Swine wastewater-cultivated Chlorella sorokiniana reduces cadmium accumulation in rice grown on contaminated paddy soil

Abstract

Cadmium (Cd) contamination in acidified paddy soils poses a major threat to rice safety and necessitates practical remediation strategies compatible with flooded rice cultivation systems. In this study, a Cd-tolerant microalgal strain, Chlorella sorokiniana T003, was isolated and evaluated for its potential to reduce Cd accumulation in rice through a microalgae-based remediation strategy integrated with swine wastewater utilization. Strain T003 maintained growth at Cd concentrations up to 25 mg L⁻¹ and removed over 90% of dissolved Cd at 5–25 mg L⁻¹, with a removal efficiency of 62% at 50 mg L⁻¹. T003 also showed robust growth in untreated swine wastewater, reaching 1.5 × 10¹¹ cells L⁻¹ after 9 d, supporting its suitability for wastewater-based biomass production. In pot experiments, application of T003 cultivated in swine wastewater increased soil pH from 5.61 to 6.60 and reduced rice shoot Cd concentration by up to 75.9% compared with the alkalized control. Field application similarly increased soil pH from 5.60 to 6.11, reduced exchangeable Cd by 49.7%, and decreased grain Cd concentrations by 72.7% and 98.7% in two rice cultivars, respectively. These findings indicate that C. sorokiniana T003 cultivated in swine wastewater can reduce Cd accumulation in rice under field conditions and may provide a biologically based strategy for Cd mitigation in acidified paddy soils while supporting nutrient recycling in crop–livestock systems.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-53386-7.

Introduction

Heavy metals pose persistent and non-degradable risks to human health due to their tendency to bioaccumulate and biomagnify along the food chain^1–4. Among them, cadmium (Cd) is a non-essential and highly toxic element that disrupts antioxidant defense systems and induces oxidative stress, ultimately leading to carcinogenesis, nephrotoxicity, and skeletal damage^1,5–7. This problem is particularly pronounced in rice (Oryza sativa L.), a staple food for over half the global population, as rice grains are a significant dietary source of Cd due to soil contamination and acidification^8–12. Field surveys in China have reported grain Cd concentrations reaching up to 3.712 mg kg⁻¹ in highly contaminated regions, substantially exceeding the national maximum limit for Cd in rice (0.2 mg kg⁻¹, GB 2762 − 2017) and the Codex Alimentarius guideline value (0.4 mg kg⁻¹), highlighting the severity of the problem¹³.

The elevated Cd content in paddy soils is primarily attributed to anthropogenic inputs, including non-ferrous metal mining and smelting, industrial emissions, sewage irrigation, and long-term application of phosphate fertilizers containing Cd impurities^8,14–18. In addition to these anthropogenic sources, geogenic background Cd derived from parent materials can also contribute locally to elevated soil Cd concentrations in certain regions. According to the 2014 national soil pollution survey released by the Ministry of Environmental Protection of China, 7.0% of surveyed farmland sites exceeded the risk screening value for Cd, with higher incidence in southern China where rice is widely cultivated (Ministry of Environmental Protection of the People’s Republic of China, 2014). Soil acidification further exacerbates Cd mobility and plant uptake. A decline in soil pH increases proton (H⁺) activity, reduces negative charge on soil colloids, weakens Cd adsorption, and shifts Cd from relatively stable fractions to more soluble and exchangeable forms^19–22; Xian and In Shokohifard, 1989). Long-term monitoring indicates that paddy soils in central subtropical China have experienced an average pH decrease of approximately 0.94 units since the 1980s^11,23. Under such conditions, even moderate total Cd concentrations can result in disproportionately high bioavailable Cd and enhanced grain accumulation. Importantly, conventional pH-adjustment strategies such as liming often provide only transient mitigation, as continuous nitrogen fertilization and acid deposition drive ongoing re-acidification, necessitating repeated applications^24,25. Similarly, biochar amendments can immobilize Cd, but their effectiveness may decline over time due to aging, surface oxidation, and changing redox conditions in flooded paddy systems^26,27. These limitations underscore the need for more sustainable and self-regulating remediation approaches.

