Abstract
Background
Vital pulp therapy (VPT) aims to preserve pulp vitality and stimulate regeneration of the dentin–pulp complex. Dental pulp stem cells (DPSCs) are clonogenic mesenchymal stem cells with high self-renewal and multipotent differentiation capacity. Bioactive cements such as mineral trioxide aggregate (MTA) and calcium-enriched mixture (CEM) are widely used as pulp-capping agents due to their biocompatibility. Platelet-rich fibrin (PRF), an autologous fibrin matrix rich in cytokines and growth factors, has been used to support tissue healing and regeneration.
Methods
Human third-molar DPSCs were isolated and characterized, then cultured with MTA, CEM, and combinations of cement with PRF. Cell viability was assessed using the MTT assay, and expression of pluripotency markers (OCT4, SOX2, NANOG) was quantified by real-time PCR.
Results
MTT assays showed that CEM alone significantly reduced DPSC viability compared to control, whereas MTA and MTA + PRF did not differ from control. Notably, co-treatment with PRF attenuated CEM's adverse effect. NANOG was significantly upregulated in the MTA and MTA + PRF groups relative to control, and SOX2 was significantly elevated in the MTA + PRF group. OCT4 remained unchanged across all conditions.
Conclusion
The combination of MTA and PRF enhanced DPSC survival and upregulated pluripotency markers (NANOG, SOX2), supporting its potential application in regenerative VPT. In contrast, CEM alone had a detrimental effect on cell viability; however, this adverse effect was attenuated by PRF co-application. These findings suggest that MTA + PRF is a promising pulp-capping strategy for preserving DPSC function and promoting pulp regeneration.
Keywords: Dental pulp stem cells, Regenerative endodontics, Platelet-rich fibrin, Mineral trioxide aggregate, Calcium-enriched mixture cement, Cell viability, Pluripotency gene expression
Highlights
-
•
MTA preserved DPSC viability; CEM alone reduced cell survival significantly.
-
•
PRF mitigated CEM toxicity and synergized with MTA for optimal outcomes.
-
•
MTA + PRF upregulated NANOG and SOX2, preserving DPSC stemness properties.
-
•
Combined MTA + PRF creates bioactive microenvironment supporting regeneration.
-
•
MTA + PRF is promising for vital pulp therapy; caution advised with CEM alone.
1. Introduction
The pulp and dentin of a tooth form a connected living system that supplies nutrients, nerve signals, and immune protection to the tooth. Maintaining the health and vitality of the pulp is crucial for the long-term survival and proper functioning of the tooth [1]. When pulp tissue is damaged or exposed to infection (from tooth decay, injury, or other causes), vital pulp therapy tries to stop disease progression while maintaining the remaining healthy pulp tissue [2]. Procedures like direct pulp capping and pulpotomy are designed to save the living pulp so that the root can continue to develop and new dentin can form [3]. By preserving the pulp's ability to regenerate, these methods can prevent the pulp from dying and avoid the need for root canal treatment [4].
Dental pulp stem cells (DPSCs) are critical to this regenerative mechanism. Located within the dental pulp, DPSCs are bone-marrow-like stem cells that grow rapidly and can develop into different cell types [5]. They carry typical markers found on mesenchymal stem cells and have the capacity to become various specialized cells [6]. Laboratory and living-organism studies have shown that DPSCs can transform into cells similar to odontoblasts (cells that make dentin) and create tooth-like mineralized tissue under the right circumstances [7]. DPSCs are attractive candidates for tissue engineering of the pulp-dentin unit because they expand quickly and can differentiate into multiple cell types [8]. In controlled laboratory settings, DPSCs can be encouraged to form dentin, bone, cartilage, fat tissue, or even nerve tissue [9]. Using this inherent capacity of DPSCs to change into different cell types is therefore essential for regenerative dental treatments [10].
Presently, mineral trioxide aggregate (MTA) and calcium-enriched mixture (CEM) cement are the primary bioactive cements used in pulp-capping procedures [11]. MTA is a cement derived from calcium silicate compounds; when combined with water, it releases calcium ions that react with phosphate ions to form a mineral compound that closely resembles natural bone mineral [12]. This reaction creates a strong seal and is well-tolerated by tissues. MTA's alkaline nature and excellent sealing properties trigger the formation of hard tissue (dentin) when it contacts living pulp tissue and simultaneously prevent bacterial growth. However, MTA has some drawbacks: it requires a long time to harden (roughly 2-3 h), it is difficult to work with, it is expensive, and it can sometimes cause discoloration of the tooth [13]. CEM is a more recently developed calcium-containing endodontic material made up of calcium oxide, calcium phosphate, and related compounds [14]. CEM has advantages including a quicker setting time and the ability to kill bacteria, and like MTA, it promotes the growth of hard tissues in pulp tissue [11]. Clinical evidence has demonstrated that CEM works as well as MTA for direct pulp capping; for instance, studies show that CEM and MTA have similar success rates at preserving the pulp's vital functions, and both are superior to calcium hydroxide [15]. Due to their beneficial interactions with tissues and regenerative properties, both MTA and CEM are employed as pulp-capping agents, even though each has certain limitations regarding ease of handling and setting characteristics [11].
