 ℃ for 40 min, the colour change was observed until 10− 4 whilst there was no colour change from 10− 5 to 10− 7 LAMP reaction tubes (Fig. 4). Therefore, the LoD for the fosA gene-based LAMP assay in Klebsiella pneumoniae was 8 pg/µL.

Fig. 4.

Fig. 4

Open in a new tab

Limit of detection of the gene fosA by LAMP assay. N, no-template control, D – D7; different genomic DNA concentrations (D, 81.2 ng/µL; D1, 7.86 ng/µL; D2, 0.84 ng/µL; D3, 0.08 ng/µL; D4, 8 pg/µL; D5, 0.8 pg/µL; D6, 0.08 pg/µL; D7, 8 fg/µL) of the reference strain K. pneumoniae strain LIM1738. Positive LAMP reactions show a color change from pink to yellowish, indicating DNA amplification. The limit of detection is shown in duplicate.

Discussion

In this work, we developed a rapid and easy to perform LAMP-based method specifically aimed at detecting fosA5 and fosA6 genes without the need for expensive or sophisticated equipment. This LAMP assay was able to amplify the fosA gene in as little as 20 min at 65 °C, and the amplification products could be easily detected with the naked eye, allowing rapid visual interpretation of results. The fosA-LAMP based assay could be easily implemented in resource-limited settings, such as Brazilian primary health-care (PHC) units, for the detection of fosfomycin resistance in UTI pathogens. In clinical practice, LAMP may complement antibiotic susceptibility testing to assess the presence of resistance genes. The use of such a diagnostic could have a significant impact on the local health system, particularly by reducing diagnostic costs and the time to results. LAMP assays have already been described as a molecular low-cost alternative to conventional and real-time PCR methodologies for the detection of methicillin (mecA), carbapenem (blaNDM, blaKPC, blaOXA−48, blaOXA−23, blaVIM and blaIMP), extended-spectrum β-lactamase (blaCTX), tetracycline (tetM), sulfonamides (sul1, sul2, sul3) and colistin (mcr-9) resistance11–16. To our knowledge, this is the first study to develop a LAMP methodology to identify the fosA gene. Molecular and high-throughput approaches have been increasingly used to identify fosfomycin resistance genes, including fosA, fosB, fosC, fosX as well as fosA13 and fosSC17–19. However, these methods often require specialized equipment and trained personnel, which makes them challenging to use for rapid diagnostics3,20. In this context, a LAMP-based assay represents a rapid, simple, and cost-effective alternative for the detection of fosA-mediated fosfomycin resistance in PHC units.

Of the three primer sets that we tested, fosA.1 was more sensitive compared to fosA.3. Also, for the optimization of primer concentration, two different primer concentration were tested. The higher primer concentration tested, ratio 1 F3/B3: 4 FIP/BIP: 2 FLP, provides the required levels of primers to drive the efficient kinetics of the LAMP reaction, resulting in better performance than the lower concentration (0.2 F3/B3: 1.6 FIP/BIP: 0.4 FLP) as suggested by the manufacturer, which may be suboptimal for this specific assay. After completing the optimization of the primer concentration, the optimum time of incubation was also determined. Five incubation times reaction (20, 30, 40, 50, and 60 min) were tested, with 40 min being the most efficient reaction time for the fosA-LAMP assay.

The sensitivity and specificity of the LAMP assay were 90.5% and 90.9%, respectively, for the genes fosA3, fosA5, and fosA6 in Klebsiella spp. and E. coli isolates. The fosA-LAMP assay demonstrated 100% sensitivity in detecting fosA5 and fosA6 in all 34 Klebsiella spp. isolates tested. However, its specificity in Klebsiella spp. could not be determinate because of the lack of negative samples. This limitation represents an important constraint of the present study, as the absence of negative Klebsiella spp. prevented a complete evaluation of the assay specificity for this species. Therefore, future studies including both positive and negative Klebsiella spp. isolates are necessary to better assess the diagnostic performance of the assay.

The sensitivity of the fosA LAMP method drops to 43% when E. coli strains (n = 29) where included in the analysis. This reduced sensitivity is likely explained by the fact that the primers were originally designed based on the fosA6 sequence from K. pneumoniae, which may result in lower amplification efficiency for fosA3-carrying E. coli isolates. The overall specificity, as well as the species-specific specificity in Escherichia coli, was 90.9%. The reduced specificity was due to two false-positive results observed in E. coli isolates, which may be explained by cross-reactivity with non-target sequences homologous to the fosA gene, potentially leading to non-specific amplification. Indeed, although the fosA gene is frequently found on the chromosome of K. pneumoniae, fosA-like sequences have also been reported in E. coli6, which may explain the occurrence of false-positive results in this study. Additionally, those false positive results may also occur due to primer-dimer formation, which is more likely to happen when multiple primers are used7,8.