Biological remediation strategies have gained increasing attention as environmentally compatible alternatives. In flooded paddy ecosystems, periphyton—a complex biofilm composed of microalgae, bacteria, and fungi—develops naturally at the water–soil interface and plays an active role in regulating nutrient cycling and metal dynamics. Previous studies have demonstrated that paddy periphyton can reduce Cd accumulation in rice grains by removing and immobilizing Cd from the water–soil interface^28,29. Beyond direct biosorption and bioaccumulation, microalgae can alter local physicochemical conditions. Through photosynthetic CO₂ assimilation and preferential uptake of nitrate nitrogen, microalgal growth typically increases ambient pH, thereby decreasing Cd solubility and exchangeable fractions in soil–water systems^30,31. In southern China, especially in Hunan Province, integrated crop–livestock systems are widely promoted to improve nutrient recycling efficiency. Large volumes of swine manure wastewater are commonly returned to paddy fields as liquid fertilizer. However, untreated wastewater typically contains high concentrations of organic matter and ammonium, which may introduce secondary environmental risks, including eutrophication, soil acidification, and nutrient imbalance. Therefore, developing a biological strategy capable of simultaneously valorizing swine wastewater and mitigating heavy metal risks in paddy soils is of considerable practical importance. Microalgae-based cultivation offers such potential, as microalgae can assimilate nutrients from wastewater while modifying physicochemical conditions at the water–soil interface.

Based on this framework, the present study isolated a Cd-tolerant microalgal strain, Chlorella sorokiniana T003, and evaluated its feasibility for Cd mitigation in rice paddies following cultivation in swine wastewater. In this paper, we evaluated its Cd tolerance and removal efficiency in aqueous systems, its growth performance in swine wastewater, and its effects on soil pH, Cd fraction distribution, and Cd accumulation in rice under pot and field conditions. By integrating wastewater resource utilization with Cd risk mitigation, this study proposes a biologically driven strategy tailored to flooded rice systems and provides mechanistic insight into how microalgal processes at the water–soil interface regulate heavy metal dynamics and crop safety.

Materials and methods

Isolation and identification of Cd-tolerant microalgae

To enrich Cd-tolerant microalgae, a glass beaker containing 500 mL sterile water supplemented with 20 mg L^{− 1} CdCl₂ was placed on the rooftop of the laboratory building (Yuelu District, Changsha, P.R. China) in April 2022. The beaker was exposed to ambient outdoor conditions for 30 d under natural light and temperature fluctuations (approximately 18–30 °C) and was uncovered to allow airborne microbial colonization while exposed to natural precipitation. After visible algal growth developed, the suspension was streaked onto BG11 agar plates (1% agar, pH = 7.0)³². Single colonies were repeatedly subcultured to obtain axenic isolates. Genomic DNA was extracted, and 18 S rRNA gene fragments were amplified using primers 21 F (AACCTGGTTCGATCCTGCCAGT) and 1791R (TGATCCTTCTGCAGGTTCACCTAC)³³. Molecular identification was conducted by analyzing sequence similarity using the Basic Local Alignment Search Tool (BLAST) in the public database of the National Centre for Biotechnology Information (NCBI). Based on morphologies and similarity alignment of 18 S rRNA sequences, three microalgal strains were isolated and identified. They were named Chlamydomonas T002, Chlorella sorokiniana T003 and T004.

For further Cd tolerance and removal assessments, Parachlorella kessleri T001 (isolated in our lab, 18 S rRNA sequence 100% similarity to P. kessleri strain SAG 211–11 g, FM205846.1) and C. vulgaris (FACHB-8, Freshwater Culture Collection, Wuhan, China) were used as controls. All strains were cultivated in BG11 medium under 12 h light/12 h dark at 28 °C.

Cd tolerance assay

Cd tolerance was evaluated in BG11 medium supplemented with 0, 5, 10, 25, or 50 mg L⁻¹ Cd²⁺, prepared from analytical-grade CdCl₂ stock solution dissolved in deionized water and sterilized by filtration (0.22 μm). Each treatment contained 100 mL medium in 100 mL Erlenmeyer flasks. Exponentially growing algal cultures were inoculated to an initial OD₆₈₀ of 0.05. Cultures were incubated at 28 °C on an orbital shaker (150 rpm) under a 12 h light/12 h dark cycle. Optical density at 680 nm was measured daily for the first 3 d and every 2 d thereafter until day 9.

Cd removal assay in aqueous systems

For time-course Cd removal experiments, BG11 medium containing 20 mg L⁻¹ Cd²⁺ was prepared from a 10 g L⁻¹ CdCl₂ stock solution. Microalgae were inoculated to an initial OD₆₈₀ of 0.05 in 500 mL Erlenmeyer flasks containing 500 mL culture medium. Cultures were incubated at 28 °C with shaking at 150 rpm. At 0.5, 1, 3, 6, 24, 48, and 72 h, 15 mL aliquots were collected and centrifuged at 6000 × g for 10 min. Residual Cd concentration in the supernatant was determined by flame atomic absorption spectrometry.

Cd removal of microalgae strains was further tested across varying initial Cd²⁺ concentrations (5, 10, 25, and 50 mg L^-1 in 100 mL BG11 medium). According to the time course treatments, their The residual Cd concentration stabilized after approximately 48 to 72 h, indicating that a steady-state removal level was reached under the experimental conditions. Therefore, microalgae were added to Cd²⁺ solutions to achieve the starting OD₆₈₀ value as 0.05, and then kept shaken at 150 rpm at 28 °C for three days. The residue Cd²⁺ in the supernatant was quantified by atomic absorption spectroscopy after centrifugation.

Microalgae cultivation in swine wastewater

Two C.sorokiniana strains T003 and T004 showed high tolerance to Cd stress and excellent ability of Cd biosorption. Therefore, these two strains are potential to employed as bioremediations to Cd contaminated water and paddy field. We accidently found that C. sorokiniana T003 can grow well in swine wastewater. While, the other strain C. sorokiniana T004 did not show this ability. To test that, these two strains were pre-cultivated in BG11 medium and added to 300 mL rough swine wastewater, in 500 mL flasks to make the initial OD₆₈₀ as 0.05. Swine wastewater used here were collected from a local pig farm in Hunan Province, China. Wastewater was passed through a 0.45 mm mesh filter to remove large suspended solids but was not sterilized. Their growth was evaluated from cell number counting with a hemocytometer every three days. And according to previous reports, microalgal growth in the swine wastewater can efficiently remove pollutants in the effluent³⁴. Microalgae tolerant to swine wastewater can utilize pollutants in swine wastewater to propagate. The initial COD, -N and TP of the rough swine wastewater were examined according to the protocols released by the American Public Health Association guidelines³⁵.

Microalgae-soil-rice plant treatments

To evaluate whether microalgal growth could mitigate Cd bioavailability in soil and reduce Cd accumulation in rice, we conducted pot and field experiments. Pot experiments were designed as a short-term assay to evaluate treatments effects on early vegetative Cd uptake and soil chemical responses, whereas field experiments assessed final agronomic relevance through grain Cd at harvest. Pot experiments were conducted in Changsha, China, from May to June 2023 using paddy soil collected from the field trial site in Yiyang, Hunan Province. Each plastic pot (30 cm diameter × 25 cm height) contained 7 kg dry soil. Rice seedlings (Oryza sativa L. cv. Zhuliangyou) were pre-germinated in water and cultured hydroponically in half-strength Kimura B solution for 10 d. Six uniform two-leaf seedlings were transplanted into each pot. Seven treatments were established: BG (1/10 BG11 medium, shaded), BGP (1/10 BG11 medium, unshaded), BGS (T003 cultured in 1/10 BG11), SW (1/10 swine wastewater, shaded), SWP (1/10 swine wastewater, unshaded), SWS (T003 cultured in 1/10 swine wastewater), and OH (1/10 BG11 adjusted to pH 10 with NaOH, shaded). For BGS and SWS treatments, T003 microalgae cells were precultured in 1/10 BG11 medium or 1/10 diluted rough swine wastewater to reach number cell of about 3 × 10⁹L^-1, pH value around 10. To suppress indigenous periphyton growth in shaded treatments (BG, SW, OH), pots were covered with black polyethylene film perforated at planting positions. Treatments were applied every 2 d to maintain a standing water layer of 3–4 cm above the soil surface.

After one month, Cd content in the above-ground plant tissues was measured by atomic absorption spectrometry. To test whether microalgae method affect the pH value and Cd phytoavailability of soil, soil samples before and after treatment were collected and air dried. Soil samples were then ground to pass through a 2 mm stainless sieve. The soil pH was measured in a water suspension using a soil: sdH₂O ratio of 2:5 (w/w) by a pH meter³⁶. Chemical forms of Cd were studied using Tessier sequential extraction method³⁷.

Field trials were conducted during the 2023 rice-growing season in Heshan District, Hunan Province, China. Based on pot experiment results, microalgal cell T003 cultivated in swine wastewater was the most effective to cut down Cd accumulation in rice plants, two treatments were set and the field was divided into two sections: one irrigated with reservoir water (pH = 7), and the other with T003-enriched water (pH = 8.5) pre-grown in swine wastewater and transferred to a reservoir tank. Two rice cultivars (Wuxiangyou and Quanyou) also cultivated by local farmers were planted in the field experiment. After harvesting, rice grains were ground to fine powders and the Cd contents of rice grains were analyzed with the atomic absorption spectrometry method. Soil Cd fraction and pH were analyzed as described above.

Statistical analysis

All the experiments were performed with three replicates to ensure reliability of results. Significant difference (P < 0.05) among treatments were determined by one-way ANOVA test or by unpaired Student’s T-test using GraphPad Prism 10.