Platelet-rich fibrin (PRF) has emerged as a promising biological addition to enhance pulp regeneration [1]. PRF is created from a patient's own blood through a centrifugation process without chemical additives [16]. It contains a high level of platelets (which carry growth-promoting substances including PDGF, TGF-β, and VEGF), immune cells, and a thick network of fibrin protein [17]. PRF essentially functions as a natural storage unit that progressively releases growth-promoting proteins and cytokines to stimulate new blood vessel formation, encourage cell multiplication, and improve wound repair [18]. PRF has been widely used in oral surgery and gum disease treatment because of its tissue-building capabilities [19]. In dental root treatments, PRF has been employed in vital pulp procedures—for example, PRF layers have been positioned over pulp damage during pulpotomy or mixed with capping substances to enhance healing [1]. Research data indicates that PRF can trigger growth protein-mediated repair in pulp and tissues around the root tip, and early research shows positive outcomes for using PRF as an addition to pulp-capping treatments [20]. Altogether, PRF acts as a biologically active framework that might enhance cell survival and recruitment during vital pulp therapy [8].
A crucial concept in pulp regeneration is the preservation of DPSC “stemness” [21]. Core pluripotency genes such as OCT4, SOX2, and NANOG encode transcription factors that regulate self-renewal and multipotency in stem cells. These factors maintain the stem cell phenotype and the capacity for differentiation into multiple lineages [22,23]. DPSCs have been shown to express OCT4, SOX2, and NANOG at low levels, and higher expression of these markers is associated with enhanced proliferation and differentiation potential [24]. Thus, VPT strategies that preserve or boost the expression of pluripotency markers in DPSCs could improve regenerative outcomes [25]. In this context, combining growth factor–rich materials such as PRF with bioactive cements like MTA or CEM may favorably modulate DPSC biology.
2. Materials and methods
2.1. Ethical approval
This in vitro experimental study was approved by the Ethics Committee of Rafsanjan University of Medical Sciences (Approval No. IR.RUMS.REC.1401.110). All procedures involving human tissues were conducted in accordance with institutional and national ethical guidelines.
2.2. DPSC isolation and culture
Human DPSCs were isolated from impacted third molar teeth extracted from healthy donors (age 18–25 years) under aseptic conditions. Teeth were disinfected, and the pulp tissues were extracted and minced into small fragments. Tissue fragments were placed in 25-cm2 culture flasks containing DMEM/F-12 (Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12) supplemented with 10% fetal bovine serum (FBS; heat-inactivated) and 1% penicillin–streptomycin (100 U/mL penicillin and 100 μg/mL streptomycin; Shellmax, China). Cultures were incubated at 37°C in 5% CO2, and the medium was changed every 2–3 days. Upon reaching approximately 90% confluence, cells were detached with 0.25% trypsin–EDTA and subcultured. DPSCs at passages 3–6 were used for all experiments.
2.3. Immunophenotypic characterization
Cultured DPSCs were characterized by flow cytometry for mesenchymal stem cell (MSC) markers. Cells at passage 3 were immunostained with fluorochrome-conjugated antibodies against CD105 and CD90 (MSC-positive markers) and against CD34 and CD45 (hematopoietic markers, negative in MSCs). Stained cells were analyzed by flow cytometry to confirm a typical MSC immunophenotype [26].
2.4. Differentiation assays
The multipotency of DPSCs was verified by inducing adipogenic and osteogenic differentiation under standard conditions [27]. For adipogenesis, cells were cultured in DMEM containing 10% FBS, 100 nM dexamethasone, 50 μg/mL indomethacin, 10 μg/mL insulin, and 0.5 mM isobutylmethylxanthine. The induction medium was refreshed every 3 days, and after 21 days intracellular lipid accumulation was detected by Oil Red O staining. For osteogenesis, cells were cultured in DMEM with 10% FBS supplemented with 50 μg/mL ascorbic acid, 10 mM β-glycerophosphate, and 0.1 μM dexamethasone. The osteogenic medium was refreshed twice daily, and after 21 days mineralized matrix formation was visualized by Alizarin Red S staining.
2.5. Preparation of test materials (MTA, CEM cement, PRF)
MTA and CEM: ProRoot MTA (Dentsply Sirona) and CEM cement (BioniqueDent, Tehran, Iran) were prepared according to the manufacturers’ instructions under sterile conditions. The cement pastes were placed into sterile cylindrical molds (10 mm diameter, 1 mm thickness; approximate surface area 188.5 mm2, volume 78.5 mm3) and allowed to set for 24 h at 37°C in 5% CO2. After setting, the disks were pulverized into a powder. To standardize extract preparation following ISO 10993-12 guidance, 20 mg of set cement powder was incubated in 1 mL of DMEM (20 mg/mL) for 24 h at 37°C with gentle agitation. The extract was then centrifuged at 3000 × g for 10 min, and the supernatant was sterile-filtered through a 0.2 μm syringe filter. The filtrate (100% cement extract) was diluted to a final concentration of 1 mg/mL in culture medium for cell treatments. To control for potential assay interference (e.g., alkaline pH or ion release affecting MTT reduction), cell-free control wells containing only medium and cement extracts were included in all MTT assays; their absorbance values were subtracted from experimental wells.
PRF: Autologous PRF was prepared from venous blood of healthy volunteers. Three 10-mL blood samples (without anticoagulant) were collected and immediately centrifuged at 3000 rpm for 10 min at room temperature. The resulting PRF clot (the fibrin layer between the red blood cells and acellular plasma) was collected and incubated in 5 mL of DMEM for 24 h at 37°C to create a 100% PRF-conditioned medium. The PRF clot was then discarded, and the conditioned medium (100% PRF) was used directly or diluted 1:1 with culture medium to obtain 50% PRF. All PRF preparations were sterile-filtered before use.
2.6. Experimental grouping and exposure
DPSC cultures were divided into five experimental groups: untreated control, MTA extract alone, CEM extract alone, MTA extract + 50% PRF, and CEM extract + 50% PRF. For the combined treatment groups, cement extracts (1 mg/mL) and 50% PRF were applied simultaneously. Cells were exposed to these conditions for 72 h.
2.7. Cell viability assay
The viability of DPSCs in response to the test materials was assessed using the MTT assay. Cells were seeded into 96-well plates at a density of 5 × 103 cells per well and allowed to attach for 24 h under standard culture conditions (37°C, 5% CO2). After attachment, the culture medium was replaced with media containing the experimental treatments: MTA extract, CEM extract, MTA + PRF, and CEM + PRF. Untreated cells served as the control group. All treatments were performed in technical triplicates, and the entire experiment was repeated using DPSCs isolated from three different healthy donors (three independent biological replicates). Cells were incubated for 72 h.
After incubation, 20 μL of MTT solution (5 mg/mL in PBS) was added to each well, and plates were returned to the incubator for 4 h. The medium was then carefully removed, and the formazan crystals formed by viable cells were dissolved in 100 μL of dimethyl sulfoxide (DMSO). Absorbance was measured at 570 nm using a microplate reader. Background absorbance from cell-free control wells (medium + test materials) was subtracted for each condition. The cell viability for each group was calculated as a percentage relative to the control. All experiments were independently repeated three times.
2.8. Colony formation assay
The clonogenic capacity of DPSCs was assessed using a colony formation assay. DPSCs at passages 3–5 were seeded into 6-well plates at a density of 500 cells per well and allowed to adhere for 24 h. The medium was then replaced with experimental media corresponding to the study groups (control, MTA, CEM, MTA + PRF, CEM + PRF).
Cells were maintained under standard culture conditions (37°C, 5% CO2), with medium refreshed every 3 days. Colonies were allowed to form for 10–14 days. At the end of the incubation period, cells were washed with phosphate-buffered saline, fixed with 4% paraformaldehyde, and stained with 0.5% crystal violet.
Colonies containing more than 50 cells were counted under an inverted microscope. The clonogenic activity was expressed as the mean number of colonies per group. All experiments were performed in technical triplicates and repeated with three independent donor-derived DPSC lines (biological replicates).
2.9. RNA extraction and real-time PCR
Total RNA was extracted from DPSC pellets using RNX Plus reagent (Pars Azmun, Karaj, Iran) according to the manufacturer's protocol. Briefly, cells were lysed in RNX Plus, then chloroform was added and samples were centrifuged to separate the phases. The RNA-containing aqueous phase was collected, and RNA was precipitated with isopropanol, washed with 70% ethanol, and resuspended in RNase-free water. RNA concentration and purity were determined spectrophotometrically. One microgram of total RNA was reverse-transcribed into cDNA using an oligo-dT–primed cDNA synthesis kit (Pars Azmun).
Gene expression of the pluripotency markers OCT4, SOX2, and NANOG was quantified by real-time PCR using SYBR Green chemistry. Each 20 μL PCR reaction contained cDNA template, SYBR Green Master Mix, and specific primers. Thermal cycling conditions were: initial denaturation at 95°C for 120s, followed by 40 cycles of 95°C for 15s and 60°C for 15s (annealing/extension). Melt-curve analysis was performed to confirm specificity of amplification. Gene expression levels were normalized to a housekeeping gene and analyzed using the ΔΔCt method. Primer sequences for all targets are listed in Table 1. Gene expression was analyzed using three biological replicates, each with technical triplicates.
Table 1.
Primer sequences used for real-time PCR analysis.
| Gene | Forward 5′ to 3′ | Reverse 5′ to 3′ |
|---|---|---|
| SOX2 | TTGCTGCCTCTTTAAGACTAGGA | CTGGGGCTCAAACTTCTCTC |
| OCT4 | GCAAAACCCGGAGGAGTC | CCACATCGGCCTGTGTATATC |
| NANOG | CCAACATCCTGAACCTCAGC | GCTATTCTTCGGCCAGTTG |
| GAPDH | AATGGGCAGCCGTTAGGAAA | GCGCCCAATACGACCAAATC |
2.10. Statistical analysis
All experiments used DPSCs from three independent healthy donors (biological replicates, n = 3). Normality was assessed using the Shapiro–Wilk test. For comparisons among multiple groups, one-way ANOVA with Tukey's post hoc test was used for parametric data; Kruskal–Wallis with Dunn's post hoc was used for nonparametric data. A p-value <0.05 was considered statistically significant.
3. Results
3.1. Characterization of human dental pulp stem cells
Primary cultures obtained from human dental pulp attached to plastic surfaces and exhibited a spindle-shaped, fibroblast-like morphology characteristic of mesenchymal stem cells (Fig. 1). Cells formed uniform monolayers during expansion.
Fig. 1.
Morphology of isolated human dental pulp stem cells (DPSCs) at passage 3 (Original magnification ×40, scale bar of ∼100 μm). Cells exhibit characteristic spindle-shaped, fibroblast-like morphology typical of mesenchymal stem cells.
Flow cytometry confirmed the mesenchymal phenotype of the isolated cells (Fig. 2). DPSCs showed strong expression of MSC-associated surface markers CD90 and CD105, while lacking hematopoietic markers CD34 and CD45, indicating successful isolation of a mesenchymal stem cell population.
Fig. 2.
Flow cytometric characterization of DPSCs. Cells express mesenchymal stem cell markers CD90 and CD105 (>95% positive) while lacking hematopoietic markers CD34 and CD45 (<2% positive).
The multilineage differentiation capacity of the DPSCs was demonstrated under standard induction conditions. Following adipogenic induction, intracellular lipid vacuoles were observed by Oil Red O staining (Fig. 3A). Osteogenic induction produced calcium-rich mineralized nodules, confirmed by positive Alizarin Red S staining (Fig. 3B). These outcomes verified the multipotent nature of the isolated DPSCs.
Fig. 3.
Multilineage differentiation potential of DPSCs (Original magnification ×100, scale bar of ∼40 μm). (A) Adipogenic differentiation showing intracellular lipid vacuoles (Oil Red O staining, 21 days). (B) Osteogenic differentiation showing mineralized matrix deposition (Alizarin Red S staining, 21 days).
3.2. Effects of experimental materials on DPSC viability
Cell viability was evaluated using the MTT assay after 72 h of exposure to MTA, CEM, and their combinations with PRF (Fig. 4). No significant differences were seen between the control group and cells treated with MTA or MTA combined with PRF.
Fig. 4.
MTT assay assessing DPSC viability after 72 h exposure to test materials. CEM alone significantly reduced viability (p < 0.05 vs. control). MTA and MTA + PRF maintained control-level viability. PRF attenuated CEM cytotoxicity. Data represent mean ± SD (n = 3). p < 0.05 vs. control.
In contrast, treatment with CEM alone resulted in a statistically significant reduction in DPSC viability compared to the control group (p < 0.05). The addition of PRF to CEM partially restored cell viability; however, this improvement was not statistically significant relative to the control. These data indicate that MTA exhibits superior cytocompatibility toward DPSCs compared to CEM.
3.3. Colony-forming ability of DPSCs
The clonogenic potential of DPSCs was assessed by the colony formation assay (Fig. 5). Cells treated with CEM showed a significant decrease in colony number compared to the control group, consistent with the reduced viability observed with CEM.
Fig. 5.
Colony formation assay showing DPSC clonogenic capacity after 14 days.
The combination of CEM with PRF resulted in a higher number of colonies than CEM alone, suggesting a protective role of PRF in cell survival. DPSCs exposed to MTA, either alone or in combination with PRF, formed colonies in numbers comparable to or greater than those of the control group.
3.4. Expression of pluripotency-associated genes
In each experimental group, the relative mRNA expression of SOX2, OCT4, and NANOG was measured by real-time PCR (Fig. 6). The results for each gene are as follows:
Fig. 6.
Real-time PCR analysis of pluripotency gene expression. (A) SOX2 significantly upregulated in MTA + PRF (p < 0.05). (B) OCT4 unchanged across groups. (C) NANOG significantly increased in MTA and MTA + PRF groups (p < 0.01, **p < 0.001).
SOX2 Expression: As shown in Fig. 6A, SOX2 was significantly upregulated in DPSCs treated with MTA + PRF compared to the untreated control group (p < 0.05). Although SOX2 levels were slightly higher in the MTA-only, these increases were not statistically significant.
OCT4 Expression: No significant differences in OCT4 expression were observed among any of the groups relative to the control. A modest, non-significant increase in OCT4 was noted in the MTA + PRF group (Fig. 6B).
NANOG Expression: Exposure to MTA significantly increased NANOG expression compared to the control group (p < 0.01) (Fig. 6C). The highest NANOG level was observed in the MTA + PRF group, which was significantly greater than the control and all other groups (p < 0.001).
4. Discussion
In this study, we found that MTA alone and MTA + PRF markedly supported DPSC viability and clonogenic potential, whereas CEM alone significantly reduced both cell viability and colony formation. The high biocompatibility of MTA is well documented [12], and our results are consistent with this: DPSCs cultured with MTA showed robust survival and colony formation. Importantly, combining MTA with PRF produced the greatest increases in cell viability and colony number among all groups, indicating a biological synergy between MTA and PRF. Indeed, previous work showed that MTA combined with PRF (or PRF extract) synergistically enhances the odontoblastic differentiation of pulp cells via growth factor–mediated signaling [1,28]. In our system, PRF likely provided a fibrin scaffold and a sustained release of growth factors (e.g., PDGF, TGF-β) that amplified MTA's stimulatory effects on DPSCs. The result was not only higher viability and proliferation, but also enhanced maintenance of a stem-cell phenotype in the MTA + PRF group. Notably, this synergistic effect has been observed clinically: a recent randomized trial of direct pulp capping found that combining PRF with MTA yielded a ∼93% success rate and significantly greater reparative dentin bridge formation than MTA alone [29], supporting our in vitro findings. Biocompatibility should be interpreted beyond short-term metabolic viability alone. For pulp-regenerative materials, relevant endpoints also include cell adhesion, migration, inflammatory signaling, and differentiation/mineralization potential, because material formulation can produce distinct biological profiles even within the same cement class [30,31].
By contrast, CEM alone had an adverse effect on DPSCs. We observed a clear reduction in viability and colony formation with CEM, suggesting greater cytotoxicity or a harsher local environment compared to MTA. Although CEM is generally considered biocompatible, our findings indicate it may exert higher early toxicity in this context. This is consistent with recent data showing that MTA and Biodentine provide maximal DPSC biocompatibility, whereas CEM is somewhat less favorable [32]. Possible explanations include CEM's smaller particle size or its particular ion release (e.g., high alkalinity) that could stress cells. Crucially, however, adding PRF to CEM nearly restored DPSC viability and colony counts. The PRF matrix and its growth factors evidently attenuated CEM's adverse effects, similar to observations in other settings where PRF mitigates material toxicity. Notably, clinical studies indicate that CEM's efficacy rivals that of MTA: Parameswaran et al. reported 18-month success rates of 86.7% for CEM versus 77.3% for MTA in direct pulp capping of deep carious exposures [33], suggesting that in vivo regenerative processes may compensate for the initial biocompatibility differences observed in vitro. These observations align in part with Mohamed et al., who reported that both MTA and CEM support DPSC growth over time [34]; in our hands, the initial viability lag with CEM suggests dose- or time-dependent effects. Overall, while both MTA and CEM can be tolerated by DPSCs, CEM alone is less supportive of cell survival than MTA, and PRF can compensate for this deficit.
Moving beyond short-term viability, we interpret biocompatibility as a continuum that includes functional endpoints such as cell adhesion, migration, inflammatory signaling, and differentiation. In the present study, we did not directly measure these parameters; however, our observation that MTA + PRF upregulated pluripotency genes suggests that this combination may also favorably influence cell migration and reduce pro-inflammatory cues. Future studies should specifically assess DPSC adhesion/spreading on these material surfaces (e.g., by cytoskeletal staining), migration in scratch assays, and the secretion of inflammatory mediators (IL-6, IL-1β, TNF-α) or anti-inflammatory cytokines (IL-10, TGF-β). Such data would place “biocompatibility” in a more clinically relevant, regenerative context.
A particularly novel finding in our study was the differential expression of pluripotency-associated genes. In the MTA + PRF group we observed significant upregulation of NANOG and SOX2, whereas OCT4 levels remained unchanged. DPSCs inherently express key pluripotency factors such as OCT4, SOX2, and NANOG [35], which orchestrate their self-renewal and multi-lineage differentiation potential. Dental pulp stem cells are known to express these core stemness factors [36]. Upregulation of NANOG and SOX2 suggests that MTA + PRF helped preserve or enhance the cells’ stem-like state. In fact, Oct4/Nanog signaling acts as a critical switch for DPSC self-renewal and differentiation potential [36,37], and SOX2 overexpression has been shown to augment DPSC proliferation, migration, and adhesion [38]. Thus, the increased NANOG and SOX2 in our MTA + PRF-treated cells likely reflect a more primitive phenotype with higher regenerative potential. The lack of change in OCT4 may indicate that basal OCT4 levels were already sufficient, and that PRF specifically boosted NANOG/SOX2 pathways. In sum, the pattern of pluripotency marker expression suggests that MTA + PRF not only improves DPSC survival but also actively maintains the regenerative capacity of these cells.
These results have clear implications for vital pulp therapy. MTA is already considered a “gold standard” pulp-capping material due to its favorable interactions with pulp cells [28,32]. Our findings reinforce that MTA provides a supportive environment for DPSCs. More importantly, they suggest that adding PRF to MTA (or possibly to other capping agents) could further improve outcomes by promoting stem cell survival and maintaining stemness. PRF is a readily obtainable autologous material rich in growth factors, so an MTA + PRF strategy might be a practical way to enhance pulp regeneration in clinical settings. Conversely, the relative toxicity of CEM alone raises caution about its use without a biological adjunct. If CEM must be used, pairing it with PRF or another protective scaffold is advisable, as the PRF co-treatment clearly ameliorated CEM's adverse effects. In this way, our data highlight how combining a bioactive material (MTA) with a biological scaffold (PRF) can leverage synergistic effects for tissue regeneration. This concept of scaffold-assisted pulp healing is echoed in recent work, where scaffold incorporation into regenerative endodontic therapies significantly improved tissue healing and hard-tissue formation [1].
Our findings are largely supported by previous studies. Woo et al. demonstrated that MTA + PRF significantly upregulates odontoblastic markers (DSPP, DMP-1) and mineralization in human pulp cells via BMP/Smad signaling [28]. This aligns with our observation of enhanced DPSC viability and stemness gene expression with MTA + PRF. Similarly, Mohamed et al. reported that DPSCs cultured with MTA or CEM maintained proliferation over several days [34], consistent with the notion that both cements can support cell growth. Notably, recent clinical evidence corroborates these in vitro findings: Abuhashema et al. found that PRF + MTA direct pulp capping achieved a 92.6% success rate, with the PRF group exhibiting far more robust dentin bridge formation compared to MTA alone [29].
However, our finding of reduced viability with CEM alone is noteworthy. It is supported by Nazemi et al. (2024), who found that while MTA and Biodentine had maximal biocompatibility, CEM was slightly less favorable on human stem cells [32]. By contrast, Parameswaran et al. (2023) observed that CEM cement had comparable efficacy to MTA (86.7% vs 77.3% success) as a direct pulp capping agent [33], implying that clinical outcomes with CEM may equal or exceed those of MTA despite the in vitro differences. Thus, although our results differ in detail from some reports, they fit an overall pattern: calcium silicate cements generally permit DPSC viability (with MTA tending to be the most benign) [32], and biological adjuncts like PRF can amplify the regenerative effects of these materials [28].
Limitations: This study was entirely in vitro, which limits direct translation to clinical practice. In vivo, factors such as blood flow, immune responses, and tissue architecture also influence pulp healing. We tested only a few materials (MTA, CEM, and PRF) under one set of conditions; other promising cements (e.g., Biodentine, calcium phosphate cements) or scaffold materials (e.g., collagen, hyaluronic acid hydrogels) were not included. Moreover, we measured cell viability and stemness gene expression but did not assess functional differentiation (such as odontogenic marker expression) or long-term mineralization. We used PRF extract (conditioned medium) rather than intact PRF membranes, which simplifies the system. Additionally, DPSCs were derived from a limited number of donors, and stem cell responses can vary among individuals. Another limitation is that PRF was not tested as a separate experimental condition, so its independent effect cannot sbe determined from this study. These limitations mean our conclusions should be interpreted with caution.
Future Directions: To build on this work, future studies should examine whether the material-induced changes in stemness markers translate into enhanced tissue differentiation and healing. For example, it would be useful to evaluate odontoblastic gene expression (e.g., DSPP, DMP-1), perform mineralization assays, or measure angiogenic and neurotrophic factor release after treatment with MTA + PRF to clarify functional outcomes. Assessing inflammatory mediators (IL-6, TNF-α, IL-10) would also clarify the immunomodulatory profile of these combinations. In vivo experiments (such as animal models of pulp capping or pulpotomy) are also needed to determine whether MTA + PRF actually improves dentin bridge formation, pulp vitality, and sensory recovery compared to MTA alone. It would be valuable to optimize the concentration and delivery of PRF (or its derivatives like advanced-PRF, i-PRF) when used with these cements, and to test additional material combinations (for instance, Biodentine + PRF or MTA/PRF hybrids). Finally, studies on how these treatments affect DPSC secretion of cytokines, growth factors, and extracellular vesicles could reveal additional mechanisms of action. Collectively, such investigations will help establish whether the MTA + PRF synergy observed in vitro can be harnessed effectively in clinical regenerative endodontics.
5. Conclusions
MTA alone supported DPSC viability and stem cell marker expression, whereas combining MTA with PRF significantly enhanced these effects, indicating a synergistic biological interaction. CEM alone was comparatively detrimental to DPSC survival, but its adverse effects were largely compensated by PRF. These findings suggest that leveraging both bioactive cements and biologically active scaffolds may improve outcomes in vital pulp therapy. Future work is needed to translate these insights into optimized regenerative treatments.
Ethics approval and consent to participate
This study received ethical approval from the institutional review board under the code IR.RUMS.REC.1401.110.
Clinical trial number
Not applicable to this research.
