Skip to main content
NCBI home page
Genome Biology logoLink to Genome Biology
. 2002 Sep 26;3(10):research0057.1–research0057.14. doi: 10.1186/gb-2002-3-10-research0057

Conservation of long-range synteny and microsynteny between the genomes of two distantly related nematodes

DB Guiliano 1, N Hall 2, SJM Jones 3, LN Clark 2, CH Corton 2, BG Barrell 2, ML Blaxter 1,✉
PMCID: PMC134624  PMID: 12372145

Short abstract

To assess whether the pattern of high rates of genome rearrangement, with a bias towards within-chromosome events is true of nematodes in general, genome sequence was used to compare the model Caenorhabditis elegans and the filarial parasite Brugia malayi. It is suggested that intrachromosomal rearrangement is a major force driving chromosomal organization in nematodes.

Abstract

Background

Comparisons between the genomes of the closely related nematodes Caenorhabditis elegans and Caenorhabditis briggsae reveal high rates of rearrangement, with a bias towards within-chromosome events. To assess whether this pattern is true of nematodes in general, we have used genome sequence to compare two nematode species that last shared a common ancestor approximately 300 million years ago: the model C. elegans and the filarial parasite Brugia malayi.

Results

An 83 kb region flanking the gene for Bm-mif-1 (macrophage migration inhibitory factor, a B. malayi homolog of a human cytokine) was sequenced. When compared to the complete genome of C. elegans, evidence for conservation of long-range synteny and microsynteny was found. Potential C. elegans orthologs for II of the 12 protein-coding genes predicted in the B. malayi sequence were identified. Ten of these orthologs were located on chromosome I, with eight clustered in a 2.3 Mb region. While several, relatively local, intrachromosomal rearrangements have occurred, the order, composition, and configuration of two gene clusters, each containing three genes, was conserved. Comparison of B. malayi BAC-end genome survey sequence to C. elegans also revealed a bias towards intrachromosome rearrangements.

Conclusions

We suggest that intrachromosomal rearrangement is a major force driving chromosomal organization in nematodes, but is constrained by the interdigitation of functional elements of neighboring genes.

Background

All genomes encode conserved genes. The arrangement of these genes on chromosomal elements is determined by a balance between stochastic rearrangements and functional constraints. The level of conservation of gene order (synteny) and linkage between two genomes will depend on the relative contributions of inter- and intrachromosomal rearrangements. Whereas shared ancestry and functional constraints will increase conservation of linkage and synteny between taxa, rearrangement events will tend to randomize gene order over time. In the Metazoa, several gene clusters have been identified that remain linked because of functional constraints. These include the histone genes [1], the Hox gene clusters [2], the immunoglobulin cluster [3], and the major histocompatibility complex (MHC) [4], but most genes are believed to be free to move within the genome. The tempo of gene rearrangement varies between taxa [5,6]. Vertebrate chromosomes are mosaic structures containing large conserved segments that can reside in different linkage groups in different species. There is a surprising conservation of synteny between distantly related species (approximately 450 million years (Myr) divergence) [7]. However, some lineages, such as rodents, show more extensive rearrangement than others, such as teleosts.

In protostomes, comparative studies of the genomes of closely related dipterans (Drosophila sp. and Aedes aegypti [5,8]) and nematodes (Caenorhabditis elegans and C. briggsae [6,9]) revealed a high rate of rearrangement. Chromosome rearrangements between closely related Drosophila species are mainly large pericentric inversions that may be facilitated by flanking transposon sequences [10,11]. C. elegans and C. briggsae are closely related, with estimates of 25-120 Myr divergence based on sequence comparisons [6,12]. Two groups have attempted to assess genome rearrangement rates and modes in comparisons between these two species. Kent and Zahler [9] compared 8.1 megabases (Mb) of fragmentary C. briggsae sequence derived from sequenced cosmid clones to C. elegans and derived a mean syntenic fragment length of 8.6 klobases (kb), or approximately 1.8 genes (there is one gene per 5 kb in C. elegans) [13]. In contrast, Coghlan and Wolfe [6], comparing 12.9 Mb of C. briggsae cosmid-derived sequence, found a mean syntenic fragment length of 53 kb. The difference appears to be purely methodological, as Kent and Zahler analyzed a subset of the data of Coghlan and Wolfe, and probably derives from a more relaxed definition of matching genes and use of cosmid fingerprinting physical map information by the latter study [6]. Estimation of rates of intrachromosomal to between-chromosome rearrangements showed that both were very frequent (approximately fourfold greater than that observed in D. melanogaster). Again, repeat sequences were associated with rearrangement boundaries [6]. It remains to be established whether this high rate of rearrangement is peculiar to the Caenorhabditis lineage, or is a general feature of nematode genomes.

To address this question we have begun analysis of a third nematode genome, that of the human filarial parasite Brugia malayi, which is estimated to have last shared a common ancestor with C. elegans 300-500 Myr ago [14]. B. malayi has a genome size of 100 Mb [15] and a gene complement estimated to be similar to C. elegans [16], and is the subject of a mature, expressed sequence tag (EST)-based genome project [16,17]. Unlike C. elegans, which has five autosomes and an XX/Xo sex-determination system [18], B. malayi has four autosomes and an XX/XY system [19]. The small size of condensed nematode chromosomes has precluded accurate in situ analysis of conservation of gene order. We have therefore taken a sequence-based approach, and here compare an 83 kb region surrounding the B. malayi macrophage-migration-inhibitory factor 1 locus (Bm-mif-1), a B. malayi homolog of a vertebrate cytokine [20], to the C. elegans genome and have found evidence for conservation of linkage and microsynteny between these two distantly related nematodes. The general features of this comparison were confirmed using a survey of genome sequences from B. malayi.

Results

General sequence features of an 83 kb segment of the B. malayi genome

Two overlapping bacterial artificial chromosome clones (BACs) were isolated that spanned the Bm-mif-1 locus. The inserts of BMBAC01L03 and BMBAC01P19 were 28,757 base pairs (bp) and 64,685 bp, respectively, with 10,637 bp of overlap, yielding a contiguated sequence of 82,805 bp (Figure 1). AT content overall was 68.0%; exonic DNA had an AT content of 59.9% and intergenic and intronic DNA had AT contents of 69.3% and 70.4% respectively. The average predicted gene size was 4.7 kb (range 0.6-20 kb). The average distance between genes was 3.1 kb (range 0.3-10.5 kb), giving an average gene density of one gene per 6.9 kb. There was an average of 9.3 introns per gene, with an average intron length of 316 bp (range 48-2,767 bp). The C. elegans orthologs of the B. malayi genes (see below) had a mean length of 3.2 kb, with an average of 5.5 introns per gene (mean size of 142 bp). The B. malayi genes were longer as a result of increased mean length and number of introns. Comparison to C. elegans presumed orthologs (see below) showed that only 50% of C. elegans introns were conserved in B. malayi (29 of 56 introns), and 25% of B. malayi introns (29 of 107) were conserved in C. elegans (Table 1). Of the 12 predicted B. malayi genes, seven were tested and confirmed by cDNA-PCR, and alternatively spliced transcripts were identified for four. Five of the 12 genes had corresponding ESTs (Table 1).

Figure 1.

Figure 1

Open in a new tab

The BMBAC01L03/BMBAC01P19 contig compared to the C. elegans genome. Genes are indicated by exon (box) and intron (bracket) structures. For each species, the direction of transcription of the genes is indicated by an arrow. The C. elegans gene structures are drawn to the same scale as the B. malayi contig. A, Match to B. malayi EST cluster BMC03169 [16]. Brugia EST (BMC) and Onchocerca volvulus (OVC) clusters are viewable in NemBase [39,60]. B, Highly similar to O. volvulus EST cluster OVC02481 [61]. C, Match to B. malayi EST cluster BMC00238. D, Match to B. malayi EST clusters BMC02055 and BMC01932. However, no ORF was identified, and it may not represent protein-coding sequence (see text for discussion). E, Match to B. malayi EST cluster BMC06334. F, Match to B. malayi EST cluster BMC00400. G, BMBAC01L03.1 and BMBAC01P19.7 are gene fragments. Percent identity was calculated on the alignable portion of the C. elegans ortholog. H, F13G3.9 (Ce-mif-3) is on C. elegans chromosome I. However, F13G3.9 is not the predicted ortholog of Bm-mif-1 and thus the relationship is indicated by a dashed arrow (see text). I, Percent identity was calculated for BMBAC01P19.3 and BMBAC01L03.4 only within the PWWP or dnaJ domains respectively. Homolog pairs are indicated by the colouring of the gene models.