Results

Isolation and identification of Cd-tolerant microalgae

As we know, Cd is not necessary for organism living. Most microalgae undergo cell morphological and metabolic changes under Cd stress³⁸. To find microalgae strains could be tolerant Cd and used for Cd bioremediation, microalgae were isolated from a Cd-containing aqueous system exposed to natural airborne colonization to enrich Cd-tolerant strains. Three isolates belonging to Chlorophyta were obtained. Based on morphological characteristics and 18 S rRNA gene sequencing, two strains were identified as Chlorella sorokiniana and designated T003 and T004., while the third strain was identified as Chlamydomonas sp. (T002). The 18 S rRNA sequence of T003 showed 100% similarity to C. sorokiniana strain NONOO1 (accession MF101221) and strain KU-1019 (KF444207), while T004 exhibited 97% similarity to reported C. sorokiniana sequences, confirming their taxonomic affiliation.

Growth response of microalgae under Cd stress

To further test the Cd tolerance of three isolated microalgae strains, purchased Chlorella vulgaris FACHB-8 and previously isolated Parachlorella kessleri T001 were also exposed to series concentration of Cd²⁺ (0, 5, 10, 25, and 50 mg L^− 1) for 9 days (Fig. 1). Biomass was monitored by OD₆₈₀. In the absence of Cd, all strains exhibited substantial growth, with C. sorokiniana T003 showing the highest biomass accumulation (OD₆₈₀ = 0.642 ± 0.001 at day 9). With increasing Cd concentrations, growth inhibition was observed across all strains.

Fig. 1.

Growth dynamics of microalgae strains under Cd stress.

At 5 mg L⁻¹ Cd²⁺, growth was markedly reduced in most strains, whereas T003 and T004 continued to grow, although at a lower rate. In contrast, P. kessleri T001, Chlamydomonas sp. T002, and C. vulgaris showed minimal growth under this condition.

At 10 mg L⁻¹ Cd²⁺, T003 and T004 maintained limited growth (OD₆₈₀ ≈ 0.18 at day 9), while the other strains exhibited near-complete growth inhibition. At higher concentrations (25 and 50 mg L⁻¹ Cd²⁺), growth was strongly suppressed in all strains. Notably, T003 showed slight but detectable growth at 25 mg L⁻¹ Cd²⁺, whereas the remaining strains exhibited negligible biomass accumulation.

These results indicate that C. sorokiniana T003 exhibited the highest Cd tolerance among the tested strains, maintaining measurable growth up to 25 mg L⁻¹ Cd²⁺.

Growth curves of five microalgae strains (Parachlorella kessleri T001, Chlamydomonas sp. T002, Chlorella sorokiniana T003, C. sorokiniana T004, and C. vulgaris) exposed to increasing concentrations of Cd²⁺ over a 9-day period. Microalgae biomass (OD₆₈₀) was monitored to assess the growth. Error bars represent the standard deviation from triplicate experiments.

Cd removal efficiency of microalgae strains in aqueous systems

The Cd²⁺ removal performance of the five tested microalgal strains was evaluated by time-course analysis at 20 mg L⁻¹ Cd²⁺ and by concentration-gradient experiments at initial Cd²⁺ concentrations of 5, 10, 25, and 50 mg L⁻¹ following 3 d exposure (Fig. 2).

Fig. 2.

Cd removal efficiency and residual concentration in five microalgae strains.

To characterize removal kinetics, residual Cd²⁺ concentration and removal efficiency were measured at 0.5, 1, 3, 6, 24, 48, and 72 h after exposure to 20 mg L⁻¹ Cd²⁺ (Fig. 2a, b). Cd removal by all strains approached equilibrium within approximately 24 h. Parachlorella kessleri T001 and Chlorella vulgaris exhibited similar removal patterns but lower overall efficiencies than the C. sorokiniana strains. Chlamydomonas sp. T002 showed the slowest removal kinetics and the highest residual Cd²⁺ concentration after 72 h (12.364 ± 0.326 mg L⁻¹). No significant difference in removal efficiency was observed between C. sorokiniana T003 and T004, both of which removed approximately 90% of Cd²⁺ within 24 h.

Cd removal efficiency varied with initial Cd²⁺ concentration and strain identity (Fig. 2c, d). At 5, 10, and 25 mg L⁻¹ Cd²⁺, T003 and T004 consistently achieved removal efficiencies above 90%. At 50 mg L⁻¹ Cd²⁺, removal efficiency of both strains declined to approximately 62%, with residual Cd²⁺ concentrations of ~ 18.8 mg L⁻¹ after 3 d treatment. In contrast, P. kessleri T001 and C. vulgaris exhibited intermediate removal efficiencies across the tested concentrations, whereas Chlamydomonas sp. T002 showed the lowest removal performance throughout. Given their superior Cd tolerance and removal performance, C. sorokiniana T003 and T004 were selected for subsequent evaluation in paddy-related application experiments.

Five microalgae strains (Parachlorella kessleri T001, Chlamydomonas sp. T002, Chlorella sorokiniana T003, C. sorokiniana T004, and C. vulgaris) were exposed to 20 mg L^− 1 Cd²⁺. Their Cd removal efficiency (a) and the residual Cd (b) in the medium were monitored at 0.5 h, 1 h, 3 h, 6 h, 24 h, 48 h, and 72 h.

The Cd²⁺ removal efficiency (c) and residual Cd²⁺ concentration (d) were also evaluated at varying initial Cd²⁺ concentrations (5, 10, 25, and 50 mg L^− 1).

Data are presented as mean ± standard deviation, and different letters indicate significant differences (p < 0.05) between groups by one-way ANOVA analysis.

Growth ofChlorella sorokinianain swine wastewater

Due to their excellent Cd tolerance and remove capacity in the tests, C. sorokiniana T003 and T004 were selected as candidates for Cd bioremediation in rice paddies. Based on previous studies and our findings, some C. sorokiniana strains could survive and propagate in swine wastewater. Microalgal biomass production was achieved through the utilization of nutrients in wastewater³⁹. Swine manure wastewater is readily available in southern China, a region known for its large-scale pig farming, and it poses significant environmental risks. Therefore, utilizing swine wastewater for microalgae biomass production offers a sustainable and low-cost solution, providing both an effective means of wastewater treatment and a method for producing valuable biomass for bioremediation purposes.

C. sorokiniana T003 and T004 were cultivated in filtered raw swine wastewater with high COD, NH₄⁺-N, and TP levels (initial concentration 1280, 250, and 47 mg L^− 1, respectively). Marked differences in growth performance were observed between the two strains (Fig. 3). C. sorokiniana T003 exhibited robust proliferation in swine wastewater, reaching a cell density of 1.5 × 10¹¹ cells L⁻¹ after 9 d of cultivation. In contrast, T004 showed minimal growth, with only slight increases in cell concentration over the cultivation period. Given their comparable Cd removal performance in aqueous systems but contrasting growth responses in swine wastewater, T003 was selected for subsequent pot and field experiments.

Fig. 3.

Growth dynamics of strains Chlorella sorokiniana T003 and T004 in real swine wastewater.

Strain T003 exhibits significant growth, particularly after day 6, with cell numbers reaching approximately 1.41 × 10¹¹±3.23 × 10¹⁰ cells L^-1 by day 9. In contrast, strain T004 shows minimal growth throughout the experiment, with cell numbers remaining relatively stable around 2.5 × 10¹⁰ cells L^-1. Error bars represent standard deviations from triplicate measurements.

Pot-scale screening of microalgal treatments on soil pH, Cd fractionation, and rice shoot Cd accumulation

A one-month pot experiment was conducted to screen the effects of different microalgal-related treatments on soil pH, Cd fractionation, and rice Cd uptake at the vegetative stage. Seven treatments were included: diluted BG11 medium (BG), alkalized BG11 medium adjusted with NaOH (OH), BG11-induced periphyton (BGP), pre-cultured T003 in BG11 medium (BGS), diluted swine wastewater (SW), swine wastewater-induced periphyton (SWP), and pre-cultured T003 in swine wastewater (SWS).

The untreated paddy soil had an initial pH of 5.610 ± 0.010, indicating acidic soil conditions (Fig. 4a). After one month, all treatments increased soil pH to varying extents. The OH treatment produced the highest pH (6.813 ± 0.057), followed by SWS (6.597 ± 0.078) and BGS (6.437 ± 0.006). Other treatments caused smaller but detectable increases relative to the untreated soil. Although T003 cultures reached strongly alkaline conditions in liquid medium (Fig. S2), soil pH increased by approximately 0.8–1.2 units after application, indicating substantial buffering by the paddy soil matrix.

Fig. 4.

Effects of soil amendments and microalgae treatment on Cd content in rice plants and grains, and soil pH in pot and field experiments. (a) Cd content in rice shoots and (b) soil pH under various soil amendments in the pot experiment. (c) Cd content in rice grains and (d) soil pH in the field experiment comparing microalgae-treated and control plots. Different letters within same column indicate significant difference among different treatments at p < 0.05, while same letters represent no significant difference. * indicates significant difference between two groups by T-test.

The same homogenized soil batch was used as the baseline material for both pot and field experiments; therefore, identical pre-treatment Cd fraction values are presented in Tables 1 and 2 for comparison across experimental scales. Sequential extraction showed that exchangeable Cd, the most bioavailable fraction, decreased in all treatments relative to the untreated soil (Table 1). The greatest reduction was observed in the OH treatment, where exchangeable Cd declined from 0.155 ± 0.002 to 0.117 ± 0.004 mg kg⁻¹ which is consistent with the soil pH result as an increase in soil pH induces the reduction of bioavailable Cd content^40–42. Other treatments showed similar exchangeable Cd values ranging from 0.123 to 0.132 mg kg⁻¹. In contrast, carbonate-bound, Fe–Mn oxide-bound, organic matter-bound, and residual Cd fractions varied only slightly among treatments.

Table 1.

Fractionation of soil Cd before and after treatment in the pot experiment.

Cd fractionation (mg kg⁻¹)	Exchangeable	Bound to carbonates	Bound to iron and manganese oxides	Bound to organic matter	Residual
BG	0.128 ± 0.003 b	0.054 ± 0.006 a	0.046 ± 0.0005 a	0.011 ± 0.0009 a	0.029 ± 0.0008 c
BGP	0.123 ± 0.003 b	0.049 ± 0.001 a	0.043 ± 0.0005 a	0.010 ± 0.0004 a	0.028 ± 0.0009 d
BGS	0.129 ± 0.002 b	0.056 ± 0.002 a	0.045 ± 0.0008 a	0.011 ± 0.0015 a	0.031 ± 0.0002 c
SW	0.127 ± 0.001 b	0.051 ± 0.003 a	0.040 ± 0.0004 a	0.011 ± 0.0002 a	0.031 ± 0.0007 c
SWP	0.132 ± 0.003 b	0.049 ± 0.0004 a	0.042 ± 0.0014 a	0.010 ± 0.0002 a	0.031 ± 0.0013 c
SWS	0.129 ± 0.006 b	0.052 ± 0.003 a	0.043 ± 0.0009 a	0.010 ± 0.000 a	0.032 ± 0.0002 b
OH	0.117 ± 0.004 c	0.054 ± 0.003 a	0.043 ± 0.0018 a	0.011 ± 0.0002 a	0.032 ± 0.0005 b
before	0.155 ± 0.002 a	0.044 ± 0.006 a	0.044 ± 0.0017 a	0.013 ± 0.0024 a	0.037 ± 0.0010 a

Table 2.

Fractionation of soil Cd in the field experiments.

Cd fractionation (mg kg⁻¹)	Exchangeable	Bound to carbonates	Bound to iron and manganese oxides	Bound to organic matter	Residual
microalgae	0.078 ± 0.006 c	0.065 ± 0.001 b	0.038 ± 0.003 a	0.008 ± 0.0001 b	0.034 ± 0.001 a
control	0.121 ± 0.003 b	0.082 ± 0.009 a	0.062 ± 0.019 a	0.016 ± 0.004 a	0.036 ± 0.0001a
before	0.155 ± 0.002 a	0.044 ± 0.006 c	0.044 ± 0.002 a	0.013 ± 0.002 a	0.037 ± 0.001 a

Rice shoot Cd concentration at the vegetative stage differed significantly among treatments (Fig. 4b). Despite exhibiting the highest soil pH and lowest exchangeable Cd fraction, the OH treatment showed the highest shoot Cd concentration (0.054 ± 0.0008 mg kg⁻¹), followed by BG (0.049 ± 0.008 mg kg⁻¹). The lowest shoot Cd concentration was observed in the SWS treatment (0.013 ± 0.001 mg kg⁻¹), representing a 75.9% reduction relative to the OH treatment. Intermediate Cd concentrations were detected in BGP, BGS, SW, and SWP, with no significant differences among these treatments (p > 0.05). Based on its superior performance, the SWS treatment was selected for subsequent field validation.

Field validation of microalgae application on soil pH, Cd fractionation, and rice grain Cd accumulation

Based on pot-scale screening, the T003–swine wastewater treatment (SWS) produced the greatest reduction in rice Cd accumulation and was therefore selected for field-scale validation. Field experiments compared this treatment with conventional irrigation under practical agronomic conditions, using grain Cd concentration at harvest as the final food-safety endpoint.

Consistent with the pot experiment, microalgae-treated plots showed significantly increased soil pH at harvest (6.110 ± 0.221) compared with both conventionally irrigated control plots (5.443 ± 0.118) and pre-planting soil (5.602 ± 0.221) (p < 0.05) (Fig. 4d).