Additionally, it is important to note that fosfomycin resistance can also occur through mechanisms other than fosA, including the fosB and fosX genes, as well as chromosomal mutations in fosfomycin-resistance-related genes such as glpT, uhpT, and murA21,22. Therefore, a major limitation of this assay is that it does not detect all possible fosfomycin resistance mechanisms, but specifically detects fosA-mediated resistance, particularly fosA5 and fosA6 alleles. For this reason, this assay should be considered a rapid molecular screening tool for fosA gene and should complement, rather than replace, phenotypic susceptibility testing, since molecular assays do not detect resistance caused by chromosomal mutations or alternative resistance mechanisms.

Finally, our study confirmed that the fosA-LAMP method has a low detection limit, being able to detect the fosA gene at concentrations as low as 8 pg/µL. Previous studies have already demonstrated that LAMP assays can achieve similarly low detection concentrations, reinforcing the high analytical sensitivity of this technique7,8,15.

Conclusions

In conclusion, a detection method based on LAMP was developed to rapidly and effectively identify the fosA gene. This method was considered a sensitive, low-cost approach that is as effective as classical molecular methods for detecting resistance genes and can be implemented in the field, particularly in primary care settings for the detection of fosfomycin-resistant isolates. Primary health-care units with no prior experience in molecular diagnostics may benefit from implementing such low-complexity and low-cost method such as LAMP-based assays.

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (1.2MB, docx)

Acknowledgements

The authors are grateful to CAMO-net Brazil for providing NS fellowship. The authors are grateful to FAPESP for providing LSF fellowship. The authors would also like to thank Joyce Vanessa da Silva Fonseca for providing the WGS analysis, and Danilo Gennari da Costa for assisting with the reconfirmation of some of the tested samples.

Author contributions

Conceptualization: Scaccia N., Silva Figueiredo, L.; data curation: Scaccia N., Silva Figueiredo, L.; formal analysis: Scaccia N., Silva Figueiredo, L., Van der Heijden Natário, I. M., Figueiredo Costa, S.; investigation: Scaccia N., Silva Figueiredo, L.; methodology: Scaccia, N.; project administration: Figueiredo Costa, S., Van der Heijden Natário, I. M.; resources: Figueiredo Costa, S., Van der Heijden Natário, I. M.; supervision: Scaccia, N., Figueiredo Costa, S.; validation: Scaccia N., Silva Figueiredo, L., Van der Heijden Natário, I. M., Figueiredo Costa, S.; writing original draft: Scaccia, N.; writing, review and editing: Scaccia N., Silva Figueiredo, L., Van der Heijden Natário, I. M., Figueiredo Costa, S. All authors read and approved the final manuscript.

Funding

This work was financed, in part, by the São Paulo Research Foundation (FAPESP), Brazil (process number: 2022/05087-6).

Data availability

The data that support the findings of this study are available from the corresponding author, NS, upon reasonable request. The raw genomic sequencing data of the bacterial isolates used have been submitted to GenBank under Bio Project accession number PRJNA1152710.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval

this article does not contain human or animal participants.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Muteeb, G., Rehman, M. T., Shahwan, M. & Aatif, M. Origin of Antibiotics and Antibiotic Resistance, and Their Impacts on Drug Development. Narrative Rev. Pharmaceuticals. 16 (11), 1615. 10.3390/ph16111615 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.World Health Organization (WHO). Antimicrobial resistance. (2023). Available from: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance. [date visited: 08/12/25].
  • 3.Mattioni Marchetti, V., Hrabak, J. & Bitar, I. Fosfomycin resistance mechanisms in Enterobacterales: an increasing threat. Front. Cell. Infect. Microbiol.13, 1178547. 10.3389/fcimb.2023.1178547 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bassetti, M., Graziano, E., Berruti, M. & Giacobbe, D. R. The role of fosfomycin for multidrug-resistant gram-negative infections. Curr. Opin. Infect. Dis.32 (6), 617–625. 10.1097/QCO.0000000000000597 (2019). [DOI] [PubMed] [Google Scholar]
  • 5.Sorlozano-Puerto, A., Lopez-Machado, I., Albertuz-Crespo, M., Martinez-Gonzalez, L. J. & Gutierrez-Fernandez, J. Characterization of fosfomycin and nitrofurantoin resistance mechanisms in Escherichia coli isolated in clinical urine samples. Antibiotics, 1;9(9):1–19. (2020). 10.3390/antibiotics9090534 [DOI] [PMC free article] [PubMed]
  • 6.Ito, R. et al. Widespread Fosfomycin Resistance in Gram-Negative Bacteria Attributable to the Chromosomal fosA Gene. mBio8 (4), e00749–e00717. 10.1128/mbio.00749-17 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Notomi, T. et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res.28 (12), E63. 10.1093/nar/28.12.e63 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Moehling, T. J., Choi, G., Dugan, L. C., Salit, M. & Meagher, R. J. LAMP Diagnostics at the Point-of-Care: Emerging Trends and Perspectives for the Developer Community. Expert Rev. Mol. Diagn.21 (1), 43–61. 10.1080/14737159.2021.1873769 (2021). [DOI] [PubMed] [Google Scholar]
  • 9.Wong, Y. P., Othman, S., Lau, Y. L., Radu, S. & Chee, H. Y. Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms. J. Appl. Microbiol.124, 626–643. 10.1111/jam.13647 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Tomita, N., Mori, Y., Kanda, H. & Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc.3 (5), 877–882. 10.1038/nprot.2008.57 (2008). [DOI] [PubMed] [Google Scholar]
  • 11.Khosravi, A. D. et al. The application of the loop-mediated isothermal amplification method for rapid detection of methicillin-resistant Staphylococcus aureus. New. Microbes New. Infect.45, 100960. 10.1016/j.nmni.2022.100960 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lahiri, S. et al. Evaluation of LAMP-based assays for carbapenemase genes. J. Med. Microbiol.68 (10), 1431–1437. 10.1099/jmm.0.001050 (2019). [DOI] [PubMed] [Google Scholar]
  • 13.Thirapanmethee, K., Pothisamutyothin, K., Nathisuwan, S., Chomnawang, M. T. & Wiwat, C. Loop-mediated isothermal amplification assay targeting the blaCTX-M9 gene for detection of extended spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae. Microbiol. Immunol.58 (12), 655–665. 10.1111/1348-0421.12205 (2014). [DOI] [PubMed] [Google Scholar]
  • 14.Mussa, E. A. M. et al. Development of an RT-LAMP Assay for Detecting tet(M) in Enterococcus Species: Enhancing AMR Surveillance Within the One Health Sectors. Diagnostics15 (10), 1213. 10.3390/diagnostics15101213 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gong, J. et al. Establishment of a Multiplex Loop-Mediated Isothermal Amplification Method for Rapid Detection of Sulfonamide Resistance Genes (sul1, sul2, sul3) in Clinical Enterobacteriaceae Isolates from Poultry. Foodborne Pathog Dis.15 (7), 413–419. 10.1089/fpd.2017.2410 (2018). [DOI] [PubMed] [Google Scholar]
  • 16.Rodriguez-Manzano, J. et al. Rapid Detection of Mobilized Colistin Resistance using a Nucleic Acid Based Lab-on-a-Chip Diagnostic System. Sci. Rep.10, 8448. 10.1038/s41598-020-64612 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Xu, W. et al. Molecular Mechanisms and Epidemiology of Fosfomycin Resistance in Staphylococcus aureus Isolated From Patients at a Teaching Hospital in China. Front. Microbiol.11, 1290. 10.3389/fmicb.2020.01290 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhang, R. et al. Characterization of FosA13, a novel fosfomycin glutathione transferase identified in a Morganella morganii isolate from poultry. Front. Cell. Infect. Microbiol.11, 15:1534084. 10.3389/fcimb.2025.1534084 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hong, Y. et al. Identification of the novel fosfomycin resistance gene fosSC in Staphylococcus capitis. Int. J. Antimicrob.63 (6), 107162. 10.1016/j.ijantimicag.2024.107162 (2024). [DOI] [PubMed] [Google Scholar]
  • 20.Goraj, W. et al. Fosfomycin Resistance: An Update on the Anthropogenic Impact Through Agriculture. Pathogens15 (1), 29. 10.3390/pathogens15010029 (2026). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Xu, S. et al. Mutations of the Transporter Proteins GlpT and UhpT Confer Fosfomycin Resistance in Staphylococcus aureus. Front. Microbiol.19, 8:914. 10.3389/fmicb.2017.00914 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fu, Z. et al. Prevalence of Fosfomycin Resistance and Mutations in murA, glpT, and uhpT in Methicillin-Resistant Staphylococcus aureus Strains Isolated from Blood and Cerebrospinal Fluid Samples. Front. Microbiol.11, 6:1544. 10.3389/fmicb.2015.01544 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (1.2MB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author, NS, upon reasonable request. The raw genomic sequencing data of the bacterial isolates used have been submitted to GenBank under Bio Project accession number PRJNA1152710.

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES