ABSTRACT
Background
Rheumatoid arthritis (RA) is a chronic autoimmune disease characterized by persistent synovial inflammation and joint damage. Toll‐like receptor 7 (TLR7), one of the innate immunity receptors, plays a role in releasing inflammatory mediators like cytokines and histamine. These mediators are crucial in inducing and maintaining chronic inflammation in the joints. This study examines the relationship between histamine receptor 2 (H2R) and TLR7 expression in peripheral blood mononuclear cells (PBMCs) and evaluates plasma levels of histamine, IL‐10, and TNF‐α in RA patients.
Methods
The study included 60 RA patients (22 newly diagnosed and 38 undergoing treatment) and 30 healthy controls. H2R and TLR7 gene expression in PBMCs was measured using Real‐time PCR (RT‐PCR), while plasma levels of histamine, TNF‐α, and IL‐10 were assessed using ELISA.
Results
H2R and TLR7 gene expression in PBMCs was significantly higher in RA patients than in controls (p = 0.0013, p = 0.0057), with newly diagnosed patients showing increased H2R expression compared to treated individuals (p = 0.0004). Plasma levels of histamine, TNF‐α, and IL‐10 were elevated in RA patients, with higher histamine and TNF‐α levels in newly diagnosed cases and increased IL‐10 in treated patients (p = 0.0253). Significant correlations were observed between H2R and TLR7 expression (R = 0.68, p < 0.0001) and between H2R expression and histamine levels (R = 0.34, p = 0.01).
Conclusions
Our study suggests a potential link between H2R signaling and TLR7 activation in RA. The therapeutic potential of H2R inhibitors and TLR7 antagonists in mitigating RA progression warrants further investigation.
Keywords: histamine, histamine receptor 2, IL‐10, rheumatoid arthritis, TLR7, TNF‐α
1. Introduction
Rheumatic diseases encompass a range of conditions affecting joints, bones, and muscles, often causing pain, inflammation, and stiffness. Rheumatoid arthritis (RA) is an autoimmune rheumatic disease where the body's immune system mistakenly attacks its joints, leading to chronic inflammation [1]. This inflammation is a key driver of RA pathogenesis. Histamine, a biogenic amine and crucial mediator in inflammatory processes, is found in high quantities during these processes and plays a significant role in RA [2]. Histamine acts through four G protein‐coupled receptors (H1R, H2R, H3R, and H4R) [3]. While H1 receptors primarily drive vascular effects and H2 receptors influence gastric secretion [4] H4 receptors on hematopoietic cells are important in inflammatory conditions, including RA [5]. H3 receptors also play a role in inflammation, modulating histamine release and other neurotransmitter systems, although their precise role in RA is still being investigated. Histamine and its receptors (H1R‐H4R) are implicated in RA pathogenesis and are potential therapeutic targets. Specifically, H2 receptors are expressed on various immune cells, including PBMCs, and play a role in modulating immune responses in inflammatory conditions like RA [6]. Although recent research has predominantly focused on H4 receptors due to their established role in immune cell recruitment and inflammation, the immunomodulatory functions of H2R—particularly in regulating cytokine production and immune balance—remain relatively underexplored in RA. This highlights a critical gap in current knowledge and provides a rationale for further investigation of H2R in the context of RA pathogenesis.
The Toll‐like receptor (TLR) family initiates innate and adaptive immune responses and plays a significant role in the inflammatory processes characteristic of RA [7]. TLRs identify pathogen‐associated and damage‐associated molecular patterns (PAMPs and DAMPs, respectively) [8]. TLR7, found in hematopoietic and non‐immune cells, responds to its ligand within endosomes, and its expression is elevated in RA [9]. TLR7 activation can contribute to pro‐inflammatory cytokine production, further exacerbating RA's inflammatory cascade. Both histamine signaling via H2R and TLR7 activation are implicated in the complex inflammatory mechanisms driving RA [10].
Cytokines modulate immune responses and contribute to systemic disorders [11]. IL‐10, produced by TH2 lymphocytes, T regulatory cells, and macrophages, is an anti‐inflammatory factor [12]. TNF‐α, a pro‐inflammatory cytokine, plays roles in immune responses, tumor cytotoxicity, and conditions like diabetes and rheumatoid arthritis [13, 14]. Both histamine signaling and TLR activation can influence the production and release of these cytokines. For instance, through its receptors (particularly H2R), histamine can modulate the production of pro‐inflammatory cytokines like TNF‐α and anti‐inflammatory cytokines like IL‐10, contributing to the complex cytokine balance in inflammatory conditions [15]. Similarly, TLR7 activation is known to induce the production of pro‐inflammatory cytokines, including TNF‐α, which further amplifies the inflammatory cascade [16]. This interplay between histamine signaling, TLR activation, and cytokine production is crucial in the pathogenesis of RA. This study aimed to investigate the correlation of histamine receptor 2 (H2R) and TLR7 expression in peripheral blood mononuclear cells of RA patients. Crucially, rather than evaluating cytokines in isolation, we also assessed plasma levels of TNF‐α and IL‐10 to serve as functional, downstream indicators of the pro‐ and anti‐inflammatory balance associated with the activation of this receptor axis across different stages of treatment status.
2. Materials and Methods
2.1. Sample Collection
This case–control study included a patient group of 60 individuals diagnosed with rheumatoid arthritis (RA), among whom approximately 22 were newly diagnosed cases, ranging in age from 20 to 90 years. A rheumatologist confirmed RA diagnoses based on the American College of Rheumatology (ACR) criteria, and disease activity was evaluated using the Clinical Disease Activity Index (CDAI). The control group consisted of 30 healthy individuals, free from rheumatoid arthritis or other chronic illnesses, selected to be partially matched with the RA group. All participants provided informed consent before inclusion in the study, and none of the patients had comorbid conditions. Patient recruitment took place between August 2022 and April 2023 at Sayad Shirazi Hospital in Gorgan City.
2.2. RNA Extraction and Real–Time PCR (RT‐PCR)
The blood samples were collected and divided into two 5 mL tubes, one for isolating PBMCs and then RNA extraction and cDNA synthesis for RT‐PCR. Total RNA was isolated from frozen PBMC samples by RNX‐PLUS (Sinaclon, Cat. No: EX6101), and the cDNA was synthesized by a cDNA kit (Sinaclon, Cat. No: RT5210). Gene‐specific primers were designed using oligo‐analyzer software and the NCBI website. Primer sequences specific for the TLR7 and H2R genes are presented in Table 1.
TABLE 1.
Primer sequences specific for the TLR‐7 and H2R genes.
| Oligo‐name | Seq. (5–3) | M.W | T.M | GC% | Mer |
|---|---|---|---|---|---|
| TLR‐7‐F | AGCCACAACCAACTGACCAC | 6009 | 59.35 | 55 | 20 |
| TLR‐7‐R | ATCGCAACTGGAAGGCATCTTG | 6759.4 | 60.25 | 50 | 22 |
| H2R‐F | CAGTTCGGGTCGCCATCTC | 5755.7 | 60.98 | 63.16 | 19 |
| H2R‐R | CTGGTCTCGTTCCTGCTGCTGTTC | 6346.1 | 61.78 | 57.14 | 21 |
| 18srRNA‐F | CAGCCACCCGAGATTGAGCA | 6096 | 63 | 60 | 20 |
| 18srRNA‐R | TAGTAGCGACGGGCGGTGTG | 6254 | 65 | 65 | 20 |
To evaluate mRNA expression level, RT‐PCR was performed using specific primers (Table 1), and the relative amount of the genes of interest and the s18 reference gene was measured in two independent assays. Specific amplification of the PCR products was analyzed using melting curve analysis. The data were presented as the relative expression of the genes of interest compared with the internal control gene as determined by the 2−∆CT method. Histamine levels, tumor necrosis factor‐alpha (TNF‐α), and interleukin‐10 (IL‐10) were measured in plasma using ELISA kits from Biolegend (Cat. No: 430204) and Zellbio GmbH (Cat. No: RK00012), respectively.
2.3. Statistical Analysis
Continuous variables (cytokines and gene expression levels) were expressed as (means ± SE). Group comparisons were conducted using the Student's t‐test (or Mann–Whitney test). For analyses involving more than two groups, the Kruskal‐Wallis ANOVA test was utilized. Correlations between variables were assessed using Spearman's test. Statistical analysis was performed using GraphPad Prism, with a significance threshold set at p ≤ 0.05.
3. Results
3.1. Demographic Analysis
The results showed that the highest percentage of RA‐affected individuals was in the 46–55 age group (41.60%), followed by the 56–65 age group (30%). The 26–35 and 36–45 age groups had 11.60%, while the 15–25 and 86–95 age groups each had the lowest percentage (1.60%). The sex distribution of the patient group was predominantly female (80%) and male (20%). Based on CDAI, 26% of patients had high disease activity, 21% had moderate disease activity, 23% had low disease activity, and 25% were in remission.
3.2. H2R Gene Expression
The histamine receptor 2 (H2R) gene expression was evaluated and compared with a control group. As shown in Figure 1A–C, H2R gene expression was significantly higher in RA patients than in controls (p = 0.0013) (Figure 1A). New cases showed significantly higher H2R expression than on‐treatment cases (p = 0.0004) (Figure 1B). Comparison of H2R expression between RA‐Score groups showed no significant differences (Figure 1C).
FIGURE 1.
The histamine receptor 2 gene expression in PBMCs of RA patients and controls. (A) The gene expression of H2R in RA patients is significantly higher than in the control group (p = 0.0013). (B) The H2R gene expression is significantly lower in RA patients who are under treatment in comparison to new case patients (p = 0.0004). (C) The comparison between H2R gene expression with RA scores showed no significant differences. Significance was calculated using the unpaired t‐test and one‐way ANOVA/Kruskal–Wallis test. Data are displayed as Means ± SEM. (**p ≤ 0.01. ***p ≤ 0.001).
3.3. TLR7 Gene Expression
TLR7 gene expression was significantly higher in RA patients than in controls (p = 0.0057) (Figure 2A). New cases showed significantly higher expression than on‐treatment RA patients (p = 0.0010) (Figure 2B). Comparison of gene expression across RA‐Score groups (one‐way ANOVA/Kruskal–Wallis test) showed significant differences (p = 0.0426) (Figure 2C). Post hoc Mann–Whitney tests revealed significantly higher expression in the high disease activity (HDA) group compared to the remission group (p = 0.0248) and in the moderate disease activity (MDA) group compared to the remission group (p = 0.0286).
FIGURE 2.
The toll‐like receptor 7 gene expression in PBMCs of RA patients and controls. (A) TLR‐7 gene expression was significantly higher in RA patients than in healthy controls (p = 0.0057). (B) New cases patients showed significantly higher expression than under‐treatment RA patients (p = 0.0010). (C) Comparison of TLR‐7 gene expression with RA‐Score groups (one‐way ANOVA/Kruskal–Wallis test) showed significant differences (p = 0.0426). Also, analysis showed significantly higher TLR‐7 expression in the high disease activity (HDA) group compared to the remission group (p = 0.0248) and in the moderate disease activity (MDA) group compared to the remission group (p = 0.0286). Significance was calculated using the unpaired t‐test, one‐way ANOVA/Kruskal–Wallis test, and post hoc Mann–Whitney test. Data are displayed as Means ± SEM. (**p ≤ 0.01. ***p ≤ 0.001).
3.4. Detection of Histamine Levels by ELISA
Histamine levels were significantly higher in RA patients than in controls (p = 0.0497) (Figure 3A). Newly diagnosed RA patients had significantly higher histamine levels than on‐treatment patients (p = 0.0277) (Figure 3B). Comparison of histamine levels across RA‐Score groups (one‐way ANOVA/Kruskal–Wallis test) showed no significant differences (Figure 3C).
FIGURE 3.
The histamine plasma levels in RA patients. (A) The histamine plasma levels in RA patients were significantly higher than healthy controls (p = 0.0497). (B) The histamine levels are significantly decreased in on‐treatment patients in comparison to new case patients (p = 0.0277). (C) Histamine levels do not show a significant relationship with each RA score. Significance was calculated using the unpaired t‐test and one‐way ANOVA/Kruskal–Wallis test. Data are displayed as Means ± SEM. (* p ≤ 0.05).
3.5. Detection of TNF‐α Levels by ELISA
TNF‐α levels were significantly higher in RA patients compared to controls (p < 0.0001) (Figure 4A). Newly diagnosed RA patients had higher TNF‐α levels than on‐treatment patients (p = 0.0151) (Figure 4B). Comparison of TNF‐α levels across RA‐score groups (one‐way ANOVA/Kruskal–Wallis test) showed significant differences. Post hoc Mann–Whitney tests revealed significant differences between HDA and remission (p = 0.0004) and between HDA and LDA (p = 0.0443), with no significant differences between other groups (Figure 4C).
FIGURE 4.
The TNF‐α plasma levels in RA patients. (A) The plasma levels of TNF‐α are significantly increased in RA patients in comparison to healthy controls (p < 0.0001). (B) Within RA patients, plasma levels of TNF‐α are significantly increased in on‐treatment patients in comparison to new diagnostic patients (p = 0.0151). (C) TNF‐α levels do not show a significant relationship with each RA score. Significance was calculated using the unpaired t‐test and one‐way ANOVA/Kruskal–Wallis test. Data are displayed as mean ± SEM. (*p ≤ 0.05. ****p ≤ 0.0001, p ≤ 0.001, ns: non‐significant).
3.6. Detection of IL‐10 Levels by ELISA
IL‐10 levels were significantly higher in RA patients than in controls (p = 0.0196) (Figure 5A). On‐treated RA patients had higher IL‐10 levels than newly diagnosed RA patients (p = 0.0253) (Figure 5B). Comparison of IL‐10 levels across RA‐score groups showed no significant differences (Figure 5C).
FIGURE 5.
The IL‐10 plasma levels in RA patients. (A) IL‐10 levels in RA patients are significantly increased in comparison with healthy controls. (B) Within RA patients, IL‐10 plasma levels are significantly increased in under‐treatment patients in comparison to new case patients. (C) Histamine levels do not show a significant relationship with each RA score. Significance was calculated using the unpaired t‐test and one‐way ANOVA/Kruskal–Wallis test. Data are displayed as mean ± SEM. (*p ≤ 0.05).
3.7. Correlation Between H2R and TLR7 Genes Expression
Correlation analysis revealed a strong positive correlation between H2R and TLR7 (Spearman's Rho r = 0.68, p = 2.78). A slight positive correlation was found between H2R gene expression and histamine levels (r = 0.34, p = 0.01).
4. Discussion
Our findings highlight a potential relationship between histamine signaling and TLR7 activation in rheumatoid arthritis (RA), especially during the early stages of the disease. Increased expression of H2R and TLR7 in the peripheral blood mononuclear cells (PBMCs) of RA patients, particularly those newly diagnosed, coupled with higher levels of plasma histamine, TNF‐α, and IL‐10 suggests a potential association with disease progression. The positive association between H2R and TLR7 expression, as well as between H2R and histamine levels, may indicate a potential role of histamine signaling in immune activation.
The increased H2R gene expression in RA PBMCs, especially in newly diagnosed RA patients, is a novel finding. While Kim et al. [5] reported elevated H4R expression in RA PBMCs, the role of H2R in RA remains less explored. Our data suggest that H2R expression may be modulated by treatment with Disease‐modifying antirheumatic drugs (DMARDs), as we observed lower expression in patients under treatment compared to newly diagnosed individuals. By targeting various inflammatory pathways [17], DMARDs could indirectly influence H2R expression. Alternatively, they might directly interact with H2R regulatory pathways [5]. Further research is crucial to dissect the precise mechanisms by which DMARDs affect H2R expression. It is also important to acknowledge that PBMCs comprise various immune cell subsets (T cells, B cells, and monocytes), each potentially exhibiting different H2R expression patterns. Future studies should investigate the specific effects of altered H2R expression on these subsets and how these effects are modulated by treatment [5, 18]. Interestingly, our findings differ from earlier reports, such as the study by Tanaka et al. [19], which described downregulation of H2R in certain cell types, including synovial fibroblasts and lymphocytes. This discrepancy may be attributed to differences in cell populations analyzed, as our study focused on total PBMCs rather than isolated cell subsets. Additionally, advances in detection methods, as well as differences in disease stage and treatment status, may contribute to these contrasting observations, suggesting that H2R expression in RA is dynamic and context‐dependent. These findings suggest that the role of H2R in RA may warrant further investigation, particularly given its relatively limited exploration compared to other histamine receptor subtypes in recent years.
Our observation of elevated TLR7 gene expression in RA PBMCs aligns with previous work demonstrating increased TLR3 and TLR7 expression in RA synovium [20]. TLR7, crucial for innate immune responses, recognizes ssRNA from viruses and self‐RNA released from damaged cells [21]. The heightened TLR7 expression in RA PBMCs, particularly in newly diagnosed RA patients, could contribute to chronic inflammation by promoting pro‐inflammatory cytokine production and immune cell activation. This finding is consistent with the notion that TLR signaling pathways are activated early in RA progression [22]. The observed decrease in TLR7 expression in treated patients may reflect the immunomodulatory effects of DMARDs and other therapies. TLR7 expression can be influenced by various factors, including IFN‐α [23], epigenetic regulation [24] age, disease activity, and glucocorticoid treatment [25]. Our finding of significant differences in TLR7 expression across RA disease activity scores (HDA vs. Remission, MDA vs. Remission) further supports the link between TLR7 and disease status [26].
The elevated plasma histamine levels in RA patients corroborate some studies [5] but contradict other previous findings [27]. The discrepancy may be due to differences in patient populations, disease activity, or assay methodologies. Our data did not reveal significant differences in histamine levels across RA disease activity scores, consistent with some prior reports [28]. The increased TNF‐α and IL‐10 levels in RA patients are well‐established [29]. The higher TNF‐α in newly diagnosed RA patients and the higher IL‐10 in treated patients are interesting observations that warrant further investigation. The inverse relationship of TNF‐α and IL‐10 with treatment status could be related to the natural progression of the disease or could be influenced by the treatment itself. IL‐10 is generally considered an anti‐inflammatory cytokine, and its increase with treatment could be a mechanism to control the inflammatory response [30]. Importantly, the assessment of TNF‐α and IL‐10 in this study was not intended to establish novel cytokine findings, but rather to provide functional context for the observed alterations in H2R and TLR7 expression. These cytokines were included as representative markers of pro‐ and anti‐inflammatory responses, allowing for a more integrated interpretation of the immunological environment associated with this receptor axis in RA.
The observed strong positive correlation between H2R and TLR7 gene expression in RA PBMCs represents a novel finding. However, this association should be interpreted with caution, as it does not imply a direct causal or functional interaction between these pathways. Rather, the concurrent upregulation of H2R and TLR7 may reflect a shared upstream regulatory mechanism or a common inflammatory milieu characteristic of RA. Although prior evidence suggests that histamine signaling can modulate immune responses and cytokine production, the potential interplay between H2R signaling and TLR7 activation has not been directly investigated in this study. Therefore, our findings primarily support the existence of an association rather than a mechanistic link [5]. Given the cross‐sectional case–control design of this study, causal inference cannot be established. To better define the nature of this relationship, future studies employing functional approaches—such as receptor‐specific inhibition, gene silencing, and pathway‐level analyses in both in vitro and in vivo models—are required. These investigations would help clarify whether a direct regulatory interaction exists or whether both pathways are independently driven by the inflammatory environment in RA. The relatively small sample size, particularly in the healthy control group, represents another limitation of this study and may affect the generalizability of the findings. Therefore, the results should be interpreted with caution. Nevertheless, the statistically significant differences and correlations observed suggest that these findings may reflect underlying biological patterns. Future studies with larger and more balanced cohorts are required to confirm and extend these results.
5. Conclusions
Our findings suggest a potential association between histamine signaling through H2R and TLR7 activation in RA. While this relationship may reflect a coordinated involvement of these pathways in the inflammatory processes underlying RA, no causal interaction can be inferred from the present study. The observed association highlights the possibility that H2R and TLR7 signaling may contribute to the complex immunological network involved in disease progression. Although previous evidence has suggested that modulation of these pathways may have therapeutic relevance, the current findings should be interpreted as hypothesis‐generating rather than indicative of direct clinical application. Further mechanistic and longitudinal studies are required to elucidate the precise nature of this relationship and to determine whether targeting these pathways may offer potential therapeutic benefits in RA.
Author Contributions
H.D. contributed to conceptualization, methodology, and supervision of the study. A.K.A.‐B. conducted the investigation, performed formal data analysis, and drafted the original manuscript. H.A. contributed to writing – review and editing of the manuscript. Y.B. and M.S.J. contributed to methodology and assisted with data analysis. S.S. contributed to the clinical aspects of the study. E.H. contributed to data acquisition and experimental procedures. All authors reviewed and approved the final version of the manuscript.
Funding
The authors have nothing to report.
Ethics Statement
This study was funded by Golestan University of Medical Sciences (GOUMS) with Ethics No: (IR.GOUMS.REC.1401.396). This original research was extracted from an MSc thesis in medical immunology.
Consent
All authors have provided their consent for the publication of this study.
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgments
We want to extend our heartfelt thanks to everyone who contributed to this study.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
References
- 1. Shakeel L., Shaukat A., Khaliq N., et al., “Rheumatoid Arthritis: A Comprehensive Overview of Genetic Markers, Emerging Therapies, and Personalized Medicine,” Annals of Medicine and Surgery 87 (2025): 696–710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Smolinska S., Winiarska E., Globinska A., and Jutel M., “Histamine: A Mediator of Intestinal Disorders—A Review,” Metabolites 12, no. 10 (2022): 895. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Jutel M., Akdis M., and Akdis C., “Histamine, Histamine Receptors and Their Role in Immune Pathology,” Clinical and Experimental Allergy: Journal of the British Society for Allergy and Clinical Immunology 39, no. 12 (2009): 1786–1800. [DOI] [PubMed] [Google Scholar]
- 4. Shi Z., Fultz R. S., Engevik M. A., et al., “Distinct Roles of Histamine H1‐ and H2‐Receptor Signaling Pathways in Inflammation‐Associated Colonic Tumorigenesis,” American Journal of Physiology. Gastrointestinal and Liver Physiology 316, no. 1 (2019): G205–G216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Kim K.‐W., Kim B. M., Lee K. A., Lee S. H., Firestein G. S., and Kim H. R., “Histamine and Histamine H4 Receptor Promotes Osteoclastogenesis in Rheumatoid Arthritis,” Scientific Reports 7, no. 1 (2017): 1197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Smuda C. and Bryce P. J., “New Developments in the Use of Histamine and Histamine Receptors,” Current Allergy and Asthma Reports 11 (2011): 94–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Park J. S., Svetkauskaite D., He Q., et al., “Involvement of Toll‐Like Receptors 2 and 4 in Cellular Activation by High Mobility Group Box 1 Protein,” Journal of Biological Chemistry 279, no. 9 (2004): 7370–7377. [DOI] [PubMed] [Google Scholar]
- 8. Carroll K., Sawden M., and Sharma S., “DAMPs, PAMPs, NLRs, RIGs, CLRs and TLRs–Understanding the Alphabet Soup in the Context of Bone Biology,” Current Osteoporosis Reports 23, no. 1 (2025): 6. [DOI] [PubMed] [Google Scholar]
- 9. Zong Y., Li H., Chang Y., et al., “Global Research Trends and Priorities in the Link Between Toll‐Like Receptors and Rheumatoid Arthritis: A Bibliometric Analysis From 2003 to 2023,” (2025).
- 10. Hansen Selnø A. T., Sumbayev V. V., Raap U., and Gibbs B. F., “Role of Histamine in Inflammatory Diseases,” Immunopharmacology and Inflammation (Springer, 2018), 85–106. [Google Scholar]
- 11. Catalan‐Dibene J., McIntyre L. L., and Zlotnik A., “Interleukin 30 to Interleukin 40,” Journal of Interferon & Cytokine Research 38, no. 10 (2018): 423–439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Giganti G., Atif M., Mohseni Y., et al., “Treg Cell Therapy: How Cell Heterogeneity Can Make the Difference,” European Journal of Immunology 51, no. 1 (2021): 39–55. [DOI] [PubMed] [Google Scholar]
- 13. Mateen S., Zafar A., Moin S., Khan A. Q., and Zubair S., “Understanding the Role of Cytokines in the Pathogenesis of Rheumatoid Arthritis,” Clinica Chimica Acta 455 (2016): 161–171. [DOI] [PubMed] [Google Scholar]
- 14. Jahandideh B., Derakhshani M., Abbaszadeh H., et al., “The Pro‐Inflammatory Cytokines Effects on Mobilization, Self‐Renewal and Differentiation of Hematopoietic Stem Cells,” Human Immunology 81, no. 5 (2020): 206–217. [DOI] [PubMed] [Google Scholar]
- 15. Branco A. C. C. C., Yoshikawa F. S. Y., Pietrobon A. J., and Sato M. N., “Role of Histamine in Modulating the Immune Response and Inflammation,” Mediators of Inflammation 2018, no. 1 (2018): 9524075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. El‐Zayat S. R., Sibaii H., and Mannaa F. A., “Toll‐Like Receptors Activation, Signaling, and Targeting: An Overview,” Bulletin of the National Research Centre 43, no. 1 (2019): 1–12. [Google Scholar]
- 17. Akdis M. and Akdis C. A., “Mechanisms of Allergen‐Specific Immunotherapy: Multiple Suppressor Factors at Work in Immune Tolerance to Allergens,” Journal of Allergy and Clinical Immunology 133, no. 3 (2014): 621–631. [DOI] [PubMed] [Google Scholar]
- 18. Thangam E. B., Jemima E. A., Singh H., et al., “The Role of Histamine and Histamine Receptors in Mast Cell‐Mediated Allergy and Inflammation: The Hunt for New Therapeutic Targets,” Frontiers in Immunology 9 (2018): 1873. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Tanaka S., Sohen S., and Fukuda K., “A Role for Histamine Receptors in Rheumatoid Arthritis,” Semin Arthritis Rheum 26, no. 6 (1997): 824–833, 10.1016/s0049-0172(97)80026-1. [DOI] [PubMed] [Google Scholar]
- 20. Roelofs M., Joosten L. A., Abdollahi‐Roodsaz S., et al., “The Expression of Toll‐Like Receptors 3 and 7 in Rheumatoid Arthritis Synovium Is Increased and Costimulation of Toll‐Like Receptors 3, 4, and 7/8 Results in Synergistic Cytokine Production by Dendritic Cells,” Arthritis & Rheumatism: Official Journal of the American College of Rheumatology 52, no. 8 (2005): 2313–2322. [DOI] [PubMed] [Google Scholar]
- 21. Gs C., “Recent Insights in the Epidemiology of Autoimmune Diseases: Improved Prevalence Estimates and Understanding of Clustering of Diseases,” Journal of Autoimmunity 33 (2009): 197–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Ospelt C., Brentano F., Rengel Y., et al., “Overexpression of Toll‐Like Receptors 3 and 4 in Synovial Tissue From Patients With Early Rheumatoid Arthritis: Toll‐Like Receptor Expression in Early and Longstanding Arthritis,” Arthritis & Rheumatism: Official Journal of the American College of Rheumatology 58, no. 12 (2008): 3684–3692. [DOI] [PubMed] [Google Scholar]
- 23. Pascual V., Allantaz F., Patel P., Palucka A. K., Chaussabel D., and Banchereau J., “How the Study of Children With Rheumatic Diseases Identified Interferon‐α and Interleukin‐1 as Novel Therapeutic Targets,” Immunological Reviews 223, no. 1 (2008): 39–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Klein K. and Gay S., “Epigenetics in Rheumatoid Arthritis,” Current Opinion in Rheumatology 27, no. 1 (2015): 76–82. [DOI] [PubMed] [Google Scholar]
- 25. Barnes M. G., Grom A. A., Thompson S. D., et al., “Subtype‐Specific Peripheral Blood Gene Expression Profiles in Recent‐Onset Juvenile Idiopathic Arthritis,” Arthritis & Rheumatism: Official Journal of the American College of Rheumatology 60, no. 7 (2009): 2102–2112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Clanchy F. I., Clanchy F. I. L., Borghese F., et al., “TLR Expression Profiles Are a Function of Disease Status in Rheumatoid Arthritis and Experimental Arthritis,” Journal of Autoimmunity 118 (2021): 102597. [DOI] [PubMed] [Google Scholar]
- 27. Adlesic M., Verdrengh M., Bokarewa M., Dahlberg L., Foster S. J., and Tarkowski A., “Histamine in Rheumatoid Arthritis,” Scandinavian Journal of Immunology 65, no. 6 (2007): 530–537. [DOI] [PubMed] [Google Scholar]
- 28. Tomic Lucic A., Pantovic S., Rosic G., et al., “Histamine Index and Clinical Expression of Rheumatoid Arthritis Activity,” (2010). [DOI] [PubMed]
- 29. Illahi M. I., Inam Illahi M., Amjad S., et al., “Serum Tumor Necrosis Factor‐Alpha as a Competent Biomarker for Evaluation of Disease Activity in Early Rheumatoid Arthritis,” Cureus 13, no. 5 (2021): e15314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Wang X., Wong K., Ouyang W., and Rutz S., “Targeting IL‐10 Family Cytokines for the Treatment of Human Diseases,” Cold Spring Harbor Perspectives in Biology 11, no. 2 (2019): a028548. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.