Sequential extraction indicated substantial changes in soil Cd fractionation following microalgae treatment (Table 2). Exchangeable Cd decreased from 0.155 ± 0.002 mg kg⁻¹ before planting to 0.078 ± 0.006 mg kg⁻¹ after microalgae treatment, corresponding to a 49.7% reduction. Carbonate-bound Cd was also lower in microalgae-treated soil (0.065 ± 0.001 mg kg⁻¹) than in the conventionally irrigated control (0.082 ± 0.009 mg kg⁻¹). Similar decreases were observed for Fe–Mn oxide-bound and organic matter-bound Cd fractions, whereas residual Cd remained stable across treatments (0.034–0.037 mg kg⁻¹).

Two locally cultivated rice varieties, Wuxiangyou and Quanyou, were evaluated in the field trial. Grain Cd concentrations were significantly reduced by microalgae treatment in both cultivars (Fig. 4c). In Wuxiangyou, grain Cd decreased from 0.128 ± 0.006 to 0.035 ± 0.009 mg kg⁻¹, representing a 72.7% reduction. In Quanyou, grain Cd decreased from 0.223 ± 0.007 to 0.003 ± 0.002 mg kg⁻¹, corresponding to a 98.7% reduction. These results demonstrate that application of C. sorokiniana T003 cultivated in swine wastewater effectively reduced rice grain Cd accumulation under field conditions.

Data are expressed as mean±standard deviation (n = 3). Different letters within same column indicate significant difference among different treatments at p < 0.05, while same letters represent no significant difference.

Data are expressed as mean±standard deviation (n = 3). Different letters within same column indicate significant difference among different treatments at p < 0.05, while same letters represent no significant difference.

Discussion

Chlorella sorokinianaT003 exhibited strong Cd tolerance and practical applicability for wastewater-based biomass production

Among the isolated strains, Chlorella sorokiniana T003 combined high Cd tolerance, efficient Cd removal, and robust growth in untreated swine wastewater, supporting its suitability for subsequent application in paddy remediation. T003 maintained growth at Cd concentrations up to 25 mg L⁻¹ and removed more than 90% of dissolved Cd at 5–25 mg L⁻¹, while retaining 62% removal efficiency at 50 mg L⁻¹. These values compare favorably with previously reported Chlorella strains used for Cd remediation^43,44.

Cd removal in Chlorella species is generally attributed to surface biosorption via functional groups (carboxyl, hydroxyl, amino), intracellular sequestration, and metallothionein-like proteins^4345,46;. Although adsorption and intracellular partitioning were not independently quantified here, the high removal efficiency and sustained growth under Cd stress suggest coordinated tolerance and binding mechanisms. These characteristics make T003 a strong biological candidate for Cd mitigation in flooded paddy systems.

The ability of T003 to proliferate in raw swine wastewater is notable because such wastewater typically contains elevated ammonium, high organic loading, and fluctuating salinity, all of which can inhibit algal growth. In contrast to T004, which showed limited growth, T003 reached 1.5 × 10¹¹ cells L⁻¹ after 9 d in untreated wastewater. This difference suggests that Cd tolerance alone is insufficient to predict field applicability, and that wastewater adaptability is an important engineering criterion when selecting strains for integrated remediation systems.

Microalgae application increased soil pH and reduced exchangeable Cd, but alkalization alone did not explain reduced plant Cd uptake

Soil acidification is a major driver of Cd bioavailability in rice paddies, as discussed in the Introduction. Application of T003-cultured biomass increased paddy soil pH in both pot and field experiments, consistent with the known alkalizing effect of photosynthetic microalgae. Although liquid cultures reached pH values above 10 (Fig. S2), soil pH increased by only approximately 0.8–1.2 units after application, indicating substantial buffering by the soil matrix. This attenuation likely reflects proton exchange with soil colloids, carbonate re-equilibration, and nitrification of residual ammonium introduced with wastewater^30,47,48, although these processes were not quantified in the present study.

The observed pH increase was accompanied by a reduction in exchangeable Cd, particularly under field conditions where exchangeable Cd decreased by nearly 50%. Because exchangeable Cd represents the most readily plant-available fraction, this shift likely contributed to the reduced Cd accumulation observed in rice grain. Similar pH-dependent immobilization of Cd has been widely reported in acidic paddy soils^49–53.

However, the NaOH treatment produced the highest soil pH and the lowest exchangeable Cd fraction in the pot experiment, yet resulted in the highest rice shoot Cd concentration. This inconsistency suggests that the short duration of the pot experiment may not have been sufficient for chemically induced alkalization to fully translate into reduced plant Cd uptake. Although NaOH rapidly increased bulk soil pH, the associated changes in Cd partitioning and root-zone equilibrium may require longer periods to influence plant uptake under flooded soil conditions. Accordingly, short-term chemical alkalization alone may not immediately reduce Cd accumulation in rice tissues despite measurable changes in bulk soil chemistry. These observations suggest that Cd uptake was governed by multiple interacting factors beyond bulk alkalization alone.