Consent for publication
All contributing authors provided their consent for the publication of this work.
Authors' contributions
F.PMN. data analysis and wrote the manuscript; A.I. designed the research proposal, and collected data; R.A. designed the experiments, and supervised the project; P.A. designed the research proposal; A.YAP. performed the experiments and data analysis, contributed to manuscript preparation, and supervised the research.
Generative AI statement
During the preparation of this work the authors used ChatGPT (OpenAI, GPT-4 —web version) in order to polish and edit the language for readability. After using this tool, the authors reviewed and edited the content as needed and take full responsibility for the content of the published article.
Funding
Financial support for this project was provided by Rafsanjan University of Medical Sciences, Rafsanjan, Iran (Grant Number: 400262).
Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this research article.
Data availability
Data will be made available on request.
References
- 1.Rebimbas Guerreiro S., et al. Platelet-rich plasma and platelet-rich fibrin in endodontics: a scoping review. Int. J. Mol. Sci. 2025;26(12):5479. doi: 10.3390/ijms26125479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Colloc T.N., Tomson P.L. Vital pulp therapies in permanent teeth: what, when, where, who, why and how? Br. Dent. J. 2025;238(7):458–468. doi: 10.1038/s41415-025-8560-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Asgary S., Nosrat A. Vital pulp therapy: evidence-based techniques and outcomes. Iran. Endod. J. 2025;20(1):e2. doi: 10.22037/iej.v20i1.47141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Sabeti M., et al. Treatment outcomes of regenerative endodontic therapy in immature permanent teeth with pulpal necrosis: a systematic review and network meta‐analysis. Int. Endod. J. 2024;57(3):238–255. doi: 10.1111/iej.13999. [DOI] [PubMed] [Google Scholar]
- 5.Bae S., et al. Characterization of dental pulp stem cell responses to functional biomaterials including mineralized trioxide aggregates. J. Funct. Biomater. 2021;12(1):15. doi: 10.3390/jfb12010015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kok Z.Y., et al. Dental pulp stem cell heterogeneity: finding superior quality “needles” in a dental pulpal “haystack” for regenerative medicine‐based applications. Stem Cell. Int. 2022;2022(1) doi: 10.1155/2022/9127074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Azaryan E., et al. Dentin regeneration based on tooth tissue engineering: a review. Biotechnol. Prog. 2023;39(2) doi: 10.1002/btpr.3319. [DOI] [PubMed] [Google Scholar]
- 8.Sequeira D.B., et al. Scaffolds for dentin–pulp complex regeneration. Medicina. 2023;60(1):7. doi: 10.3390/medicina60010007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Chouaib B., Cuisinier F., Collart-Dutilleul P.-Y. Dental stem cell-conditioned medium for tissue regeneration: optimization of production and storage. World J. Stem Cell. 2022;14(4):287. doi: 10.4252/wjsc.v14.i4.287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Farjaminejad R., Farjaminejad S., Garcia-Godoy F. Regenerative endodontic therapies: harnessing stem cells, scaffolds, and growth factors. Polymers. 2025;17(11):1475. doi: 10.3390/polym17111475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Asgary S., Aram M., Fazlyab M. Comprehensive review of composition, properties, clinical applications, and future perspectives of calcium-enriched mixture (CEM) cement: a systematic analysis. Biomed. Eng. Online. 2024;23(1):96. doi: 10.1186/s12938-024-01290-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Camilleri J. Hydraulic calcium silicate‐based endodontic cements. Endodontic Advances and Evidence‐Based Clinical Guidelines. 2022:311–346. [Google Scholar]
- 13.Alshargawi W.K., et al. Clinical Applications of Mineral Trioxide Aggregate in Dental Procedures. J. Healthc. Sci. 2024;4:721–728. [Google Scholar]
- 14.Chaudhari P.S., et al. A breakthrough in the era of calcium silicate-based cements: a critical review. Cureus. 2022;14(8) doi: 10.7759/cureus.28562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Pinto K.P., et al. Success rate of direct pulp capping on permanent teeth using bioactive materials: a systematic review and meta-analysis of randomized clinical trials. Restor. Dent. Endod. 2024;49(4):e34. doi: 10.5395/rde.2024.49.e34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Shah M.J., et al. Platelet rich fibrin three-layer reconstruction of the sellar floor after endoscopic endonasal transsphenoidal approach: technical note and initial experience. Front. surg. 2024;11 doi: 10.3389/fsurg.2024.1500158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Baca-Gonzalez L., et al. Plasma rich in growth factors (PRGF) and leukocyte-platelet rich fibrin (L-PRF): comparative release of growth factors and biological effect on osteoblasts. Int. J. Implant Dent. 2022;8(1):39. doi: 10.1186/s40729-022-00440-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Alizadeh M., et al. Platelet-Rich Fibrin (PRF)-polymer composites for wound healing: macromolecular synergies, structural design, and therapeutic efficacy. ACS Appl. Bio Mater. 2025;8(10):8449–8466. doi: 10.1021/acsabm.5c01083. [DOI] [PubMed] [Google Scholar]
- 19.Chmielewski M., Pilloni A., Adamska P. Application of advanced platelet-rich fibrin in oral and maxillo-facial surgery: a systematic review. J. Funct. Biomater. 2024;15(12):377. doi: 10.3390/jfb15120377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Agrawal P., et al. Effectiveness of platelet concentrates in direct pulp capping: a systematic review. World. 2025;16(2):191. [Google Scholar]
- 21.Lampiasi N. The migration and the fate of dental pulp stem cells. Biology. 2023;12(5):742. doi: 10.3390/biology12050742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Chen G., et al. Regulation of embryonic stem cell self-renewal. Life. 2022;12(8):1151. doi: 10.3390/life12081151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Varzideh F., et al. Molecular mechanisms underlying pluripotency and self-renewal of embryonic stem cells. Int. J. Mol. Sci. 2023;24(9):8386. doi: 10.3390/ijms24098386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Nel S., et al. Determinants of dental pulp stem cell heterogeneity. J. Endod. 2022;48(10):1232–1240. doi: 10.1016/j.joen.2022.06.013. [DOI] [PubMed] [Google Scholar]
- 25.Rajasekar V., et al. Next-generation biomaterials for vital pulp therapy: exploring biological properties and dentin regeneration mechanisms. Bioeng. 2025;12(3):248. doi: 10.3390/bioengineering12030248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Tashakori M., et al. Effects of MRI on stemness properties of Wharton's jelly-derived mesenchymal stem cells. Cell Tissue Bank. 2023;24(3):523–533. doi: 10.1007/s10561-022-10052-2. [DOI] [PubMed] [Google Scholar]
- 27.Asadi F., et al. Aqueous extract of Achillea millefolium significantly affects mesenchymal stem cell renewal and differentiation in a dose dependent manner. J. Stem Cells Regen. Med. 2022;18(2):29. doi: 10.46582/jsrm.1802006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Woo S.-M., et al. Combination of mineral trioxide aggregate and platelet-rich fibrin promotes the odontoblastic differentiation and mineralization of human dental pulp cells via BMP/Smad signaling pathway. J. Endod. 2016;42(1):82–88. doi: 10.1016/j.joen.2015.06.019. [DOI] [PubMed] [Google Scholar]
- 29.Abuhashema R.A.I.H., et al. Clinical and radiographic assessment of mineral trioxide aggregate with platelet rich fibrin as pulp capping biomaterials: a 12-month randomized trial. Sci. Rep. 2025;15(1) doi: 10.1038/s41598-025-96056-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Rodríguez-Lozano F.J., et al. In vitro evaluation of novel resin-modified calcium silicate cements for minimally invasive vital pulp therapy. Int. Dent. J. 2026;76(1) doi: 10.1016/j.identj.2025.109299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Rodríguez-Lozano F.J., et al. In vitro evaluation of novel calcium silicate-based and resin-modified calcium silicate materials: cytocompatibility and mineralization potential on human dental pulp stem cells for pulp repair. Microsc. Res. Tech. 2026;89(6):932–947. doi: 10.1002/jemt.70121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Nazemi S.B., et al. Cytotoxic Effects of Pulp Capping Agents on Mesenchymal Stem Cells Isolated from Human Exfoliated Deciduous Teeth. J. Dent. 2024;4 doi: 10.30476/dentjods.2023.99173.2131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Parameswaran M., et al. Efficacy of calcium enriched mixture cement, mineral trioxide aggregate and calcium hydroxide used as direct pulp capping agents in deep carious lesions-a randomised clinical trial. Eur. Endod. J. 2023;8(4):253. doi: 10.14744/eej.2023.83007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Mohamed D.A., Abdelfattah M.I., Aboulezz E.H. The effect of three different biomaterials on proliferation and viability of human dental pulp stem cells (in-vitro study) Open Access Maced. J. Med. Sci. 2017;5(5):657. doi: 10.3889/oamjms.2017.089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Li Y., et al. Epigenetic control of dental stem cells: progress and prospects in multidirectional differentiation. Epigenetics Chromatin. 2024;17(1):37. doi: 10.1186/s13072-024-00563-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ballini A., et al. A comparative study on different stemness gene expression between dental pulp stem cells vs. dental bud stem cells. Eur. Rev. Med. Pharmacol. Sci. 2019;23(4):1626–1633. doi: 10.26355/eurrev_201902_17122. [DOI] [PubMed] [Google Scholar]
- 37.Huang C.-E., et al. Concurrent expression of Oct4 and Nanog maintains mesenchymal stem-like property of human dental pulp cells. Int. J. Mol. Sci. 2014;15(10):18623–18639. doi: 10.3390/ijms151018623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Liu P., et al. Effects of SOX2 on proliferation, migration and adhesion of human dental pulp stem cells. PLoS One. 2015;10(10) doi: 10.1371/journal.pone.0141346. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data will be made available on request.