Table 1.

Genes predicted on the BMBAC01L03/BMBAC01P19 contig

B. malayi open reading frame Predicted cDNA length (bp) Predicted peptide length Number of introns C. elegans ortholog Percent identity with C. elegans ortholog Number of introns in C. elegans ortholog Number of shared intron positions with C. elegans ortholog Putative identity
BMBAC01L03.1 1340* 446* 7* CeF14B4.3 58† 3‡ 3 Amino-terminal fragment of the β subunit of RNA polymerase I
BMBAC01L03.2 693 230 6 CeF43G9.5 68 3 1 Pre-mRNA cleavage factor
BMBAC01L03.3 1239 412 8 - - - - Contains LON-ATP-dependent serine protease domain
BMBAC01L03.4 630 209 2 CeF39B2.10 57§ 3 1 Contains dnaJ domain
BMBAC01L03.5 918 305 6 CeF43G9.3 58 6 2 Mitochondrial carrier protein
BMBAC01P19.1 (Bm-mif-1) 535 115 2 CeY56A3A.3 41 2 2 Macrophage-migration- inhibitory factor homolog
BMBAC01P19.2a/b (Bm-pbr-1) 5955/5748 1934/1865 37/35 CeC26C6.1 34 14 9 Polybromo domain protein, BAF180 homolog
BMBAC01P19.3 a/b 1182/919 367/283 9/7 CeF43G9.4 44 8 2 Contains PWWP domain
BMBAC01P19.4 (Bm-dap-1) 446 111 1 CeT28F4.5 30 1 1 Homolog of mammalian death- associated protein DAP-1
BMBAC01P19.5a/b (Bm-ubr-1) 2679/2602 847/821 18/17 CeT28F4.4 27 12 5 Unknown
BMBAC01P19.6 804 190 4 CeF31C3.5 41 1 1 Conserved protein of unknown function
BMBAC01P19.7a/b 1039/932* 274/298* 6/7* CeC36B1.12 60# 3‡ 2 Carboxy-terminal fragment of a novel transmembrane protein
Open in a new tab

*Gene fragments (see text). †BMBAC01L03.1 gene fragment aligned with the amino-terminal 450 amino acids of CeF14B4.3. ‡Number of introns in the aligned portion of the C. elegans ortholog. §Percent identity over the dnaJ domains of BMBAC01L03.4 and CeF39B2.10. Percent identity over the PWWP domains of BMBAC01P19.3 and CeF43G9.4. #The gene fragment of BMBAC01P19.7 aligned with the carboxy-terminal 380 amino acids of CeC36B1.12.

Comparison of predicted genes to C. elegans

All 12 predicted genes had C. elegans homologs, but putative orthology could only be assigned to 11 pairs (Figure 1, Table 1). Orthology definition is possibly problematic, as the complete genome sequence of B. malayi is not known, and it is thus possible that genes more similar to these C. elegans comparators could be present. We note, however, that no B. malayi EST-defined genes (23,000 ESTs defining approximately 8,300 genes [16]) have better matches to these C. elegans proteins (data not shown), and that orthology definition included coextension of the proteins, and conservation of intron position and phase (Table 1). The exception, BMBAC01L03.3, contained two domains, an amino-terminal LON ATP-dependent serine protease domain (domain PF02190) and an anonymous carboxy-terminal domain (PFB022940). Proteins predicted from the Arabidopsis thaliana (AAC42255.1), Mus musculus (NP_067424), and Homo sapiens (XP_0421219) genomes share this architecture, but there are no C. elegans proteins that have both domains.

Some genes were similar to hypothetical, functionally uncharacterized genes from C. elegans. BMBAC01P19.7a/b had multiple predicted transmembrane segments also found in a number of peptides from other species (PFB002843) and were most similar to C36B1.12 (60% identity). There is only one homolog of BMBAC01P19.3a in any organism -F43G9.4 from C. elegans. The amino termini of both BMBAC01P19.3a and F43G9.4 contained PWWP domains (PF00855). PWWP domains are found in proteins with nuclear location and roles in cell growth and differentiation [21,22]. PSORT profiling indicated that BMBAC01P19.3 and F43G9.4 were likely to have nuclear localizations. The amino terminus of BMBAC01L03.4 contains a dnaJ-like domain (PF00684). The dnaJ domain is found in 41 C. elegans proteins, but BMBAC01L03.4 showed highest identity (57%) to F39B2.10. Both proteins had the dnaJ domain at their amino terminus and shared a common position of the first intron in this region. The remainder of the protein was not conserved.

BMBAC01P19.1 encodes Bm-mif-1 (Figure 2) [20]. Mammalian MIF is a cytokine involved in inflammation, growth, and differentiation of immune cells [23]: B. malayi MIF-1 may have a role in immunomodulation of the host [20,24]. C. elegans has four MIF-like genes: Ce-mif-1 (Y56A3A.3), Ce-mif-2 (C52E4.2), Ce-mif-3 (F13G3.9), and Ce-mif-4 (Y73B6BL.13). Transgenic reporter and immunolocalization studies suggest that C. elegans MIFs may have roles in development and the dauer stage [13,25]. Bm-MIF-1 has highest pairwise similarity to Ce-MIF-1 (41% compared to 23-29% for the other three paralogues; Figure 2) [20], and phylogenetic analysis of over seventy MIF-like proteins from eukaryotes confirms this assignment (D.B.G. and M.L.B., manuscript in preparation). Comparison of Bm-MIF-1 to the C. elegans MIFs, a second B. malayi MIF (Bm-MIF-2), and human MIF-1 (Figure 2) revealed that Bm-mif-1 and Ce-mif-1 shared two intron/exon boundaries also found in vertebrate MIFs. One of these introns was also present in Ce-mif-3, but Ce-mif-3 and the other two C. elegans mif genes shared a set of introns not present in the mif-1 genes. Bm-MIF-1 and other filarial MIF-1 homologs contain a CXXC motif (single-letter amino-acid code) critical for the thiol-oxidoreductase activities of vertebrate MIF [26]. None of the C. elegans MIF homologs contained this motif.

Figure 2.

Figure 2

Open in a new tab

Comparison of B. malayi and C. elegans MIF proteins. Bm-MIF-1 (accession AAC82502) was aligned with human Hs-MIF-1(AAA21814), C. elegans MIF homologs Ce-MIF-1 (CAB60512), Ce-MIF-2 (CAB01412), Ce-MIF-3 (CAA95795), Ce-MIF-4 (AAG23475), and Bm-MIF-2b (AAF91074). Intron positions are marked by triangles (red, conserved with Hs-MIF-1; blue, Ce-MIF-2, -3 and -4 specific). The proline at position 2 (white) is important for immune function, and the CXXC motif at positions 60-63 is essential for thiol-oxidoreductase activity in mammalian MIF. The percent identity of each protein to Bm-MIF-1 is given at the end of the alignment.

Conserved gene clusters

Two clusters of three genes in close proximity are conserved. The first involves BMBAC01L03.2, .3 and .5. The C. elegans orthologs of these genes are F43G9.5, F43G9.4, and F43G9.3 respectively. F43G9.5 and F43G9.3 are divergently transcribed from a 631 bp intergenic region. F43G9.3 is followed by F43G9.4 in the same transcriptional orientation with 501 bp separating the genes. In B. malayi this local synteny is conserved, except that two additional genes - BMBAC01L03.3 and .4 - are found between BMBAC01L03.2 and .5.

The second cluster also involves three genes. Proteins predicted from both alternative transcripts of BMBAC01P19.2 were found to be homologous to large proteins from Homo sapiens (BAF180, AAG34760 [27]), Gallus gallus (JC5056 [28]), D. melanogaster (CG11375, AAF56339), and C. elegans (C26C6.1) (Figure 3). These proteins shared six bromodomains (PF00439), two BAH domains (bromo-adjacent homology, PF01426), a HMG box (high mobility group, PF00505), and an anonymous carboxy-terminal domain (PFB007669). The B. malayi, C. elegans, and D. melanogaster polybromodomain (PBR) proteins also contain two C2H2 zinc fingers. PBR proteins may be involved in chromatin-remodeling complexes. Bromodomains interact with acetylated lysine in histone complexes, while HMG boxes are found in chromatin proteins that bind to single-stranded DNA and unwind double-stranded DNA. Human BAF180 has been shown to localize to the kinetochores of mitotic chromosomes [27]. None of the vertebrate PBR homologs contains zinc fingers, which may indicate additional functions for the nematode and fly proteins.

Figure 3.

Figure 3

Open in a new tab

The pbr synteny cluster and pbr homologs in other species. The genomic organization of the pbr synteny cluster in C. elegans and B. malayi, and the domain structure of the PBR homologs in Drosophila melanogaster, Gallus gallus, and Homo sapiens are illustrated. Intron/exon boundaries that are conserved between the nematodes are indicated by asterisks. White boxes represent the contiguous DNA underlying the gene models.

Two conserved genes were identified immediately upstream from pbr-1 (Figure 3). BMBAC01P19.5 (named Bm-ubr-1 (upstream of pbr-1)) showed significant similarity only to T28F4.4 from C. elegans (27% identity). The protein encoded by BMBAC01P19.4 is homologous to C. elegans T28F4.5 (30% identity). Iterative searches of GenBank using PSI-BLAST [29] indicated that BMBAC01P19.4 and T28F4.5 belong to a group of small peptides that include human DAP-1 (death-associated protein). DAP-1 is a nuclear protein and positive regulator of interferon gamma-induced apoptosis in HeLa cells [30]. PSORT profiling indicated that both nematode proteins may have a nuclear localization. BMBAC01P19.2 (Bm-pbr-1) and BMBAC01P19.5 (Bm-ubr-1) are divergently transcribed and BMABAC01P19.4 (Bm-dap-1) is found in the large third intron of BMBAC01P19.5 in the same transcriptional orientation as BMBAC01P19.2 (Figure 3). In the C. elegans instance of the PBR cluster, C26C6.1 (Ce-pbr-1) and T28F4.4 (Ce-ubr-1) are also divergently transcribed from a 1,233 bp intergenic region. The third gene, T28F4.5 (Ce-dap-1) is found in the large third intron of T28F4.4 on the same strand as C26C6.1.

Comparison of the intergenic and upstream regions of both clusters, and of the orthologous gene pairs, did not reveal any clear motifs that might be involved in transcriptional regulation. In particular, the intergenic DNA between pbr-1 and ubr-1, and the first intron of ubr-1, had less than 30% pairwise identity throughout, and there were no stretches of greater identity. The AT richness of the B. malayi genome compared to C. elegans may obscure any conserved elements. No RNA-coding genes were found. Two B. malayi ESTs matched at > 99.5% identity to two regions of BMBAC01P19 separated by 200 bp that were not predicted to be part of a transcript (see Figure 1). These regions are downstream of gene BMBAC01P19.3, and may derive from alternative 3' untranslated regions: the furthest downstream match includes a good polyadenylation site. The 3' end of the cDNA determined for this gene may have derived from internal priming from an A-rich segment of the 3' untranslated region.

Fractured synteny between the genomes of B. malayi and C. elegans

All of the C. elegans orthologs, except for Y56A3A.3 (Ce-mif-1, 41% identity to Bm-mif-1, on chromosome III), are located on chromosome I (Figure 4). F13G3.9 (Ce-mif-3, 23% identity to Bm-mif-1) is found on C. elegans chromosome I in close proximity to the orthologs of B. malayi genes BMBAC01P19.2, .4, and .5. This could suggest that our orthology assignment is wrong. As described above, however, Ce-mif-1 and Bm-mif-1 share two intron positions and are more similar to each other than either is to Ce-mif-3, which has one concordant intron position, and one discordant intron position. The conflict between location and structure could be due to a gene-conversion event in either lineage, or an event of directed movement or insertion.

Figure 4.

Figure 4

Open in a new tab

Comparison of linkage and synteny with C. elegans. The B. malayi contig is compared to an approximately 9 Mb segment of C. elegans chromosome I. The relative positions of the ortholog pairs, colored as in Figure 1, are indicated. The link between Bm-mif-1 and Ce-mif-3 (F13G3.9) is dashed to indicate that these two genes are paralogs rather than orthologs (see text for details).

Eight of the 10 remaining C. elegans orthologs lay within a 2.3 Mb region in the center of chromosome I (6.7-9 Mb) (Figure 4). The orthologs of the other two genes (BMBACoLo3.4 and BMBAC01P19.6) are found at the distal tip of chromosome I. While there has been extensive rearrangement of gene order, when compared to the C. elegans orthologs, 10 of the B. malayi genes were in the same relative transcriptional orientation. Examination of the boundaries of the C. elegans cluster and individual gene regions did not show any association with repeat-sequence classes, including those shown to be commonly associated with rearrangements between C. elegans and C. briggsae [6].

Genome survey sequence comparison and synteny

To ascertain whether the segment sequenced was representative of the relationship between the B. malayi genome and that of C. elegans, we surveyed the B. malayi BAC-end derived genome survey sequences (GSSs; J. Daub, C. Whitton, N.H., M. Quail and M.L.B., unpublished observations). There are over 18,000 GSSs from B. malayi, derived from three independent libraries. Each BAC-end sequence was compared to the C. elegans proteome (Wormpep [31]) and significant similarities recorded (BLASTX probabilities < e-8). The chromosomal position of each matching C. elegans protein was derived from Wormbase [32]. One hundred and sixty-four BACs had matches at both ends to C. elegans proteins under these conditions (summarized in Table 2, details in Table 3). We note that these matches are not necessarily to orthologs, as we have not carried out intensive analysis of each one, but random selection of genes should not yield greater linkage estimation despite the problem of gene families and domain matches. While much of the C. elegans proteome consists of protein families, very few of these have a chromosomally restricted distribution [33,34].

Table 2.

Synteny conservation between B. malayi BAC-end genome survey sequences and C. elegans genome sequence

Maximal probability of either of blast matches Number of BACs with both ends matching C. elegans proteins Number of BACs with both ends matching C. elegans proteins on the same chromosome Distance between C. elegans proteins (megabases) Percentage of matches on same chromosome
<e-8 164 90 4.4 54.88
<e-10 138 78 4.6 56.52
<e-15 51 29 4.7 56.86
<e-20 17 10 5.3 58.82
Open in a new tab

B. malayi BAC end sequences were compared to the C. elegans proteome using BLASTX. Matches with a probability <e-8 were noted, and chromosomal positions determined from WormBase. Of 2,200 BACs with matches, 164 had matches to both ends.

Table 3.

B. malayi BAC end comparisons to C. elegans

T7 end SP6 end
Brugia malayi BAC clone C. elegans match C. elegans chromosome Position on chromosome Exponent of probability in BLAST search C. elegans match C. elegans chromosome Position on chromosome Exponent of probability in BLAST search Distance between matches
BMBAC01M03 CE27661 IV 7844080 18 CE03144 II 11592445 30 NA
BMBAC01I11 CE12826 II 2125627 24 CE27131 X 12434210 12 NA
BMBAC01O12 CE12384 IV 11536217 21 CE24899 X 10540216 13 NA
BMBAC01I15 CE07931 X 1138520 11 CE00450 III 7926986 9 NA
BMBAC01F17 CE06551 V 11711418 18 CE00946 III 4668338 18 NA
BMBAC01F18 CE06551 V 11711418 18 CE00946 III 4668338 18 NA
BMBAC03I06 CE04396 X 4702371 12 CE01008 III 3436926 17 NA
BMBAC03F12 CE22809 IV 10961452 9 CE28366 V 2688438 15 NA
BMBAC03O15 CE29604 I 10151104 24 CE08947 V 11984722 10 NA
BMBAC03F17 CE00316 III 9821062 22 CE14390 V 6500809 8 NA
BMBAC03J17 CE20445 IV 3562754 23 CE15856 II 13201660 9 NA
BMBAC04M12 CE14750 I 4619453 9 CE17599 V 14520036 11 NA
BMBAC04B14 CE26776 IV 2800306 36 CE03447 X 10583738 36 NA
BMBAC04B18 CE01099 III 9303554 45 CE16711 V 18449410 43 NA
BMBAC06B01 CE15044 V 4304442 23 CE26600 I 1494247 10 NA
BMBAC07G03 CE07756 II 3032776 9 CE13435 I 6135032 20 NA
BMBAC08D11 CE22116 II 14151234 16 CE17662 I 9188977 19 NA
BMBAC08E17 CE18356 I 3663582 17 CE24671 X 1800708 13 NA
BMBAC09F11 CE08682 I 4162592 13 CE08947 V 11984722 10 NA
BMBAC09K18 CE26381 IV 7210081 26 CE27040 III 1491791 12 NA
BMBAC09A22 CE24671 X 1800708 38 CE14734 II 1143941 33 NA
BMBAC10N08 CE14734 II 1143941 29 CE11078 X 14666566 18 NA
BMBAC11P11 CE18826 I 12580986 63 CE01074 III 4761237 39 NA
BMBAC301H09 CE00436 III 8966904 15 CE03397 II 10033351 10 NA
BMBAC303G12 CE25661 X 10088725 12 CE28910 IV 12096051 37 NA
BMBAC305D10 CE05811 IV 12222786 10 CE26022 I 13790068 13 NA
BMBAC306C12 CE19038 II 12001566 10 CE17716 V 5828441 25 NA
BMBAC307F09 CE26106 III 11214188 14 CE24397 I 398952 12 NA
BMBAC308B07 CE01495 III 4243241 9 CE23997 I 4301621 52 NA
BMBAC308E07 CE10254 V 8596497 16 CE22541 IV 1058851 39 NA
BMBAC309G05 CE19946 V 13652193 10 CE20405 I 10121170 21 NA
BMBAC310G03 CE00169 III 8560276 16 CE03487 IV 11101538 20 NA
BMBAC310F07 CE26106 III 11214188 20 CE17565 I 12897554 9 NA
BMBAC311D10 CE05492 IV 9045220 11 CE09323 I 8357446 11 NA
BMBAC312B12 CE03263 X 12785597 11 CE20461 II 11358344 28 NA
BMBAC314G02 CE04726 X 7500571 15 CE16564 III 10779508 14 NA
BMBAC314G05 CE04726 X 7500571 15 CE16564 III 10779508 14 NA
BMBAC314C06 CE14448 V 8303220 13 CE25695 III 7697801 23 NA
BMBAC321E09 CE00901 III 3777196 28 CE04196 IV 7171873 27 NA
BMBAC324A05 CE23883 X 10640426 10 CE24718 IV 9708837 15 NA
BMBAC325E11 CE24076 IV 16170439 27 CE20681 III 3942090 19 NA
BMBAC327E05 CE29377 II 14249402 21 CE05190 I 7147729 9 NA
BMBAC328H12 CE11268 I 6056251 27 CE20346 IV 359584 33 NA
BMBAC331C11 CE00639 III 10524644 12 CE07306 V 8110632 39 NA
BMBAC332H10 CE03812 X 11374102 41 CE03398 II 10030927 18 NA
BMBAC335D03 CE00713 III 6820989 37 CE26022 I 13790068 10 NA
BMBAC335B06 CE03657 X 12880838 36 CE28110 II 12072195 15 NA
BMBAC335H06 CE04374 III 7093735 29 CE27906 II 7218339 12 NA
BMBAC335B11 CE28095 II 6474361 11 CE12664 IV 10627077 9 NA
BMBAC335G11 CE14211 II 526662 12 CE00644 III 4417152 9 NA
BMBAC338H04 CE21000 I 3609203 39 CE01643 II 8066397 57 NA
BMBAC340C01 CE08947 V 11984722 12 CE06100 I 7963691 10 NA
BMBAC340H10 CE24671 X 1800708 28 CE28961 II 8518425 11 NA
BMBAC341A06 CE24422 II 15153828 10 CE26560 IV 2637785 14 NA
BMBAC341H09 CE20297 I 10962692 19 CE07462 X 16821321 18 NA
BMBAC342D11 CE27040 III 1491791 14 CE11074 X 14645097 11 NA
BMBAC352C10 CE00713 III 6820989 44 CE26022 I 13790068 18 NA
BMBAC353A03 CE00949 III 4694946 10 CE06100 I 7963691 18 NA
BMBAC353E06 CE09682 IV 17269732 48 CE02716 II 4609014 10 NA
BMBAC354G08 CE24000 X 13899761 16 CE21401 I 12747957 34 NA
BMBAC354C09 CE16562 III 10808992 23 CE17579 IV 1178045 9 NA
BMBAC355C03 CE04838 IV 7225306 12 CE21023 I 2496034 24 NA
BMBAC356B08 CE06116 V 10355247 11 CE26971 I 311402 14 NA
BMBAC357C02 CE14754 I 4624187 24 CE19593 III 867498 12 NA
BMBAC360E07 CE06034 IV 11733052 15 CE02044 II 6736839 11 NA
BMBAC362E03 CE05492 IV 9045220 11 CE28001 III 6020770 16 NA
BMBAC365D07 CE15463 IV 12871709 16 CE01508 II 11384821 12 NA
BMBAC365F09 CE15612 V 10250527 10 CE05747 IV 12401915 20 NA
BMBAC365D11 CE15892 I 13091093 13 CE28340 III 13328281 9 NA
BMBAC368B08 CE21026 X 8125574 15 CE09880 I 8898846 16 NA
BMBAC374G02 CE24292 II 12681620 11 CE06704 IV 5987165 18 NA
BMBAC375H10 CE01537 II 9588260 15 CE04726 X 7500571 15 NA
BMBAC376D04 CE02705 II 5918674 9 CE29504 IV 4212960 17 NA
BMBAC377D05 CE03061 X 12966730 14 CE15044 V 4304442 10 NA
BMBAC01G04 CE12942 II 163142 12 CE15754 II 13443071 19 13279929
BMBAC01J11 CE17559 III 3729721 13 CE27691 III 6439903 14 2710182
BMBAC01N16 CE19942 II 6157856 20 CE01090 II 7858336 15 1700480
BMBAC01A23 CE27862 I 4952222 8 CE16340 I 13239686 8 8287464
BMBAC01M24 CE02307 II 10222779 15 CE04813 II 4902586 25 5320193
BMBAC02F03 CE01008 III 3436926 30 CE02018 III 5268852 17 1831926
BMBAC02M10 CE18369 IV 14965985 26 CE27782 IV 32953 13 14933032
BMBAC03D10 CE01563 II 10146750 11 CE18563 II 14006392 10 3859642
BMBAC03L15 CE27488 IV 2976034 13 CE20122 IV 12679870 30 9703836
BMBAC03O17 CE27311 III 1616853 13 CE00946 III 4668338 20 3051485
BMBAC03J24 CE21971 II 12727192 17 CE22157 II 13670692 12 943500
BMBAC04P08 CE17474 IV 8034836 13 CE06702 IV 5987165 37 2047671
BMBAC04J10 CE17474 IV 8034836 12 CE06702 IV 5987165 35 2047671
BMBAC04G15 CE03492 III 10465212 14 CE01161 III 5016428 29 5448784
BMBAC04L18 CE26381 IV 7210081 23 CE06302 IV 10375062 23 3164981
BMBAC06H01 CE16413 V 11222884 11 CE08630 V 4818967 13 6403917
BMBAC07C02 CE13736 I 5616992 9 CE18454 I 7384257 27 1767265
BMBAC07C06 CE28324 X 4830732 21 CE23711 X 14708595 24 9877863
BMBAC07E21 CE16194 III 10818631 33 CE26632 III 12724299 46 1905668
BMBAC07C22 CE16565 III 10784128 12 CE17401 III 3778796 16 7005332
BMBAC08P03 CE27215 X 6626852 21 CE09403 X 4445872 16 2180980
BMBAC09E01 CE25011 III 7031238 12 CE24009 III 4722390 10 2308848
BMBAC09B17 CE25196 II 2913916 15 CE18730 II 11578670 11 8664754
BMBAC09E19 CE22045 III 11317051 12 CE20681 III 3942090 23 7374961
BMBAC09J20 CE27601 IV 3694675 13 CE17308 IV 3625656 9 69019
BMBAC09A24 CE04504 IV 8315582 37 CE29005 IV 6345808 12 1969774
BMBAC10M23 CE01473 II 8023190 13 CE28454 II 5867637 17 2155553
BMBAC11H08 CE11494 II 10872814 20 CE03412 II 11545610 17 672796
BMBAC11K08 CE28485 IV 16845895 21 CE06705 IV 5987165 45 10858730
BMBAC11C09 CE21401 I 12747957 12 CE08532 I 3704246 13 9043711
BMBAC11H20 CE08377 I 10117043 20 CE17566 I 12903800 16 2786757
BMBAC13A23 CE29235 II 6995861 10 CE23659 II 13251947 19 6256086
BMBAC301F09 CE28770 V 7400098 9 CE06116 V 10355247 13 2955149
BMBAC303H10 CE18123 X 10768551 12 CE04392 X 5627431 15 5141120
BMBAC303E12 CE01105 III 3992607 28 CE05066 III 6081444 39 2088837
BMBAC306B02 CE19437 IV 1935178 12 CE06634 IV 11985224 30 10050046
BMBAC306F02 CE21208 V 11417176 9 CE15044 V 4304442 46 7112734
BMBAC306B09 CE05594 IV 11574005 10 CE18268 IV 262009 12 11311996
BMBAC309A07 CE27186 II 1490131 20 CE20311 II 14794131 18 13304000
BMBAC309H07 CE15235 I 6586100 12 CE15751 I 8715988 13 2129888
BMBAC311C01 CE26713 X 10830672 11 CE05839 X 14719098 16 3888426
BMBAC312B02 CE23530 II 9886945 21 CE05732 II 9892692 9 5747
BMBAC318E08 CE03335 II 9006072 32 CE01731 II 10094778 33 1088706
BMBAC320B05 CE24687 I 13505250 32 CE10608 I 5535918 18 7969332
BMBAC321D05 CE03487 IV 11101538 12 CE06601 IV 12361570 12 1260032
BMBAC323H11 CE28173 II 7045967 12 CE03349 II 8811285 12 1765318
BMBAC326G05 CE18454 I 7384257 16 CE19979 I 14650506 17 7266249
BMBAC327F03 CE05372 I 8656418 20 CE17767 I 14934285 15 6277867
BMBAC327E08 CE22135 II 13280025 18 CE03397 II 10033351 14 3246674
BMBAC329E10 CE26424 III 7268168 10 CE26172 III 2584463 13 4683705
BMBAC333B09 CE06291 III 9853062 21 CE00018 III 9542362 18 310700
BMBAC335G07 CE23108 V 18907704 25 CE08145 V 7207535 24 11700169
BMBAC336F09 CE23823 V 904798 12 CE08939 V 10165831 10 9261033
BMBAC338B09 CE19930 IV 11494578 12 CE27358 IV 12787708 12 1293130
BMBAC339A05 CE03536 X 11156821 19 CE29169 X 15581083 10 4424262
BMBAC340B12 CE28433 V 12591291 11 CE06114 V 10352190 21 2239101
BMBAC341B01 CE06362 IV 11131027 28 CE17284 IV 507058 10 10623969
BMBAC344B10 CE27691 III 6439903 9 CE18868 III 13830997 16 7391094
BMBAC345G11 CE16052 III 13507164 17 CE01319 III 7408460 22 6098704
BMBAC346C07 CE20899 III 9066807 42 CE06204 III 10983239 9 1916432
BMBAC348D09 CE27859 X 4671617 13 CE03447 X 10583738 14 5912121
BMBAC349D02 CE28454 II 5867637 30 CE01473 II 8023190 15 2155553
BMBAC349A03 CE01694 II 9647841 22 CE01697 II 9649394 30 1553
BMBAC350E01 CE05839 X 14719098 31 CE28227 X 10830175 11 3888923
BMBAC350F06 CE07421 IV 7521267 17 CE17427 IV 606450 11 6914817
BMBAC351D02 CE17559 III 3729721 37 CE29455 III 7295192 14 3565471
BMBAC351E11 CE04813 II 4902586 15 CE01843 II 6318128 9 1415542
BMBAC352A02 CE16057 X 9835707 16 CE23711 X 14708595 13 4872888
BMBAC352H11 CE27011 III 2386289 22 CE23035 III 12323434 40 9937145
BMBAC354D02 CE09506 V 13767614 15 CE26193 V 7064763 11 6702851
BMBAC354C06 CE28000 V 5680455 19 CE18785 V 14010680 10 8330225
BMBAC357F01 CE07705 I 5160615 15 CE17689 I 7197186 12 2036571
BMBAC357D06 CE05481 V 9909478 10 CE18731 V 12911699 11 3002221
BMBAC360G09 CE26686 V 19889249 20 CE12204 V 12228547 13 7660702
BMBAC361F02 CE21971 II 12727192 15 CE24422 II 15153828 14 2426636
BMBAC364D04 CE19878 IV 13020730 47 CE12664 IV 10627077 24 2393653
BMBAC364D12 CE05066 III 6081444 36 CE01648 III 10372177 11 4290733
BMBAC365G04 CE27551 I 1567610 19 CE09340 I 9956916 15 8389306
BMBAC367E09 CE29511 III 7551909 19 CE28049 III 10232451 11 2680542
BMBAC369F08 CE20121 IV 12674275 12 CE06362 IV 11131027 44 1543248
BMBAC370D08 CE09762 IV 3867451 19 CE17122 IV 7994133 17 4126682
BMBAC372C01 CE06239 I 8521548 15 CE16055 I 10289506 13 1767958
BMBAC372A05 CE23035 III 12323434 18 CE27402 III 5842056 15 6481378
BMBAC372F06 CE29472 III 5231760 15 CE00100 III 8521627 9 3289867
BMBAC372A09 CE00872 III 4156692 10 CE20934 III 3133584 18 1023108
BMBAC373F04 CE09880 I 8898846 12 CE06511 I 7477616 19 1421230
BMBAC374E02 CE00946 III 4668338 10 CE03076 III 3936413 20 731925
BMBAC374F12 CE21847 IV 1757609 21 CE06364 IV 11128632 11 9371023
BMBAC375A04 CE25585 IV 6754827 12 CE04562 IV 7326282 11 571455
BMBAC375F12 CE22210 V 14353297 17 CE21224 V 7077544 16 7275753
Open in a new tab

Clones with significant matches at both ends. NA, not applicable.

C. elegans has six chromosomes. Under a minimal model, if a genome rearrangement were equally likely to involve a between-chromosome as a within-chromosome event, and was only dependent on the length of DNA in the within-chromosome versus not-within-chromosome classes, we would expect approximately five of every six rearrangements to involve between-chromosome events and one-sixth to involve within-chromosome events. This model ignores the fact that B. malayi has only five chromosome pairs: four autosomes and one XY pair. The derivation of the two karyotypes is unknown, and cannot be deduced from phylogenetic comparisons (see [35]). While most nematodes of clade V have six chromosomes like C. elegans, other taxa in the Secernentea have from one to > 100 [36]. If we assume that the C. elegans complement derives from splitting of an ancestral chromosome retained in B. malayi, the expectation would be that 20% of rearrangements would be within-chromosome.

Many more BACs had significantly more ends mapping to the same chromosome than would be expected under these models (approximately 55%, χ2 test p < 0.01 for all comparisons in Table 2 under the above model). The mean distance between the C. elegans matches was 4.4 Mb, which may be compared to an expected approximately 45 kb for the separation between the B. malayi BAC ends.

Discussion

B. malayi is a human parasite only distantly related to the model nematode C. elegans [14,37]; therefore, genome comparisons between these species will yield data concerning longer-term changes in structure and function that cannot be derived from within-genus comparisons. In the 83 kb of genomic DNA flanking the B. malayi mif-1 locus we found a fractured conservation of microsynteny between the two nematode genomes, and conservation of linkage. Twelve protein-coding genes were predicted, and 11 of these had putative orthologs in the C. elegans genome. Ten of these orthologs were on C. elegans chromosome I, with eight in a 2.3 Mb segment in the center of the chromosome and two at the distal tip of chromosome I. Some of these genes have remained tightly linked in the same or slightly modified relative transcriptional orientations in both species.

This pattern, of conservation of linkage with disruption of precise synteny, was confirmed using BAC-end sequences. Of the 171 clones with matches at both ends to C. elegans genes, over 55% were localized to the same chromosome in C. elegans. While the mean distance separating the B. malayi genes is 45 kb (the length of the BAC clones; [38] and C. Whitton and M.L.B., unpublished work), the mean distance between the matching C. elegans genes is approximately 4.4 Mb.

The 83 kb fragment of B. malayi genomic DNA is the largest contiguated portion of sequenced genomic DNA from a non-rhabditid nematode described to date. A large proportion (around 60%) of genes identified in the B. malayi EST dataset (23,000 ESTs corresponding to around 8,300 unique transcripts [39]) have no close C. elegans homologue [16]. In this study, however, C. elegans orthologs were identified for 11 of the 12 identified B. malayi genes. Some of these orthologous pairs were confirmed by congruence in length of open reading frame and shared intron positions, despite low pairwise identity. Global searches with ESTs would not have detected these pairs (BLAST probability values of approximately e-4), and thus the true proportion of B. malayi unique genes is likely to be less than 60%. B. malayi genes were found to have larger and more numerous introns than C. elegans genes (2.2 times longer and 1.7 times more frequent), in keeping with previous estimates made using data from several highly expressed genes [40]. If the contig is representative and gene complement is equivalent to C. elegans, the B. malayi genome may be larger (120-140 Mb) than estimated previously (100 Mb [41]). Four of seven genes confirmed by reverse transcriptase PCR had alternative transcripts, a figure consistent with C. elegans EST and cDNA projects [42]. Additionally, five genes had B. malayi EST matches, a proportion congruent with the estimate that the EST program has identified around 40% of the expected 20,000 B. malayi genes [16].

Conserved linkage between the genomes of closely related eukaryotic organisms has been shown in several taxa. But it is only recently, with the sequencing of discrete segments or whole genomes, that examples of conservation of microsynteny between the genomes of distantly related species (not involving functionally related genes) have been described [43,44]. The microsyntenic gene clusters retained between C. elegans and B. malayi do not fall into any clear functional categories. However, all genes contained in the second cluster (BMBAC01P19.2, .4, and .5) are predicted to have nuclear localization signals and could be co-regulated. Alternatively, promoters or cis-acting regulatory elements required for their proper function could be embedded within other cluster members. Interdigitation of these regulatory elements could be constraining the movement of genes away from this cluster. No conserved motifs were found, however, and this possibility can thus only be tested by transgenesis experiments. This phenomenon has been observed in other systems such as fungal genomes, where gene pairs predicted to have overlapping regulatory elements are more likely to be conserved between species [45].

Many genes in C. elegans are co-transcribed in operons [46,47] and this could constrain synteny breakage. The C. elegans orthologs of BMBAC01L03.5 and BMBAC01P19.3 are separated by 501 bp, an intergenic distance found in other C. elegans operons, and the downstream gene (Ce-F43G9.4) was shown to be trans-spliced to the SL2 spliced leader, a feature of downstream genes in C. elegans operons [47]. However, in B. malayi, BMBAC01L03.5 and BMBAC01P19.3 are separated by 2.8 kb, which is outside the range of operon intergenic spacing. The functions of C. elegans genes on chromosome I have been investigated by RNA-mediated interference and a phenotype was identified for one gene in each cluster: embryonic lethality (F39G4.5 [48]) and altered adult morphology (C26C6.1 [49]). Therefore, it is possible that the clusters are conserved because removing other members would interfere with functions of these essential genes. The one exception to the conservation of linkage is the Bm-mif-1/Ce-mif-1 ortholog pair. Another C. elegans MIF homolog, Ce-mif-3, is found in close proximity to the genes in the pbr-1 synteny cluster, raising the possibility that a gene-conversion event may have obscured orthology assignment for this gene.

In the Metazoa, long-range synteny between the genomes of distantly related species (>300 Myr divergence) has only been identified previously in vertebrates (teleost fish and humans [50,51]). In vertebrates, interchromosomal exchanges seem to be rare events, and some linkage groups, such as human chromosomes 6 and X, are conserved across most eutherian mammals [7]. From the analyses presented here we can suggest some general patterns of gene rearrangement in nematodes. Most of the C. elegans orthologs were located in a small segment of chromosome I (nine of eleven genes in 2.3 Mb or 16% of the chromosome), suggesting that local intrachromosomal inversions or rearrangements have occurred more frequently than long-range intrachromosomal, or interchromosomal rearrangements. This is consistent with patterns observed in closely related dipterans, where the composition of linkage groups is conserved but not the order within the chromosome. Mechanistically this may occur because intrachromosomal rearrangements require fewer DNA breaks than interchromosomal translocations, and the nuclear scaffold may hold local chromosomal regions in closer association. The high rate of rearrangement of genes within the nematode chromosomes makes it unlikely that the positional information of genes in the Caenorhabditis genomes will be useful in finding orthologous genes in the genomes of distantly related nematodes such as B. malayi.

Materials and methods

Identification of candidate genomic clones for sequencing

A probe for Bm-mif-1 was synthesized by labeling full-length cDNA (GenBank accession U88035) with biotin (Phototope; New England Biolabs), hybridized to high-density arrays of 18,000 BAC clones containing B. malayi genomic DNA [52], and detected with the Phototope detection kit (New England Biolabs). Hybridization-positive BACs were PCR verified using gene-specific primers Bm-MIF-1.F1a (ATGCCATATTTTACGATTGATAC) and Bm-MIF-1.R1a (GAACACCATCGCTTGTCCACC) using standard reaction and cycling conditions (0.2 mM dNTPs, 1.5 mM MgCl, 0.5 pM primer; 1 cycle of 94°C for 3 min; 35 cycles of 94°C for 15 sec, 55°C for 20 sec, 72°C for 3 min; 1 cycle of 72°C for 10 min). BMBAC01P19 was selected for sequencing. Sequence from the T7 end of the insert was used to design specific primers 01P19.T7.F1 (GCAGCAAATGCTTATTTGTCTTG) and 01P19.T7.R1 (GTTTGGTGATTCATGTCCATGAGC). Primers 01P19.T7.R1 and 2BiotinBACF3 (designed to the BAC vector; (biotinU)2GAGTCGACCTGCAGGCATGC; New England BioLabs Organic Synthesis Unit) were used to synthesize a biotin-labeled end probe. The probe was hybridized to the BAC library filter using a modified hybridization and detection protocol [38]. Positive BACs were PCR verified with primers 01P19.T7.R1 and 01P19.T7.F1, and insert DNA prepared using a kit (Qiagen). BAC ends were end-sequenced using the Sanger Institute protocol [53]. BMBAC01L03 showed minimal overlap with BMBAC01P19 compared to other clones and was selected for sequencing.

Preparation, subcloning, and sequencing of BACs

The BACs were sequenced using a standard two-stage strategy involving random sequencing of subcloned DNA followed by directed sequencing to resolve problem areas. In the first stage, DNA prepared from BAC clones was shattered by sonification and fragments of 1.4-2 kb cloned into pUC18. DNA from randomly selected clones was sequenced with dye-terminator chemistry and analyzed on automated sequencers. Each BAC was sequenced to a depth of sevenfold coverage. Contigs were assembled using phrap (Phil Green, Washington University Genome Sequencing Center, unpublished). Manual base calling and finishing was carried out using Gap4 [54]. Gaps and low-quality regions were resolved by techniques such as primer walking, PCR and resequencing clones under conditions that give increased read lengths.

Sequence analysis

The finished sequences of BMBAC01P19 and BMBAC01L03 were compared to the GenBank nonredundant (nucleic acid and protein) EST database (dbEST), the C. elegans genome and protein and the custom B. malayi clustered EST [16] databases using BLAST [55,56]. GeneFinder (P. Green and L. Hillier, Washington University Genome Sequencing Center, unpublished) was trained with 162 publicly available B. malayi gene sequences and used to analyze the contiguated sequence. The sequence was annotated on the Artemis workbench [57]. Predicted protein sequences were compared to Pfam [58] and cellular localization examined using PSORTII [59]. The annotated sequence is available in GenBank (accession AL606837).

Verification of gene predictions

To confirm gene predictions from BMBAC01P19, primers were designed and PCR was carried out on oligo(dT)-primed B. malayi mixed adult first-strand cDNA with gene-specific primers. To isolate cDNA ends, the GeneRacer 3' RACE primer (Invitrogen) (GCTGTCAACGATACGCTACGTAACGGCATGACAGTG), or the nematode SL1 sequence (GGTTTAATTACCCAAGTTTGAG) were used with specific primers. Secondary PCRs were carried out using nested primers and 2% of the primary PCR product. Positive PCR products were cloned and sequenced.

BAC-end sequence analysis

The B. malayi BAC-end sequence dataset was compared to the C. elegans proteome in Wormpep. Significant matches were filtered, and BAC clones having matches on both ends retained. The chromosomal position of the C. elegans genes was determined from [32].

Acknowledgments

Acknowledgements

We thank the Filarial Genome Project for the B. malayi BAC library and clones, Yvonne Harcus, Janice Murray, William Gregory, and Rick Maizels for B. malayi materials, Jen Daub and Claire Whitton for BAC-end analysis, Dan Lawson for help with C. elegans genome queries, and New England BioLabs for reagents. Funding for this work was provided by the Medical Research Council. We acknowledge the support and hard work of sequencing team 14 at the Sanger Institute.

References

  1. Hentschel CC, Birnstiel ML. The organization and expression of histone gene families. Cell. 1981;25:301–313. doi: 10.1016/0092-8674(81)90048-9. [DOI] [PubMed] [Google Scholar]
  2. Ferrier DE, Holland PW. Ancient origin of the Hox gene cluster. Nat Rev Genet. 2001;2:33–38. doi: 10.1038/35047605. [DOI] [PubMed] [Google Scholar]
  3. Litman GW, Rast JP, Shamblott MJ, Haire RN, Hulst M, Roess W, Litman RT, Hinds-Frey KR, Zilch A, Amemiya CT. Phylogenetic diversification of immunoglobulin genes and the antibody repertoire. Mol Biol Evol. 1993;10:60–72. doi: 10.1093/oxfordjournals.molbev.a040000. [DOI] [PubMed] [Google Scholar]
  4. Ohta Y, Okamura K, McKinney EC, Bartl S, Hashimoto K, Flajnik MF. Primitive synteny of vertebrate major histocompatibility complex class I and class II genes. Proc Natl Acad Sci USA. 2000;97:4712–4717. doi: 10.1073/pnas.97.9.4712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ranz JM, Casals F, Ruiz A. How malleable is the eukaryotic genome? Extreme rate of chromosomal rearrangement in the genus Drosophila. Genome Res. 2001;11:230–239. doi: 10.1101/gr.162901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Coghlan A, Wolfe KH. Fourfold faster rate of genome rearrangement in nematodes than in Drosophila. Genome Res. 2002;12:857–867. doi: 10.1101/gr.172702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. O'Brien SJ, Menotti-Raymond M, Murphy WJ, Nash WG, Wienberg J, Stanyon R, Copeland NG, Jenkins NA, Womack JE, Marshall Graves JA. The promise of comparative genomics in mammals. Science. 1999;286:458–462. doi: 10.1126/science.286.5439.458. [DOI] [PubMed] [Google Scholar]
  8. Fulton RE, Salasek ML, DuTeau NM, Black WCT. SSCP analysis of cDNA markers provides a dense linkage map of the Aedes aegypti genome. Genetics. 2001;158:715–726. doi: 10.1093/genetics/158.2.715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kent WJ, Zahler AM. Conservation, regulation, synteny, and introns in a large-scale C. briggsae-C. elegans genomic alignment. Genome Res. 2000;10:1115–1125. doi: 10.1101/gr.10.8.1115. [DOI] [PubMed] [Google Scholar]
  10. Caceres M, Ranz JM, Barbadilla A, Long M, Ruiz A. Generation of a widespread Drosophila inversion by a transposable element. Science. 1999;285:415–418. doi: 10.1126/science.285.5426.415. [DOI] [PubMed] [Google Scholar]
  11. Caceres M, Puig M, Ruiz A. Molecular characterization of two natural hotspots in the Drosophila buzzatii genome induced by transposon insertions. Genome Res. 2001;11:1353–1364. doi: 10.1101/gr.174001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Thomas WK, Wilson AC. Mode and tempo of molecular evolution in the nematode caenorhabditis: cytochrome oxidase II and calmodulin sequences. Genetics. 1991;128:269–279. doi: 10.1093/genetics/128.2.269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. The C. elegans Sequencing Consortium Genome sequence of the nematode C. elegans: a platform for investigating biology. Science. 1998;282:2012–2018. doi: 10.1126/science.282.5396.2012. [DOI] [PubMed] [Google Scholar]
  14. Vanfleteren JR, Van de Peer Y, Blaxter ML, Tweedie SA, Trotman C, Lu L, Van Hauwaert ML, Moens L. Molecular genealogy of some nematode taxa as based on cytochrome c and globin amino acid sequences. Mol Phylogenet Evol. 1994;3:92–101. doi: 10.1006/mpev.1994.1012. [DOI] [PubMed] [Google Scholar]
  15. McReynolds LA, DeSimone SM, Williams SA. Cloning and comparison of repeated DNA sequences from the human filarial parasite Brugia malayi and the animal parasite Brugia pahangi. Proc Natl Acad Sci USA. 1986;83:797–801. doi: 10.1073/pnas.83.3.797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Blaxter M, Daub J, Guiliano DB, Parkinson J, Whitton C, Project FG. The Brugia malayi genome project: expressed sequence tags and gene discovery. Trans Roy Soc Trop Med Hyg. 2001. [DOI] [PubMed]
  17. Williams SA, Lizotte-Waniewski MR, Foster J, Guiliano D, Daub J, Scott AL, Slatko B, Blaxter ML. The filarial genome project: analysis of the nuclear, mitochondrial and endosymbiont genomes of Brugia malayi. Int J Parasitol. 2000;30:411–419. doi: 10.1016/s0020-7519(00)00014-x. [DOI] [PubMed] [Google Scholar]
  18. Meyer BJ. Sex determination and X chromosome dosage compensation. In: Riddle DL, Blumenthal T, Meyer BJ, Priess JR, editor. In C elegans II. Plainview, New York: Cold Spring Harbor Laboratory Press; 1997. pp. 209–240. [PubMed] [Google Scholar]
  19. Sakaguchi Y, Tada I, Ash LR, Aoki Y. Karyotypes of Brugia pahangi and Brugia malayi (Nematoda: Filaroidea). J Parasitol. 1983;69:1090–1093. [PubMed] [Google Scholar]
  20. Pastrana DV, Raghavan N, FitzGerald P, Eisinger SW, Metz C, Bucala R, Schleimer RP, Bickel C, Scott AL. Filarial nematode parasites secrete a homologue of the human cytokine macrophage migration inhibitory factor. Infect Immun. 1998;66:5955–5963. doi: 10.1128/iai.66.12.5955-5963.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Stec I, Wright TJ, van Ommen GJ, de Boer PA, van Haeringen A, Moorman AF, Altherr MR, den Dunnen JT. WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma. Hum Mol Genet. 1998;7:1071–1082. doi: 10.1093/hmg/7.7.1071. [DOI] [PubMed] [Google Scholar]
  22. Stec I, Nagl SB, van Ommen GJ, den Dunnen JT. The PWWP domain: a potential protein-protein interaction domain in nuclear proteins influencing differentiation? FEBS Lett. 2000;473:1–5. doi: 10.1016/s0014-5793(00)01449-6. [DOI] [PubMed] [Google Scholar]
  23. Nishihira J. Macrophage migration inhibitory factor (MIF): its essential role in the immune system and cell growth. J Interferon Cytokine Res. 2000;20:751–762. doi: 10.1089/10799900050151012. [DOI] [PubMed] [Google Scholar]
  24. Falcone FH, Loke P, Zang X, MacDonald AS, Maizels RM, Allen JE. A Brugia malayi homolog of macrophage migration inhibitory factor reveals an important link between macrophages and eosinophil recruitment during nematode infection. J Immunol. 2001;167:5348–5354. doi: 10.4049/jimmunol.167.9.5348. [DOI] [PubMed] [Google Scholar]
  25. Marson AL, Tarr DEK, Scott AL. Macrophage migration inhibitory (mif) transcription is significantly elevated in Caenorhabditis elegans dauer larvae. Gene. 2001;278:53–62. doi: 10.1016/s0378-1119(01)00706-5. [DOI] [PubMed] [Google Scholar]
  26. Kleemann R, Rorsman H, Rosengren E, Mischke R, Mai NT, Bernhagen J. Dissection of the enzymatic and immunologic functions of macrophage migration inhibitory factor. Full immunologic activity of N-terminally truncated mutants. Eur J Biochem. 2000;267:7183–7193. doi: 10.1046/j.1432-1327.2000.01823.x. [DOI] [PubMed] [Google Scholar]
  27. Xue Y, Canman JC, Lee CS, Nie Z, Yang D, Moreno GT, Young MK, Salmon ED, Wang W. The human SWI/SNF-B chromatin-remodeling complex is related to yeast rsc and localizes at kinetochores of mitotic chromosomes. Proc Natl Acad Sci USA. 2000;97:13015–13020. doi: 10.1073/pnas.240208597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nicolas RH, Goodwin GH. Molecular cloning of polybromo, a nuclear protein containing multiple domains including five bromodomains, a truncated HMG-box, and two repeats of a novel domain. Gene. 1996;175:233–240. doi: 10.1016/0378-1119(96)82845-9. [DOI] [PubMed] [Google Scholar]
  29. Altschul SF, Koonin EV. Iterated profile searches with PSI-BLAST-a tool for discovery in protein databases. Trends Biochem Sci. 1998;23:444–447. doi: 10.1016/s0968-0004(98)01298-5. [DOI] [PubMed] [Google Scholar]
  30. Deiss LP, Feinstein E, Berissi H, Cohen O, Kimchi A. Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the gamma interferon-induced cell death. Genes Dev. 1995;9:15–30. doi: 10.1101/gad.9.1.15. [DOI] [PubMed] [Google Scholar]
  31. Wormpep http://www.sanger.ac.uk/Projects/C_elegans/wormpep
  32. WormBase http://www.wormbase.org/
  33. Friedman R, Hughes AL. Gene duplication and the structure of eukaryotic genomes. Genome Res. 2001;11:373–381. doi: 10.1101/gr.155801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lespinet O, Wolf YI, Koonin EV, Aravind L. The role of lineage-specific gene family expansion in the evolution of eukaryotes. Genome Res. 2002;12:1048–1059. doi: 10.1101/gr.174302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Blaxter ML. Genes and genomes of Necator americanus and related hookworms. Int J Parasitol. 2000;30:347–355. doi: 10.1016/s0020-7519(99)00198-8. [DOI] [PubMed] [Google Scholar]
  36. Walton AC. Some parasites and their chromosomes. J Parasitol. 1959;45:1–20. [PubMed] [Google Scholar]
  37. Blaxter ML, De Ley P, Garey JR, Liu LX, Scheldeman P, Vierstraete A, Vanfleteren JR, Mackey LY, Dorris M, Frisse LM, et al. A molecular evolutionary framework for the phylum Nematoda. Nature. 1998;392:71–75. doi: 10.1038/32160. [DOI] [PubMed] [Google Scholar]
  38. Foster JM, Kamal IH, Daub J, Swan MC, Ingram JR, Ganatra M, Ware J, Guiliano D, Aboobaker A, Moran L, et al. Hybridization to high-density filter arrays of a Brugia malayi BAC library with biotinylated oligonucleotides and PCR products. Biotechniques. 2001;30:1216–1218. doi: 10.2144/01306bm06. [DOI] [PubMed] [Google Scholar]
  39. Parkinson J, Whitton C, Guiliano D, Daub J, Blaxter ML. 200,000 nematode ESTs on the net. Trends Parasitol. 2001;17:394–396. doi: 10.1016/s1471-4922(01)01954-7. [DOI] [PubMed] [Google Scholar]
  40. Zang X, Yazdanbakhsh M, Jiang H, Kanost MR, Maizels RM. A novel serpin expressed by blood-borne microfilariae of the parasitic nematode Brugia malayi inhibits human neutrophil serine proteinases. Blood. 1999;94:1418–1428. [PubMed] [Google Scholar]
  41. Maina CV, Grandea AG, III, Tuyen LTK, Asikin N, Williams SA, McReynolds LA. Dirofilaria immitis: Genomic complexity and characterisation of a structural gene. In: MacInnis AJ, editor. In Molecular Paradigms for Eradicating Helminthic Parasites. Alan Liss: New York; 1987. pp. 193–204. [Google Scholar]
  42. Reboul J, Vaglio P, Tzellas N, Thierry-Mieg N, Moore T, Jackson C, Shin IT, Kohara Y, Thierry-Mieg D, Thierry-Mieg J, et al. Open-reading-frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nat Genet. 2001;27:332–336. doi: 10.1038/85913. [DOI] [PubMed] [Google Scholar]
  43. Brunner B, Todt T, Lenzner S, Stout K, Schulz U, Ropers HH, Kalscheuer VM. Genomic structure and comparative analysis of nine Fugu genes: conservation of synteny with human chromosome Xp22.2-p22.1. Genome Res. 1999;9:437–448. [PMC free article] [PubMed] [Google Scholar]
  44. Hamer L, Pan H, Adachi K, Orbach MJ, Page A, Ramamurthy L, Woessner JP. Regions of microsynteny in Magnaporthe grisea and Neurospora crassa. Fungal Genet Biol. 2001;33:137–143. doi: 10.1006/fgbi.2001.1286. [DOI] [PubMed] [Google Scholar]
  45. Huynen MA, Snel B, Bork P. Inversions and the dynamics of eukaryotic gene order. Trends Genet. 2001;17:304–306. doi: 10.1016/s0168-9525(01)02302-2. [DOI] [PubMed] [Google Scholar]
  46. Blumenthal T, Steward K. RNA processing and gene structure. In: Riddle DL, Blumenthal T, Meyer BJ, Priess JR, editor. In C elegans II. Plainview, New York: Cold Spring Harbor Laboratory Press; 1997. pp. 117–146. [PubMed] [Google Scholar]
  47. Blumenthal T, Evans D, Link CD, Guffanti A, Lawson D, Thierry-Mieg J, Thierry-Mieg D, Chiu WL, Duke K, Kiraly M, Kim SK. A global analysis of Caenorhabditis elegans operons. Nature. 2002;417:851–854. doi: 10.1038/nature00831. [DOI] [PubMed] [Google Scholar]
  48. Maeda I, Kohara Y, Yamamoto M, Sugimoto A. Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr Biol. 2001;11:171–176. doi: 10.1016/s0960-9822(01)00052-5. [DOI] [PubMed] [Google Scholar]
  49. Fraser AG, Kamath RS, Zipperlen P, Martinez-Campos M, Sohrmann M, Ahringer J. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature. 2000;408:325–330. doi: 10.1038/35042517. [DOI] [PubMed] [Google Scholar]
  50. Grant D, Cregan P, Shoemaker RC. Genome organization in dicots: genome duplication in Arabidopsis and synteny between soybean and Arabidopsis. Proc Natl Acad Sci USA. 2000;97:4168–4173. doi: 10.1073/pnas.070430597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Ku HM, Vision T, Liu J, Tanksley SD. Comparing sequenced segments of the tomato and Arabidopsis genomes: large-scale duplication followed by selective gene loss creates a network of synteny. Proc Natl Acad Sci USA. 2000;97:9121–9126. doi: 10.1073/pnas.160271297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Guiliano D, Ganatra M, Ware J, Parrot J, Daub J, Moran L, Brennecke H, Foster JM, Supali T, Blaxter M, et al. Chemiluminescent detection of sequential DNA hybridizations to high- density, filter-arrayed cDNA libraries: a subtraction method for novel gene discovery. Biotechniques. 1999;27:146–152. doi: 10.2144/99271rr03. [DOI] [PubMed] [Google Scholar]
  53. End sequencing protocol http://www.sanger.ac.uk/Teams/Team51/PACBACPrep.shtml
  54. Organization of the Gap4 manual http://www.mrc-lmb.cam.ac.uk/pubseq/manual/gap4_unix_1.html
  55. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  56. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, Barrell B. Artemis: sequence visualization and annotation. Bioinformatics. 2000;16:944–945. doi: 10.1093/bioinformatics/16.10.944. [DOI] [PubMed] [Google Scholar]
  58. Bateman A, Birney E, Durbin R, Eddy SR, Howe KL, Sonnhammer EL. The Pfam protein families database. Nucleic Acids Res. 2000;28:263–266. doi: 10.1093/nar/28.1.263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Nakai K, Kanehisa M. A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics. 1992;14:897–911. doi: 10.1016/S0888-7543(05)80111-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. NemBase http://www.nematodes.org/
  61. Lizotte-Waniewski M, Tawe W, Guiliano DB, Lu W, Liu J, Williams SA, Lustigman S. Identification of potential vaccine and drug target candidates by expressed sequence tag analysis and immunoscreening of Onchocerca volvulus larval cDNA libraries. Infect Immun. 2000;68:3491–3501. doi: 10.1128/iai.68.6.3491-3501.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Genome Biology are provided here courtesy of BMC

RESOURCES