Coupling microalgae cultivation with swine wastewater improved remediation performance and supports integration into crop–livestock systems

In southern China, swine wastewater is commonly recycled to paddy fields as part of crop–livestock integration strategies, yet direct application may introduce excessive nutrient loads. In this study, wastewater was first used as a cultivation medium for T003, converting dissolved nutrients into functional biomass prior to field application.

In the pot experiments, the combined treatment using T003 cultivated in swine wastewater resulted in the lowest Cd accumulation in rice tissues. Field trials similarly showed significantly reduced grain Cd concentrations compared with conventional irrigation. These findings indicate that nutrient recycling through wastewater utilization can be coupled with effective heavy metal risk mitigation.

Previous studies have shown that microalgae and bacteria in wastewater form symbiotic systems, in which the presence of microalgae reshapes bacterial community structure. Our results are consistent with this pattern and further suggest that the community was shifted toward specific functional groups (Fig. S3). In particular, microalgal cultivation increased the relative abundance of biofilm-forming bacteria, which may enhance local alkalization and promote Cd bioadsorption at the water–soil interface^28,54,55. Additionally, the application of swine wastewater may introduce exogenous microorganisms into soil, potentially increasing microbiome diversity. Given that soil microbial communities are known to influence plant responses to Cd stress and regulate Cd uptake^56–58, such shifts may contribute indirectly to reduced Cd accumulation in rice. However, the reuse of swine wastewater also carries potential ecological risks, particularly the dissemination of pathogenic microorganisms. Therefore, appropriate pretreatment and risk assessment are necessary to ensure environmental safety in practical applications^59–61.

The performance of the SWS treatment relative to other pot treatments may reflect multiple contributing factors. In addition to providing microalgal biomass, wastewater cultivation may alter biomass composition or extracellular matrix characteristics, potentially affecting Cd binding and persistence after soil application. However, these mechanisms were not directly measured and require further investigation.

Practical implications and limitations

Compared with conventional amendments such as lime or biochar, which primarily immobilize Cd through chemical reactions and often require repeated application, the present approach combines biomass production, wastewater utilization, and Cd mitigation within a single biologically mediated process. Although no formal economic analysis was conducted, the use of locally available swine wastewater as cultivation medium may reduce dependence on synthetic algal media and improve operational feasibility in livestock-intensive agricultural regions.

Several limitations should be acknowledged. First, although filtered raw swine wastewater was used in this study, potential biosafety concerns associated with manure-derived pathogens or antimicrobial resistance genes were not assessed and warrant evaluation before large-scale implementation. Second, the mechanistic basis for the divergence between NaOH and microalgae treatments remains unresolved and should be examined through rhizosphere-scale measurements in future work. Third, long-term field trials are needed to determine whether the observed reductions in grain Cd are stable across growing seasons and repeated applications.

Overall, the present results demonstrate that C. sorokiniana T003 cultivated in swine wastewater can reduce Cd accumulation in rice under field conditions and may represent a promising biological strategy for Cd management in acidified paddy soils.

Conclusion

In conclusion, Chlorella sorokiniana T003 exhibited strong Cd tolerance, efficient Cd removal capacity, and robust growth in untreated swine wastewater, supporting its suitability for wastewater-based biomass production. Application of swine wastewater-cultivated T003 increased soil pH, reduced exchangeable Cd fractions, and significantly decreased Cd accumulation in rice under both pot and field conditions. These findings demonstrate the feasibility of coupling swine wastewater utilization with microalgal remediation to mitigate Cd accumulation in rice grown on contaminated paddy soils. This approach provides a biologically based alternative for Cd risk management in rice production systems, particularly in livestock-intensive agricultural regions.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Ying Tan: Conceptualization, Methodology, Investigation, Validation, Formal analysis, Funding acquisition, Writing-original draft. Lianfu Tian and Dongping Li: Conceptualization, Funding acquisition, Supervision, Writing-review&editing. Gongmin Yu, Haixia Xu, Ying Wang, Sili Ying, Tanfei Dai, Mingyang Zhong, Juanjuan Tang and Zhihua Xie: Methodology, Investigation, Validation, Formal analysis.

Funding

This study was sponsored by grants from the National Nature Science Foundation of China (32071930), the key Project of Developmental Biology and Breeding from Hunan Province (2000XKQ0203), Project of Hunan Provincial National Nature Science Foundation (2021JJ30445; 2022JJ30421; 2023JJ40429), Project of Changsha Municipal Natural Science Foundation (kq2208164), Scientific Research Foundation of Hunan Provincial Education Department (24B0055), National Undergraduate Training Programs for Innovation and Entrepreneurship (S202310542047).

Data availability

The datasets used and analysed during the current study available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.